Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Molecular and Clinical Oncology
Join Editorial Board Propose a Special Issue
Print ISSN: 2049-9450 Online ISSN: 2049-9469
Journal Cover
November-December 2014 Volume 2 Issue 6

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
November-December 2014 Volume 2 Issue 6

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Expression of acidosis‑dependent genes in human cancer nests

  • Authors:
    • Toshihiko Fukamachi
    • Shunsuke Ikeda
    • Hiromi Saito
    • Masatoshi Tagawa
    • Hiroshi Kobayashi
  • View Affiliations / Copyright

    Affiliations: Graduate School of Pharmaceutical Sciences, Chiba University, Chuo‑ku, Chiba 260‑8675, Japan, Division of Pathology and Cell Therapy, Chiba Cancer Center Research Institute, Chuo‑ku, Chiba 260‑8717, Japan
  • Pages: 1160-1166
    |
    Published online on: July 11, 2014
       https://doi.org/10.3892/mco.2014.344
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

Previous studies investigating cancer cells cultured at acidic pH have shown that the expression level of ~700 genes were more than two‑fold higher than those of the cells cultured in alkaline medium at pH 7.5. The aim of the present study was to confirm whether these acidosis‑induced genes are expressed in human cancer tissues. Therefore, 7 genes were selected from our previous study, which encoded interleukin 32 (IL‑32), lysosomal H+ transporting ATPase, V0 subunit d2 (ATP6V0D2), tumor necrosis factor receptor superfamily, member 9 (TNFRSF9), amphiregulin, schwannoma‑derived growth factor (AREG), v‑erb‑b2 erythroblastic leukemia viral oncogene homolog 3 (ErbB3), PRR5‑ARHGAP8 (LOC553158) and dimethylglycine dehydrogenase (DMGDH), and their expression was examined in human clinical specimens from patients with cancer. In addition, the expression of the gene encoding manganese superoxide dismutase (MnSOD) was examined. The specimens from patients with colon, stomach and renal cancer showed increased MnSOD, IL‑32, and TNFRSF9 transcripts compared to those from non‑tumorous regions of the same patients. Notably, an elevated expression of ATP6V0D2 was found in the specimens from patients with stomach cancer, whereas the expression was decreased in those from patients with colon and renal cancer. The expression of LOC553158 was upregulated in colon and stomach cancer specimens. These results indicate that the investigation of gene expression under acidic conditions is useful for the development of novel cancer markers and/or chemotherapeutic targets.

Introduction

In the central regions of solid tumors, the extracellular pH falls below pH 6.5 as a consequence of lactate accumulation, which is caused by hypoxic conditions produced by a lack of sufficient vascularization (1,2) or an increase in tumor-specific glycolysis combined with impaired mitochondrial oxidative phosphorylation (3). Organ functions may be strongly affected by the disruption of the pH homeostasis as all the organs contain a large number of enzymes with pH-sensitive catalytic activity. Therefore, it can be argued that alternative metabolic processes are activated under acidic conditions to compensate for the decline in processes functioning at alkaline pH.

When various metabolic processes are working under different pH conditions, the efficacy of a number of inhibitors under acidic conditions may be different to those observed in conventional alkaline media. Impaired efficacy of paclitaxel, mitoxantrone and topotecan has been previously reported at pH 6.5 as compared to their efficacy at pH 7.4 in murine EMT6 and human MGH-U1 cells (4), and acidic conditions induced daunorubicin resistance by increasing the activity of p-glycoprotein via p38 activation in rat prostate cancer cells (5).

Malignant pleural mesothelioma is an aggressive tumor associated with asbestos exposure, and its prognosis is extremely poor (6). Mesothelioma shows resistance against numerous chemotherapeutic reagents (7). Our previous study found that statins inhibited the proliferation of mesothelioma cells strongly in an acidic medium with a pH that was close to the pH of an area of cancer in vivo (8). Statins, which are inhibitors of mevalonate synthesis, are prescribed for hyperlipidemia as the inhibition of mevalonate synthesis reduces blood cholesterol levels. However, the anti-cancer activity of statins has not been demonstrated in vitro. Recently, clinical studies have revealed that stains are effective at attenuating the growth of cancer cells in vivo (9,10), in agreement with our previous in vitro observations at acidic pH (8). A previous study has shown that the anticancer activity is caused by the inhibition of geranylgeranyl diphosphate, derived from mevalonate, indicated that the function of certain geranylgeranylated proteins is essential for cell proliferation under acidic conditions (8,11). In addition to the investigations with inhibitors, our previous studies found that different signal transduction pathways function under acidic environments (12,13), and that C-Terminus protein of IκB-β, which is an IκB-β variant, acted as a critical transcriptional regulatory factor at pH 6.3 only, and not at pH 7.4 (14,15).

These previous findings indicate that numerous proteins are functioning preferentially under low pH conditions. DNA array analysis showed that the expression of ~700 genes was elevated more than two-fold in mesothelioma cells under acidic conditions compared to in cells cultured in an alkaline medium (16). Numerous genes were also found to be strongly expressed in breast cancer cells cultured in an acidic medium (17). These gene products may be good candidate therapeutic targets and/or diagnostic markers of cancers. In the present study, the aim was to confirm whether or not the genes with an increased expression in cancer cells cultured in acidic medium are expressed in human cancer nests. A total of 8 genes with an increased expression in mesothelioma cells cultured under acidic conditions were selected and the expression was examined in human specimens from patients with cancer. The expression of the selected genes was demonstrated to be higher in numerous human cancer specimens compared to those in the specimens prepared from the surrounding normal areas.

Materials and methods

Human specimens from patients

Human tumor and the corresponding non-tumorous tissues were obtained from the Chiba Cancer Center Tissue Bank (Chiba, Japan) and used in the study with permission from the Institutional Ethical Committees of Chiba Cancer Center and Chiba University.

RNA extraction from human specimens

The human tissues that were stored at −80°C were mixed with ice-cold TRI reagent (Sigma-Aldrich, St. Louis, MO, USA). After 1 min on ice, the human tissues were homogenized on ice with a homogenizer until the pellets were broken and cell lysis was completed. Total RNA was isolated from the lysate according to the manufacturer’s instructions for the TRI reagent.

Quantitative polymerase chain reaction (qPCR)

Total RNA (1 μg), prepared as described above, was reverse-transcribed using ReverTra Ace (Toyobo Co., Ltd., Osaka, Japan) in a total volume of 20 μl containing the random primer for 18S rRNA or the polyT primer for the targeted genes. qPCR amplification was performed with an ABI Prism 7000 Sequence Detection System (Applied Biosystems, Foster City, CA, USA) using the FastStart Universal SYBR Green Master (Rox) (Roche Diagnostics, Basel, Switzerland) according to the manufacturer’s instructions. The PCR reaction was carried out with a mixture containing 12.5 μl PCR Master, 7.5 μM of each sense and antisense primer, 25 ng cDNA, and nuclease-free water in a total volume of 25 μl. The standard thermal profile for PCR amplification was 50°C for 2 min, 95°C for 10 min and 40 cycles of 95°C for 15 sec and 60°C for 60 sec. The primers used are shown in Table I.

Table I

Primers used in the present study.

Table I

Primers used in the present study.

Gene nameSequence
18S rRNAF: TAGAGTGTTCAAAGCAGGCCC
R: CCAACAAATAGAACCGCGGT
MnSODF: TGA ACG TCA CCG AGG AGA AG
R: CGT GCT CCC ACA CAT CAA TC
IL-32F: TCAAAGAGGGCTACCTGGAG
R: TTTCAAGTAGAGGAGTGAGCTCTG
ATP6V0D2F: GACCCAGCAAGACTATATCAACC
R: TGGAGATGAATTTTCAGGTCTTC
TNFRSF9F: AAACGGGGCAGAAAGAAACT
R: CTTCTGGAAATCGGCAGCTA
AREGF: GGGAGTGAGATTTCCCCTGT
R: AGCCAGGTATTTGTGGTTCG
ErbB3F: TGCAGTGGATTCGAGAAGTG
R: GGCAAACTTCCCATCGTAGA
LOC553158F: AGCCTCCCAGAGCACAACTA
R: ATGGCCAGATCAAATTCAGC
DMGDHF: GAGCTCACGGCTGGATCTAC
R: CCACCACCTGACCAGTTTCT

[i] MnSOD, manganese superoxide dismutase; IL-32, interleukin 32; ATP6V0D2, lysosomal H+ transporting ATPase, V0 subunit d2; TNFRSF9, tumor necrosis factor receptor superfamily, member 9; AREG, amphiregulin, schwannoma-derived growth factor; ErbB3,v-erb-b2 erythroblastic leukemia viral oncogene homolog 3; LOC553158, PRR5-ARHGAP8; DMGDH, dimethylglycine dehydrogenase.

A previous study has reported that the content of ribosomes per cell is ~4×106 (18), and the amount of mRNA per cell can be estimated using 18S rRNA as a control RNA with the following equation, in which Ct is the threshold cycle number: 4×106×2{(Ct of 18S rRNA) − (Ct of sample RNA)}.

Results

Quantification of mRNA levels in human cancer specimens

Our previous study showed that the expression of 58 genes was elevated more than three-fold in mesothelioma cells cultured for 24 h in an acidic medium (16). The 58 genes are listed in Table II. Seven genes were selected of the 58 genes with various functions, which were interleukin 32 (IL-32), lysosomal H+ transporting ATPase, V0 subunit d2 (ATP6V0D2), tumor necrosis factor receptor superfamily, member 9 (TNFRSF9), amphiregulin, schwannoma-derived growth factor (AREG), v-erb-b2 erythroblastic leukemia viral oncogene homolog 3 (ErbB3), PRR5-ARHGAP8 (LOC553158) and dimethylglycine dehydrogenase (DMGDH), and the expression of these genes was examined in human cancer specimens. In addition, the expression of the gene encoding manganese superoxide dismutase (MnSOD) was examined as MnSOD has been reported to participate in gastric and colorectal tumor metastasis (19,20), although the expression of MnSOD at acidic pH was 1.6-fold in mesothelioma cells. The selected genes are shown in Table II.

Table II

Genes with an elevated expression of >3-fold at acidic pH.

Table II

Genes with an elevated expression of >3-fold at acidic pH.

GeneExpression at pH 6.7 (fold)aRelative amountbDescription
RHCE7.8160.58Rh blood group, CcEe antigens
RSPO37.3460.70R-spondin 3 homolog (Xenopus laevis)
ZSCAN46.3461.06zinc finger and SCAN domain containing 4
ErbB3c5.9970.69v-erb-b2 erythroblastic leukemia viral oncogene homolog 3 (avian)
AREGc5.6500.92amphiregulin (schwannoma-derived growth factor)
FLJ337065.5791.75hypothetical protein FLJ33706
TNFRSF9c5.4642.58tumor necrosis factor receptor superfamily, member 9
BMP15.1860.40bone morphogenetic protein 1
PIPOX5.0690.66pipecolic acid oxidase
LOC6531934.4850.43similar to Amphiregulin precursor (AR) (Colorectum cell-derived growth factor) (CRDGF)
DMGDHc4.3100.39dimethylglycine dehydrogenase
LOC553158c4.3060.44PRR5-ARHGAP8 fusion
KCTD194.2310.33potassium channel tetramerisation domain containing 19
ZC3H64.2200.15zinc finger CCCH-type containing 6
SIGLEC14.1840.29sialic acid binding Ig-like lectin 1, sialoadhesin
GRHL34.1420.54grainyhead-like 3 (Drosophila)
FBXO324.1171.49F-box protein 32
BMP24.0140.48bone morphogenetic protein 2
LXN3.9879.88latexin
INPP5D3.9670.49inositol polyphosphate-5-phosphatase, 145kDa
RARRES13.8820.49retinoic acid receptor responder (tazarotene induced) 1
NYD-SP143.8470.48NYD-SP14 protein
RRAD3.8274.50Ras-related associated with diabetes
VWCE3.7902.35von Willebrand factor C and EGF domains
ATP6V0D2c3.7780.69ATPase, H+ transporting, lysosomal 38kDa, V0 subunit d2
CDH153.7500.64cadherin 15, M-cadherin (myotubule)
HES23.7230.54hairy and enhancer of split 2 (Drosophila)
IL-32c3.7118.91interleukin 32
CRELD13.7072.92cysteine-rich with EGF-like domains 1
PPP1R3E3.7020.39protein phosphatase 1, regulatory (inhibitor) subunit 3E
CLDN143.5600.20claudin 14
ARHGAP83.5470.23Rho GTPase activating protein 8
MGC339263.5085.58hypothetical protein MGC33926
LOC3909373.4970.34similar to ETS domain transcription factor ERF
FUT53.4860.41fucosyltransferase 5 (α (1,3) fucosyltransferase)
CLEC4F3.4590.47C-type lectin domain family 4, member F
LOC6448933.3630.21hypothetical protein LOC644893
C11orf343.3590.83chromosome 11 open reading frame 34
EGR43.3530.13early growth response 4
FLJ422583.3240.56FLJ42258 protein
CFB3.3205.25complement factor B
GPR783.3020.92G protein-coupled receptor 78
MUC3B3.3000.49mucin 3B, cell surface associated
CRYM3.2981.48crystallin, μ
CYYR13.2940.14 cysteine/tyrosine-rich 1
LOC1963943.2867.17hypothetical protein LOC196394
LOC6447253.2620.30similar to γ-tubulin complex component 3 (GCP-3) (Spindle pole body protein Spc98 homolog) (hSpc98) (hGCP3) (h104p)
FGF73.2190.17fibroblast growth factor 7 (keratinocyte growth factor)
PNLIPRP33.1781.21pancreatic lipase-related protein 3
C1orf1013.1700.13chromosome 1 open reading frame 101
ALS2CR73.1640.49amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 7
IGLL13.1301.12immunoglobulin λ-like polypeptide 1
GDF153.11222.10growth differentiation factor 15
FLJ268503.0820.23FLJ26850 protein
PTP4A33.0379.05protein tyrosine phosphatase type IVA, member 3
TAS2R393.0350.34taste receptor, type 2, member 39
SGK23.0150.28 serum/glucocorticoid regulated kinase 2
CRNN3.0050.20cornulin
MnSODc1.59913.77manganese superoxide dismutase
GAPDH0.962100.00 glyceraldehyde-3-phosphate dehydrogenase

a Expression ratio in cells cultured at pH 6.7 for 24 h compared to pH 7.5

b percent ratio of the mRNA level to the level of 18S rRNA at pH 6.7

c selected genes.

{ label (or @symbol) needed for fn[@id='tfn5-mco-02-06-1160'] } For original DNA array data, see reference 16.

One problem in the measurement of mRNA using qPCR was determining which was useful as a control RNA. Thus far, a reference gene, such as GAPDH, has generally been used in studies. There are no previous data to show that the expression of such reference genes is stable at acidic pH, particularly in human cancer nests. The amount of 18S rRNA was constant in mesothelioma cells at acidic and alkaline pH (data not shown). The amount of 18S rRNA in total RNA isolated from human cancer specimens was measured, with the results demonstrating that the content of 18S rRNA was constant in all the cancer specimens (Table III). The amount of 18S rRNA was slightly higher in normal areas, but the difference was <2-fold. These data indicated that 18S rRNA was suitable for use as control RNA. The Ct value shown in Table III was similar to that observed in cells cultured in vitro (data not shown), suggesting that the ribosome content per cell is constant even when the activity of protein synthesis varies. As one cell was reported to have ~4×106 ribosomes (18), the approximate copy number of mRNA can be calculated using this number. The mRNA level of GAPDH estimated using 18S rRNA as a control RNA decreased slightly at acidic pH in mesothelioma cells (Table II).

Table III

Amount of 18S rRNA in the human specimens from patients with colon, stomach, liver and renal cancer.

Table III

Amount of 18S rRNA in the human specimens from patients with colon, stomach, liver and renal cancer.

Ct of 18S rRNA (mean ± SD)

TissuesSamples, nNormal areaCancer area
Colon1111.07±0.6411.71±0.58
Stomach1011.03±0.5511.49±1.01
Renal1010.97±0.6911.60±0.40
Liver1010.63±0.5411.63±0.66
Total4110.93±0.6111.61±0.67

[i] SD, standard deviation.

Expression levels of selected genes in human cancers

Specimens from patients with lung, colon, stomach, liver and renal cancer in the Chiba Cancer Center Tissue Bank were available for the study. The homogenates of specimens from patients with lung cancer were not used due to a huge amount of skeletal material, so the measurement of gene expression was not assessed. Therefore, the expression of 8 selected genes was examined in the specimens from patients with colon, stomach, liver and renal cancer.

The specimens from the colon, stomach and renal cancer tissues showed increased MnSOD, IL-32 and TNFRSF9 transcripts compared to those from the non-tumorous regions of the same patients (Fig. 1). Increased expression of AREG was found in colon and renal cancer specimens (Fig. 1). Notably, an elevated expression of ATP6V0D2 was found in stomach cancer specimens, whereas the expression was reduced in the specimens from patients with colon and renal cancer (Fig. 1). The expression of ErbB3 was shown to be higher in colon, stomach and liver cancer specimens compared to the normal tissues, but a higher expression was observed in less than half of the renal cancer samples (Fig. 1). An increased expression of LOC553158 was found in the specimens from the colon and stomach cancer nests, but the expression decreased in the liver and renal cancer specimens (Fig. 1). The expression of DMGDH was upregulated in the specimens from the colon cancer tissues, and the upregulated expression was observed in about half of the samples from the patients with stomach, liver and renal cancer (Fig. 1).

Figure 1

Gene expression in cancer tissues. RNA was extracted from human tumor (closed bars) and the corresponding non-tumorous tissues (open bars). The mRNA levels (MnSOD, IL-32, ATP6V0D2 and TNFRSF9; AREG, ErbB3, LOC553158 and DMGDH) were measured as described in the Materials and methods. The averages and standard deviation values were obtained from three experiments. The numbers in the horizontal axes correlate to the patient numbers. Grey numbers are the patients in which the gene expression decreased in the cancer tissues. MnSOD, manganese superoxide dismutase; IL-32, interleukin 32; ATP6V0D2, lysosomal H+ transporting ATPase, V0 subunit d2; TNFRSF9, tumor necrosis factor receptor superfamily, member 9; AREG, amphiregulin, schwannoma-derived growth factor; ErbB3,v-erb-b2 erythroblastic leukemia viral oncogene homolog 3; LOC553158, PRR5-ARHGAP8; DMGDH, dimethylglycine dehydrogenase.

Discussion

For >30 years, it has been well known that cancer nests are acidified. However, thus far, few in vitro studies using acidic medium to develop cancer markers and medicines for cancer therapies have been performed. Our previous studies suggested that in vitro screening of compounds with anti-proliferation activity in an acidic medium was useful for developing anti-cancer drugs (11). A >2-fold increase in expression was found in ~700 genes in mesothelioma cells as the medium was acidified (16). Mesothelioma is one cancer that is hard to treat and remains asymptomatic even at a late stage.

In the present study, the expression of 8 genes with acidosis-induced expression in mesothelioma cells were examined in human specimens from various cancers and corresponding normal tissues. The expression varied in different tissues and showed a large variation among patients (Fig. 1). There may be a possibility that the genes that are specific to acidosis are expressed in a normal tissue area close to cancer nests as such an area may be acidified even if it contains no cancer cells. However, it is difficult to measure the pH of normal tissues prior to surgery as it can change during surgery due to the limited supply of blood. Furthermore, the pH may vary in different areas of cancer nests. In particular, the areas far from blood vessels are strongly acidified as suggested previously (2). Even though the data showed a wide variation, the present study produced several noteworthy results.

IL-32, TNFRSF9, AREG, ErbB3, LOC553158 and DMGDH were expressed at a higher level than that of the normal areas in almost all the colon cancer patients. MnSOD, IL-32, ATP6V0D2, TNFRSF9 and LOC553158 were expressed at a higher level compared to the normal areas in almost all the patients with stomach cancer. Therefore, these genes may be candidate therapeutic or diagnostic marker targets for these cancers, and a combination use of these genes may be particularly useful for future treatment. In the liver cancer area, MnSOD and ErbB3 were expressed at a higher level, but the expression of other genes was different in various patients. The reason for these differences in expression change remains unclear. Liver cancer nests may only be slightly acidified due to the highly organized blood vessel network in the liver.

IL-32 is a notable cytokine. This cytokine has been indicated to have a role in immune responses (21). The present data indicates that IL-32 is an interleukin that is specific to acidic conditions. As the mRNA level of IL-32 was high in mesothelioma cells cultured at acidic pH (2.6×105 copies/cell, calculated from the data shown in Table II) and the numerous cancer nests measured in the present study (Fig. 1), this interleukin may be a predominant candidate for cancer diagnosis as indicated recently (22). TNFRSF9 has been suggested to play significant roles in immune responses (23). Our previous study demonstrated that the expression of TNFRSF9 is induced in mesothelioma cells cultured in acidic media (16) and numerous cancer specimens (Fig. 1). Immune cells have to infiltrate into cancer nests or inflammatory loci to rehabilitate damaged tissues. Since cancer and inflammatory areas are often acidified, IL-32 and TNFRSF9 may function under acidic conditions in various cells besides the immune cells.

The ErbB/HER family, HER1 (epidermal growth factor receptor), HER2 (ErbB2), HER3 (ErbB3), and HER4 (ErbB4), has been indicated to have a central role in a wide variety of growth factor-dependent cell responses (24). This family has been shown to mediate differentiation in neuroblastoma (25), and a high expression of ErbB3 was found in neuroblastic tumors (26). High expression of ErbB3 was also found in various cancers, and ErbB3 has been identified as an attractive therapeutic target (27). Taken together with the present data, it can be argued that the gene product of ErbB3 protects against cell death under acidic conditions. AREG was found to be expressed at high levels in colon and renal cancers, suggesting a role in carcinogenesis (28,29). To the best of our knowledge, this is the first study to report the expression of LOC553158 itself in cancer cells, but the upregulation of ARHGAP8 has been reported in cervical cancer (30).

DMGDH is a mitochondrial enzyme that has a role in choline catabolism [NCBI data base (31)]. No data concerning the role of DMGDH in carcinogenesis has been reported until the present study, and furthermore, no data to show the activation of the mitochondrial function in cancer cells has been reported. The present data indicate that choline catabolism may be activated in cancer areas or that DMGDH may mediate an unidentified metabolic process under acidic conditions besides choline catabolism.

The expression pattern of ATP6V0D2 in renal tissues was unique. High expression of this gene was detected in normal areas, whereas almost no expression was observed in the cancer areas of all the patients. Protons are extruded to urine (32), and therefore, urine is often acidified. A high expression of ATP6V0D2 has been previously reported in normal renal tissues (33). Therefore, it is quite possible that this gene is expressed in normal renal tissues to protect cells against external acidosis. The function to extrude protons may be diminished during carcinogenesis, resulting in the attenuation of this gene expression.

The genes with elevated expression levels in cancer specimens as compared to the surrounding normal tissues may be good candidates as novel targets and markers for cancer therapy. Particularly, a combination therapy may be more useful for the diagnosis of carcinogenesis and chemotherapeutics against cancer. The expression of 8 genes with high expression in cells cultured at an acidic pH were examined and it was found that the gene expression was elevated in human cancer tissues in the present study. Further studies of other acidosis-dependent gene expressions to promote the development of novel cancer markers and/or chemotherapeutic targets are warranted in future studies.

Acknowledgements

The authors would like to express their appreciation to Chiba Cancer Center Tissue Bank (Japan) for providing the human specimens. We thank Dr Xin Wang for her contribution to this section of the study.

References

1 

Vaupel P, Kallinowski F and Okunieff P: Blood flow, oxygen and nutrient supply, and metabolic microenvironment of human tumors. Cancer Res. 49:6449–6465. 1989.PubMed/NCBI

2 

Dellian M, Helmlinger G, Yuan F and Jain RK: Fluorescence ratio imaging of interstitial pH in solid tumours: effect of glucose on spatial and temporal gradients. Br J Cancer. 74:1206–1215. 1996. View Article : Google Scholar : PubMed/NCBI

3 

Warburg O: On the origin of cancer cells. Science. 123:309–314. 1956. View Article : Google Scholar : PubMed/NCBI

4 

Vukovic V and Tannock IF: Influence of low pH on cytotoxicity of paclitaxel, mitoxantrone and topotecan. Br J Cancer. 75:1167–1172. 1997. View Article : Google Scholar : PubMed/NCBI

5 

Sauvant C, Nowak M, Wirth C, et al: Acidosis induces multi-drug resistance in rat prostate cancer cells (AT1) in vitro and in vivo by increasing the activity of the p-glycoprotein via activation of p38. Int J Cancer. 123:2532–2542. 2008. View Article : Google Scholar : PubMed/NCBI

6 

Zucali PA and Giaccone G: Biology and management of malignant pleural mesothelioma. Eur J Cancer. 42:2706–2714. 2006. View Article : Google Scholar : PubMed/NCBI

7 

Catalano A, Rodilossi S, Rippo MR, Caprari P and Procopio A: Induction of stem cell factor/c-Kit/Slug signal transduction in multidrug-resistant malignant mesothelioma cells. J Biol Chem. 279:46706–46714. 2004. View Article : Google Scholar

8 

Fukamachi T, Chiba Y, Wang X, et al: Tumor specific low pH environments enhance the cytotoxicity of lovastatin and cantharidin. Cancer Lett. 297:182–189. 2010. View Article : Google Scholar : PubMed/NCBI

9 

Nielsen SF, Nordestgaard BG and Bojesen SE: Statin use and reduced cancer-related mortality. N Engl J Med. 367:1792–1802. 2012. View Article : Google Scholar : PubMed/NCBI

10 

Brewer TM, Masuda H and Liu DD: Statin use in primary inflammatory breast cancer: a cohort study. Br J Cancer. 109:318–324. 2013. View Article : Google Scholar : PubMed/NCBI

11 

Fukamachi T, Wang X, Mochizuki Y, et al: Acidic environments enhance the inhibitory effect of statins on proliferation of synovial cells. Int Immunopharmacol. 17:148–153. 2013. View Article : Google Scholar : PubMed/NCBI

12 

Fukamachi T, Saito H, Kakegawa T and Kobayashi H: Different proteins are phosphorylated under acidic environments in Jurkat cells. Immunol Lett. 82:155–158. 2002. View Article : Google Scholar : PubMed/NCBI

13 

Hirata S, Fukamachi T, Sakano H, et al: Extracellular acidic environments induce phosphorylation of ZAP-70 in Jurkat T cells. Immunol Lett. 115:105–109. 2008. View Article : Google Scholar : PubMed/NCBI

14 

Lao Q, Fukamachi T, Saito H, Kuge O, Nishijima M and Kobayashi H: Requirement of an IkappaB-beta COOH terminal region protein for acidic-adaptation in CHO cells. J Cell Physiol. 207:238–243. 2006. View Article : Google Scholar : PubMed/NCBI

15 

Fukamachi T, Lao Q, Okamura S, Saito H and Kobayashi H: CTIB (C-Terminus protein of IkappaB-beta): a novel factor required for acidic adaptation. Adv Exp Med Biol. 584:219–228. 2006. View Article : Google Scholar : PubMed/NCBI

16 

Fukamachi T, Ikeda S, Wang X, et al: Gene expressions for signal transduction under acidic conditions. Genes (Basel). 4:65–85. 2013. View Article : Google Scholar : PubMed/NCBI

17 

Tang X, Lucas JE, Chen JL, et al: Functional interaction between responses to lactic acidosis and hypoxia regulates genomic transcriptional outputs. Cancer Res. 72:491–502. 2012. View Article : Google Scholar : PubMed/NCBI

18 

Darnel J, Lodish H and Baltimore D: Molecular Cell Biology. Scientific American Books, Inc; New York, NY, USA: 1986

19 

Malafa M, Margenthaler J, Webb B, Neitzel L and Christophersen M: MnSOD expression is increased in metastatic gastric cancer. J Surg Res. 88:130–134. 2000. View Article : Google Scholar : PubMed/NCBI

20 

Meng X, Wu J, Pan C, et al: Genetic and epigenetic down-regulation of microRNA-212 promotes colorectal tumor metastasis via dysregulation of MnSOD. Gastroenterology. 145:426–436. 2013. View Article : Google Scholar : PubMed/NCBI

21 

Joosten LA, Heinhuis B, Netea MG and Dinarello CA: Novel insights into the biology of interleukin-32. Cell Mol Life Sci. 70:3883–3892. 2013. View Article : Google Scholar : PubMed/NCBI

22 

Ishigami S, Arigami T, Uchikado Y, et al: IL-32 expression is an independent prognostic marker for gastric cancer. Med Oncol. 30:4722013. View Article : Google Scholar : PubMed/NCBI

23 

Zhao S, Zhang H, Xing Y and Natkunam Y: CD137 ligand is expressed in primary and secondary lymphoid follicles and in B-cell lymphomas: diagnostic and therapeutic implications. Am J Surg Pathol. 37:250–258. 2013. View Article : Google Scholar : PubMed/NCBI

24 

Linggi B and Carpenter G: ErbB receptors: new insights on mechanisms and biology. Trends Cell Biol. 16:649–656. 2006. View Article : Google Scholar : PubMed/NCBI

25 

Izycka-Swieszewska E, Wozniak A, Drozynska E, et al: Expression and significance of HER family receptors in neuroblastic tumors. Clin Exp Metastasis. 28:271–282. 2011. View Article : Google Scholar : PubMed/NCBI

26 

Wilzén A, Krona C, Sveinbjörnsson B, et al: ERBB3 is a marker of a ganglioneuroblastoma/ganglioneuroma-like expression profile in neuroblastic tumours. Mol Cancer. 12:702013.PubMed/NCBI

27 

Sithanandam G and Anderson LM: The ERBB3 receptor in cancer and cancer gene therapy. Cancer Gene Ther. 15:413–448. 2008. View Article : Google Scholar : PubMed/NCBI

28 

Guzman MJ, Shao J and Sheng H: Pro-neoplastic effects of amphiregulin in colorectal carcinogenesis. J Gastrointest Cancer. 44:211–221. 2013. View Article : Google Scholar : PubMed/NCBI

29 

Yotsumoto F, Yagi H, Suzuki SO, et al: Validation of HB-EGF and amphiregulin as targets for human cancer therapy. Biochem Biophys Res Commun. 365:555–561. 2008. View Article : Google Scholar : PubMed/NCBI

30 

Song JY, Lee JK, Lee NW, et al: Microarray analysis of normal cervix, carcinoma in situ, and invasive cervical cancer: identification of candidate genes in pathogenesis of invasion in cervical cancer. Int J Gynecol Cancer. 18:1051–1059. 2008. View Article : Google Scholar : PubMed/NCBI

31 

Binzak BA, Wevers RA, Moolenaar SH, et al: Cloning of dimethylglycine dehydrogenase and a new human inborn error of metabolism, dimethylglycine dehydrogenase deficiency. Am J Hum Genet. 68:839–847. 2001. View Article : Google Scholar

32 

Zeidel ML, Silva P and Seifter JL: Intracellular pH regulation and proton transport by rabbit renal medullary collecting duct cells. Role of plasma membrane proton adenosine triphosphatase. J Clin Invest. 77:113–120. 1986. View Article : Google Scholar

33 

Smith AN, Borthwick KJ and Karet FE: Molecular cloning and characterization of novel tissue-specific isoforms of the human vacuolar H+-ATPase C, G and d subunits, and their evaluation in autosomal recessive distal renal tubular acidosis. Gene. 297:169–177. 2002. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Fukamachi T, Ikeda S, Saito H, Tagawa M and Kobayashi H: Expression of acidosis‑dependent genes in human cancer nests. Mol Clin Oncol 2: 1160-1166, 2014.
APA
Fukamachi, T., Ikeda, S., Saito, H., Tagawa, M., & Kobayashi, H. (2014). Expression of acidosis‑dependent genes in human cancer nests. Molecular and Clinical Oncology, 2, 1160-1166. https://doi.org/10.3892/mco.2014.344
MLA
Fukamachi, T., Ikeda, S., Saito, H., Tagawa, M., Kobayashi, H."Expression of acidosis‑dependent genes in human cancer nests". Molecular and Clinical Oncology 2.6 (2014): 1160-1166.
Chicago
Fukamachi, T., Ikeda, S., Saito, H., Tagawa, M., Kobayashi, H."Expression of acidosis‑dependent genes in human cancer nests". Molecular and Clinical Oncology 2, no. 6 (2014): 1160-1166. https://doi.org/10.3892/mco.2014.344
Copy and paste a formatted citation
x
Spandidos Publications style
Fukamachi T, Ikeda S, Saito H, Tagawa M and Kobayashi H: Expression of acidosis‑dependent genes in human cancer nests. Mol Clin Oncol 2: 1160-1166, 2014.
APA
Fukamachi, T., Ikeda, S., Saito, H., Tagawa, M., & Kobayashi, H. (2014). Expression of acidosis‑dependent genes in human cancer nests. Molecular and Clinical Oncology, 2, 1160-1166. https://doi.org/10.3892/mco.2014.344
MLA
Fukamachi, T., Ikeda, S., Saito, H., Tagawa, M., Kobayashi, H."Expression of acidosis‑dependent genes in human cancer nests". Molecular and Clinical Oncology 2.6 (2014): 1160-1166.
Chicago
Fukamachi, T., Ikeda, S., Saito, H., Tagawa, M., Kobayashi, H."Expression of acidosis‑dependent genes in human cancer nests". Molecular and Clinical Oncology 2, no. 6 (2014): 1160-1166. https://doi.org/10.3892/mco.2014.344
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team