Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Molecular Medicine Reports
Join Editorial Board Propose a Special Issue
Print ISSN: 1791-2997 Online ISSN: 1791-3004
Journal Cover
June-2014 Volume 9 Issue 6

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
June-2014 Volume 9 Issue 6

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Inhibition of HepG2 cell proliferation by ursolic acid and polysaccharides via the downregulation of cyclooxygenase-2

  • Authors:
    • Ling Liu
    • Jingkai Zhang
    • Meiling Li
    • Xiaohong Zhang
    • Jinlu Zhang
    • Zhenjing Li
    • Likui Wang
    • Jihui Wu
    • Cheng Luo
  • View Affiliations / Copyright

    Affiliations: Key Laboratory of Food Nutrition and Safety, Tianjin University of Science and Technology, Ministry of Education, School of Food Engineering and Biotechnology, Tianjin University of Science and Technology, Tianjin 300457, P.R. China, Beijing Friendship Hospital, Capital Medical University, Beijing 100050, P.R. China, School of Life Science, Chinese University of Science and Technology, Hefei, Anhui 230026, P.R. China
  • Pages: 2505-2511
    |
    Published online on: March 17, 2014
       https://doi.org/10.3892/mmr.2014.2059
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

Cyclooxygenase (COX)-2, a multi-functional molecule, is overexpressed in hepatocellular carcinomas. In order to understand cell proliferation and its association with COX-2 in HepG2 cells in the presence of ursolic acid (UA), viili exopolysaccharides (VEPS) and Astragalus polysaccharides (APS), the cell proliferation, superoxide dismutase (SOD) and metabolic malondialdehyde (MDA) of fatty acids, COX-2, prostaglandin E2 (PGE2), as well as apoptotic morphology and rate were investigated. The results revealed that the activities of SOD, COX-2 and PGE2 were reduced, MDA was markedly decreased, apoptotic blebs were induced, and HepG2 cells were accumulated in the G1 and sub G1/apoptotic phases in test groups. The results indicated that UA, VEPS, APS and any combination of these possess anticancer properties, particularly by downregulating COX-2 expression, which may have increased internal oxidation and triggered apoptosis together with a change in internal antioxidant response elements, leading to a reduction in cell proliferation.

Introduction

Hepatocellular carcinoma (HCC) is estimated to be the fifth most common cause of cancer-related mortality worldwide (1). Although ~80% of cases are reported in developing countries, where the prevalence of hepatitis is high, HCC is one of the few types of cancer whose incidence is on the increase in developed countries (2,3). Although chemotherapy has provided significant survival benefits for HCC patients, such drugs are associated with marked tissue toxicity, and drugs or alternative therapies that target tumor cells without compromising normal tissue function are required (4). Increased concentrations of cytotoxic drugs and higher doses of radiation often fail to improve the health of liver cancer patients, and may cause resistance to apoptosis. An anticancer agent with lower toxicity that preferentially induces apoptosis in human cancer cells while creating an internal oxidative environment would be useful.

Ursolic acid (UA), a pentacyclic triterpenoid, has been identified in various natural products, such as vegetables and medicinal herbs (5). UA may inhibit cell growth and induce apoptosis in certain tumors (6,7) through multiple pathways, including inhibiting DNA replication, activating caspases and downregulating anti-apoptotic genes (8,9). UA specifically inhibits tumorigenesis (10), tumor progression (11), angiogenesis and tumor invasion (12).

Viili, a Nordic traditional fermented dairy product containing lactobacillus, yeast and filamentous fungi, generates large quantities of extracellular polysaccharide (EPS) (13). Viili exopolysaccharides (VEPS) reportedly have antioxidant properties (14), regulate immunity function and lower cholesterol (15). Astragalus, particularly A. membraneuse, is a common traditional Chinese medicine; its polysaccharides [or Astragalus polysaccharides (APS)] reportedly improve immune function (16), modulate the immune system and promote tumor cell apoptosis (17).

Cyclo-oxidase (COX)-2 is a key enzyme that catalyzes arachidonic acid into prostaglandins (18,19). COX-2 is not expressed in the majority of organs under normal physiological conditions, but it is expressed in the majority of cancer cells (20). COX-2 is believed to inhibit cancer cell apoptosis (21), thus causing resistance to chemotherapy as COX-2 selective inhibitors suppress tumor cell proliferation and induce apoptosis (22). For these reasons, naturally derived COX-2 inhibitors have been used to study chemotherapy and chemoprevention. In this study we analyzed the synergistic effect of UA in combination with VEPS and APS, on cell proliferation, morphologic change, anti-oxidation and COX-2 expression.

Materials and methods

Chemicals

Ursolic acid (>99.8%) was purchased from Sigma (St. Louis, MO, USA). VEPS (>78%) and APS (>80%) were extracted in our laboratory. DMEM and the RevertAid First Strand cDNA Synthesis kit were purchased from Thermo Fisher Scientific Inc. (St. Louis, MO, USA). Fetal bovine serum (FBS) was purchased from Gibco (Milan, Italy). Penicillin streptomycin solution, trypsin, phosphate-buffered saline (PBS), DMSO, 3-(4,5-dimethylthiazol-2-yl)-2,5- diphenyltetrazolium bromide (MTT) and cell lysis solution were purchased from Solarbio (Beijing, China). Anti-COX-2 and anti-β-actin antibodies were purchased from Bioworld Technology (St. Louis Park, MN, USA) and goat anti-rabbit IgG antibody (H+L) was purchased from Thermo Fisher Scientific Inc. (Rockford, IL, USA). Superoxide dismutase (SOD) and malondialdehyde (MDA) test kits were purchased from Nanjing Biological Engineering (Nanjing, China), human COX-2 and human prostaglandin E2 (PGE2) enzyme-linked immunosorbent assay (ELISA) kits were purchased from Bio-Swamp (Shanghai, China). The RNeasy Mini kit was purchased from Qiagen (Hilden, Germany), and the SYBR Premix Ex Taq II PCR Master Mix kit was purchased from Takara Biotechnology (Dalian, China). The West Pico Mouse IgG Detection kit was purchased from Thermo Fisher Scientific.

Cell culture and reagents

The HepG2 human HCC cell line was a gift from the Academy of Military Science (Beijing, China). Cells were maintained in DMEM medium supplemented with 10% FBS, 100 U/ml of penicillin and 100 μg/ml of streptomycin, and incubated in a humidified 5% CO2 incubator at 37°C. The culture medium was changed every two days and the cells were subcultured every fifth day. Cells in the mid-log phase were used for experiments.

Stock solutions of UA, VEPS and APS were prepared in DMSO and diluted with medium. The final concentration of DMSO was <0.1%, which demonstrated no effect on cell viability and DNA fragmentation. DMSO was also used in the controls. For all assays, the HepG2 cells (5×104/ml) were treated with UA at 0.1, 1, 2.5, 5 or 10 μg/ml; or VEPS or APS at 10, 20, 40, 50 or 100 μg/ml, respectively. For combined treatments, UA and VEPS 1:1, or UA and APS 1:1 were applied and incubated for 24, 48 and 72 h, respectively, at 37°C.

Cell viability/proliferation assay

HepG2 cells were plated at 5×103 cells/well in 96-well plates, and incubated with varying concentrations of UA, VEPS and APS at different time points. The MTT solution was added to the culture medium at a final concentration of 0.5 mg/ml for 4 h, and dark blue formazan crystals were dissolved with 150 μl DMSO. The absorbance value was measured at 570 nm using a multiwell spectrophotometer (Bio-Rad, Hercules, CA, USA). Experiments were performed in quadruplicate and repeated three times. The percentage of cell inhibition was calculated using the formula: inhibitory rate (%)=[1−(absorbanceexperiment well)/(absorbancecontrol well)] × 100.

Observations of apoptosis morphology using a scanning electronic microscope (SEM)

HepG2 cells (1×105 cells/well) were grown on cover slips in 6-well plates in a CO2 incubator, then treated with UA (5 μg/ml), VEPS (50 μg/ml), APS (50 μg/ml), UA/VEPS 1:1 in combination, or UA and APS 1:1 in combination. After 48 h, the cells were washed with PBS three times, and subsequently fixed for 2 h at 4°C with 2.5% glutaraldehyde in 0.2 M cacodylate buffer, pH 7.4. Dehydration was performed with gradients of 30, 50, 70, 90 and 100% ethanol, at 10-min intervals. HepG2 cell surfaces were coated with a gold spray and examined by SEM (Su1510, Hitachi, Japan). Images were collected in TIFF files (PC-SeM, Hitachi) and edited using Photoshop; no artifacts were added.

Flow cytometric analysis

HepG2 cells (1×106 cells/ml) were treated with varying concentrations of UA (5 μg/ml), VEPS (50 μg/ml), APS (50 μg/ml), UA/VEPS 1:1 in combination, and UA/APS 1:1 in combination during the exponential growth phase. Cells were collected after being cultured for 48 h. Collected cells were washed twice with cold PBS, fixed with 70% pre-cooled ethanol, and subsequently incubated overnight in the dark at 4°C. Cell cycle analysis was performed by flow cytometer (BD Biosciences, Franklin Lakes, NJ, USA).

Determination of intracellular SOD activity

HepG2 cells were plated at 5×103 cells/well in 96-well plates, and incubated with varying concentrations of UA, VEPS, APS, combined 1:1 UA and VEPS, or combined 1:1 UA and APS for 48 h. The cells were washed twice with ice-cold PBS, lysed for 10 min in lysis buffer, and centrifuged for 5 min at 1,400 × g. Cellular SOD activity was measured in non-protein cell lysates using a commercially available SOD assay kit according to the manufacturer’s instructions.

Determination of intracelluar MDA content

HepG2 cells were plated at 5×103 cells/well in 96-well plates, and incubated with different concentrations of UA, VEPS, APS, combined 1:1 UA and VEPS, or combined 1:1 UA and APS for 48 h. The cells were washed twice with ice-cold PBS, lysed for 10 min in lysis buffer, and centrifuged for 5 min at 1,400 × g. Cellular MDA content was measured in non-protein cell lysates using a commercially available MDA assay kit according to the manufacturer’s instructions.

Reverse-transcription polymerase chain reaction (RT-PCR)

After HepG2 cells were exposed for 48 h to 5 μg/ml of UA, 50 μg/ml of VEPS, 50 μg/ml APS, combined 1:1 UA and VEPS, or combined 1:1 UA and APS, total RNA was extracted from the cells using RNeasy Mini kit. First strand cDNA was generated via reverse transcription of 2 μg of the total RNA using a RevertAid First Strand cDNA Synthesis kit (Fermentas, USA). The standard PCR conditions for COX-2 were: 94°C for 4 min, then 30 cycles at 94°C for 45 sec, 56°C for 45 sec and 72°C for 1 min, followed by 10 min at 72°C. β-actin, a housekeeping gene, was selected as an internal standard to account for variability in amplification due to differences in the starting mRNA concentrations. The PCR conditions were as follows: 94°C for 3 min, then 35 cycles at 94°C for 30 sec, 57°C for 45 sec and 72°C for 30 sec, followed by 10 min at 72°C. The correct fragment of PCR was confirmed by a commercial sequencing service company (BGI, Beijing, China). Primer sequences for COX-2 and β-actin are listed in Table I.

Table I

Primer sequences used for PCR.

Table I

Primer sequences used for PCR.

GenesPrimers (5′-3′)Primers (5′-3′)Size (bp)Accession
COX-2 TGAAACCCACTCCAAACACAG TCATCAGGCACAGGAGGAAG232NM_000963
β-actin AAATCTGGCACCACACCTT AGCACTGTGTTGGCGTAGAG646NG_007992

[i] PCR, polymerase chain reaction; COX-2, cyclooxygenase-2.

COX-2 expression by western blotting

HepG2 cells were incubated with 5 μg/ml UA, 50 μg/ml VEPS, 50 μg/ml APS, combined 1:1 UA and VEPS, or combined 1:1 UA and APS for 48 h. Cells were collected and washed twice with ice-cold PBS. Lysates were incubated for 10 min on ice, sonicated and centrifuged for 15 min at 12,000 × g. After protein concentrations were determined using the Bradford assay, the samples were boiled for 10 min, equal amounts of protein (20 μl/lane) were separated by SDS-PAGE, transferred to nitrocellulose membranes, and immunoblotted with a 1:1000 dilution of primary antibody against COX-2 and 1:4000 dilution of primary antibody against β-actin at 4°C overnight. The secondary antibody was goat anti-rabbit IgG antibody (H+L) diluted 1:5,000 in blocking solution for 1 h at room temperature. Immunoreactivity was detected using West Pico Mouse IgG Detection kit and visualized by autoradiography.

Measurement of intracellular COX-2 by ELISA

HepG2 cells were plated at 5×103 cells/well in 96-well plates, and incubated with varying concentrations of UA, VEPS, APS, combined 1:1 UA and VEPS, or combined 1:1 UA and APS for 48 h. Cells were washed twice with ice-cold PBS and lysed for 10 min in lysis buffer. COX-2 concentration was measured in plates coated with purified human COX-2 antibody, using a commercially available human COX-2 ELISA kit, according to the manufacturer’s instructions.

Measurement of PGE2 levels by ELISA

HepG2 cells were plated at 5×103 cells/well in 96-well plates, and incubated with varying concentrations of UA, VEPS, APS, combined 1:1 UA and VEPS, or combined 1:1 UA and APS for 48 h. PGE2 levels in the culture media were analyzed in plates coated with purified human PGE2 antibody, using a commercially available human PGE2 ELISA kit, according to the manufacturer’s instructions.

Statistical analysis

Data are reported as the means ± SD. Statistical analyses used analysis of variance (ANOVA) tests. Differences among means were determined by the least significance difference test. P<0.05 was considered to indicate a statistically significant difference.

Results

UA, VEPS, APS and combined treatments inhibited HepG2 cell proliferation

UA, VEPS, APS and combination treatments induced HepG2 cell deaths in a time- and dose-dependent manner (Fig. 1). Incubation with varying doses of UA, VEPS, APS and combined treatments for different time periods (24, 48, or 72 h) resulted in the significant inhibition of cell proliferation (P<0.05). However, inhibition at 48 h was stronger than that at 24 h or 72 h (P<0.05). Furthermore, there was greater inhibition by the combined treatments than with individual treatments (P<0.05).

Figure 1

Inhibitory effect of different compounds on HepG2 cell proliferation. HepG2 cells were incubated at different concentration of UA (0.1, 1, 2.5, 5, or 10 μg/ml), VEPS/APS (10, 20, 40, 50, or 100 μg/ml), or combined treatments for different time periods (24, 48, or 72 h). UA, ursolic acid; VEPS, viili exopolysaccharides; APS, Astragalus polysaccharide.

UA, VEPS, APS and combined treatments induced apoptotic blebs in HepG2 cells

Morphological changes to cells following exposure to UA (5 μg/ml), VEPS (50 μg/ml), APS (50 μg/ml), and combined treatments for 48 h were visualized under a SEM (Fig. 2). Following treatment with UA, VEPS, or APS, HepG2 cells demonstrated characteristic apoptotic features, with shrinkage, nuclear condensation and DNA fragmentation.

Figure 2

Effects of different compounds on the cell apoptotic morphology. HepG2 cells were treated with UA (5 μg/ml), VEPS (50 μg/ml), APS (50 μg/ml) or combined treatments for 48 h. Cells exhibited characteristic ultrastructural apoptotic blebs. (a) Control; (b) UA; (c) VEPS; (d) APS; (e) UA+VEPS; (f) UA+APS. Original magnification, ×3500. UA, ursolic acid; VEPS, viili exopolysaccharides; APS, Astragalus polysaccharide.

UA, VEPS, APS and combined treatments increased cell arrest in the HepG2 cell cycle

Following the exposure of HepG2 cells to UA (5 μg/ml), VEPS (50 μg/ml), APS (50 μg/ml), and combined treatments for 48 h, the cell cycle and apoptosis were monitored by flow cytometry (Fig. 3). The percentage of cells increased in the G1- and S-phases. A sub-G1 peak (apoptosis peak) was also observed. Cell apoptosis increased when HepG2 cells were treated with UA and combined compounds. The results indicate that UA, VEPS and APS are capable of inducing cell cycle arrest.

Figure 3

Effects of different compounds on the cell cycle of HepG2 cells. HepG2 cells were treated with UA (5 μg/ml), VEPS (50 μg/ml), APS (50 μg/ml) or combined treatments for 48 h. (a) Control, (b) UA, (c) VEPS, (d) APS, (e) UA+VEPS and (f) UA+APS. UA, ursolic acid; VEPS, viili exopolysaccharides; APS, Astragalus polysaccharide.

UA, VEPS, APS and combined treatments reduced intracellular ROS activity

SOD is a critical antioxidant enzyme that cleans up cytosolic ROS efficiently. As the drug concentrations increased, SOD activity was significantly downregulated in HepG2 cells (Fig. 4; P<0.05). SOD activity was markedly affected at concentrations of 5 μg/ml UA, 50 μg/ml VEPS, 50 μg/ml APS and by the combined treatments (P<0.01). Similarly, MDA is an indicator for intracellular ROS, as the accumulation of MDA is normally increased in cancer cells. Results of our assay showed that the MDA content increased at a low concentration, but decreased at a high concentration of VEPS and APS in HepG2 cells (Fig. 5, P<0.05), However, MDA content was significantly decreased by UA from 0.1 to 10 μg/ml, and when combined with 40, 50 and 100 μg/ml VEPS and APS (P<0.01), respectively.

Figure 4

Effects of different compounds on SOD activity in HepG2 cells. HepG2 cells were treated with various doses of UA (0.1, 1, 2.5, 5, or 10 μg/ml), VEPS/APS (10, 20, 40, 50, or 100 μg/ml), or combined treatments for 48 h. *P<0.05, **P<0.01, compared with control group. SOD, superoxide dismutase; UA, ursolic acid; VEPS, viili exopolysaccharides; APS, Astragalus polysaccharide.

Figure 5

Effects of different compounds on MDA content in HepG2 cells. HepG2 cells were treated with different doses of UA (0.1, 1, 2.5, 5, or 10 μg/ml), VEPS/APS (10, 20, 40, 50, or 100 μg/ml), or combined treatments for 48 h. *P<0.05, **P<0.01, compared with the control group. MDA, malondialdehyde; UA, ursolic acid; VEPS, viili exopolysaccharides; APS, Astragalus polysaccharide.

UA, VEPS, APS and combined treatments reduced COX-2 expression in HepG2 cells

RT-PCR analysis results (Fig. 6A, P<0.05) revealed that COX-2 mRNA expression in HepG2 cells was higher in the control group, and downregulated by various compounds (Fig. 6B, P<0.05). For HepG2 cells treated with 5 μg/ml of UA, COX-2 mRNA expression was markedly downregulated compared with the controls (P<0.05), and COX-2 mRNA expression decreased further when treated with combinations of UA and VEPS or APS compared with 50 μg/ml of VEPS or APS alone, compared with the controls (P<0.05). Western blotting results (Fig. 6C) revealed that COX-2 protein expression was higher in the control compared with the experimental groups (Fig. 6D). Additionally, COX-2 protein expression following treatment with 5 μg/ml UA or either combination of UA and VEPS or APS was markedly reduced, compared with the controls (P<0.01). However, no clear change was observed in the VEPS group, and reduction with 50 μg/ml of APS was less significant when compared with the controls (P<0.05).

Figure 6

Inhibitory effects of different compounds on (COX)-2 expression in HepG2 cells. HepG2 cells were treated with doses of UA (5 μg/ml), VEPS (50 μg/ml), APS (50 μg/ml) or combined treatments for 48 h. (A) RT-PCR analysis of COX-2 genes. Lane 0, control; lane 1, UA (5 μg/ml); lane 2, VEPS (50 μg/ml); lane 3, APS (50 μg/ml), lane 4, UA+VEPS; lane 5, UA+APS for 48 h. (B) Quantitative analysis of protein levels. *P<0.05, **P<0.01, compared with control group. (C) Western blot analysis of protein. Lane 0, control; lane 1, VEPS (50 μg/ml); lane 2, UA (5 μg/ml); lane 3, APS (50 μg/ml), lane 4, UA+VEPS; lane 5, UA+APS for 48 h. (D) Quantitative analysis of protein levels. *P<0.05 compared with control group. COX-2, cyclooxygenase-2; RT-PCR, reverse-transcription polymerase chain reaction; UA, ursolic acid; VEPS, viili exopolysaccharides; APS, Astragalus polysaccharide.

UA, VEPS, APS and combined treatments reduced COX-2 and PGE2 in HepG2 cells by ELISA

Based on the standard curve, as the concentrations of the different tested compounds increased, the COX-2 concentration decreased (Table II), although the effects varied among these treatments; 5 μg/ml UA, 50 μg/ml VEPS, 50 μg/ml APS and the combined treatments significantly reduced COX-2 concentration in HepG2 cells compared with the controls (P<0.05). Similarly, based on the standard PGE2 curve, with increasing concentrations of the various tested compounds, PGE2 production decreased (Table III). Although effects varied among these treatments, 5 and 10 μg/ml UA significantly reduced the PGE2 titer, while the combined treatments; 5 μg/ml UA with 50 μg/ml VEPS or with 50 μg/ml APS, significantly reduced the PGE2 concentration in HepG2 cells compared with the controls (P<0.01). However, the reduction with 50 μg/ml VEPS or APS alone was less significant, compared with the controls (P<0.05).

Table II

Inhibitory effects of different compounds on cyclooxygenase (COX)-2 concentration in HepG2 cells at 48 h.

Table II

Inhibitory effects of different compounds on cyclooxygenase (COX)-2 concentration in HepG2 cells at 48 h.

COX-2 concentration

Samples0 (μg/ml)10 (μg/ml)20 (μg/ml)40 (μg/ml)50 (μg/ml)100 (μg/ml)
UA11.10±0.668.63±0.478.75±1.456.90±0.724.33±0.20b5.49±1.13a
VEPS11.10±0.669.51±0.587.94±1.016.62±0.315.73±0.47a6.22±0.98
APS11.10±0.669.47±0.878.95±1.958.01±0.695.59±0.94a6.08±1.56
UA+VEPS11.10±0.667.39±0.258.11±0.855.77±0.554.65±0.69b5.27±1.67a
UA+APS11.10±0.667.90±0.948.82±0.406.45±1.514.81±0.55b5.37±0.49a

{ label (or @symbol) needed for fn[@id='tfn2-mmr-09-06-2505'] } A standard curve with absorbance value on the vertical (y) axis and concentration on the horizontal (x) axis: y = 0.0342x + 0.0148; R2=0.9989. The corresponding concentration of COX-2 in the table was from the standard curve.

a P<0.05;

b P<0.01, compared with the control group.

{ label (or @symbol) needed for fn[@id='tfn5-mmr-09-06-2505'] } UA, ursolic acid; VEPS, viili exopolysaccharides; APS, Astragalus polysaccharide.

Table III

Inhibitory effects of different compounds on PGE2 concentration in HepG2 cells at 48 h.

Table III

Inhibitory effects of different compounds on PGE2 concentration in HepG2 cells at 48 h.

PGE2 concentration

Samples0 (μg/ml)10 (μg/ml)20 (μg/ml)40 (μg/ml)50 (μg/ml)100 (μg/ml)
UA120.67±7.3178.10±16.7951.44±10.0439.13±5.4617.85±3.35b21.69±3.53b
VEPS120.67±7.31109.13±6.1761.69±7.3452.46±8.3230.67±6.1735.28±11.42
APS120.67±7.3194.00±12.6663.74±10.0150.15±4.8034.77±10.8542.72±13.08
UA+VEPS120.67±7.3184.00±8.5761.95±7.4746.56±6.5422.21±5.40b28.62±2.77a
UA+APS120.67±7.3188.36±21.9258.62±2.7737.59±8.1518.87±6.98b26.82±10.04a

{ label (or @symbol) needed for fn[@id='tfn6-mmr-09-06-2505'] } A standard curve with absorbance value on the vertical (y) axis and concentration on the horizontal (x) axis: y=0.0013x + 0.0848; R2=0.9984. The corresponding concentration of PGE2 in the table was from the standard curve.

a P<0.05;

b P<0.01, compared with control group.

{ label (or @symbol) needed for fn[@id='tfn9-mmr-09-06-2505'] } PGE2, prostaglandin E2; UA, ursolic acid; VEPS, viili exopolysaccharides; APS, Astragalus polysaccharide.

Discussion

Although the occurrence and development of tumors and malignancies are complex, cancer events are not unusual processes. Potentially cancerous cells are constantly produced, but are usually eliminated in a healthy environment. However, carcinogenesis may occur if the body’s internal antioxidant or anti-inflammatory environment changes entirely, or the mechanisms that inhibit abnormal cell proliferation disappear. Previous studies have revealed that antioxidation and anti-inflammation may increase the risk of cancer in certain environments (23,24), where antioxidants are over-enriched, due to the internal antioxidative system, or ARE genes, may be triggered, which eventually increase cell proliferation (25,26). Thus an antioxidant environment may not curb cancer, particularly in cancerous organisms, where COX-2 is overexpressed. COX-2, a double-edged molecule, participates in inflammatory and anti-inflammatory processes. As a downstream product of COX-2, PGE2 frequently affects inflammation, and may be further derived into several so-called electrophilic oxo-derivative (EFOX) molecules with short life-cycles that strongly regulate cell proliferation through the Nrf2/keap1/ARE pathways (27).

In this study we have demonstrated that UA, VEPS, APS and their combined treatments markedly reduced COX-2 expression, and reduced the concentration of PGE2 in HepG2 cells, as shown by RT-PCR, western blot and ELISA analyses. The inhibition of COX-2 in cancer cells may increase oxidative stress due to decreased levels of EFOXs molecules that mediate the gene expression of SOD and other AREs (28). This is due to the fact that the ARE family, including SOD, create an antioxidative and anti-inflammatory protective environment in order to increase cell proliferation (29). Increased MDA levels, metabolic products of fatty acids, also indicate an oxidative environment. UA is a potent antioxidant with multiple functions, which reduced MDA significantly, while the inhibition of MDA and cell proliferation occurred only with a high concentration of VEPS and APS. Complications in in vivo metabolism occur when the metabolites of fatty acids accumulate. However, it is possible to ignore MDA as it minimizes the metabolism of fatty acids in vitro. Thus it is possible that the inhibition of HepG2 cell proliferation by UA, VEPS, APS and the combined treatments may be attributed to the inhibition of COX-2 and the associated decreases in SOD activity, which increase the oxidative environment and induce apoptosis, as shown by the higher rate of apoptotic blebs which were observed under the SEM, and the cell-cycle arrest detected by flow cytometry.

These compounds, particularly VEPS, may also have cancer-preventive roles in vivo through the innate immune system (30–32), as VEPS are capable of activating macrophages and lymphocytes without causing severe inflammation or other diseases, and a correlation between its dietary use and cancer epidemiology has been suggested (33).

In conclusion, this study has demonstrated that UA, VEPS, APS, and their combined treatments inhibit HepG2 cell growth. The mechanism for this inhibition may be through the inhibition of COX-2, which in turn reduces EFOXs that activate the internal anti-oxidative elements, including SOD, thus leading HepG2 cancer cells into an over-oxidative environment, causing apoptosis and retarding cell proliferation.

Acknowledgements

This study was supported by an initial fund from Tianjin City Government for the ‘1000 Talents Plan’ program to C.L. The authors would like to thank Dr Changlu Wang, Dr Mianhua Chen and Dr Yurong Wang, of the Tianjin University of Science and Technology for their tireless aid. The authors are also thankful to Dr Wentian Liu, Department of Gastroenterology, Tianjin Medical University’s General Hospital, Tianjin, China for his critical comments on the preparation of this manuscript.

References

1 

Lodato F, Mazzella G, Festi D, Azzaroli F, Colecchia A and Roda E: Hepatocellular carcinoma prevention: a worldwide emergence between the opulence of developed countries and the economic constraints of developing nations. World J Gastroenterol. 12:7239–7249. 2006.

2 

El-Serag HB: Epidemiology of hepatocellular carcinoma. Clin Liver Dis. 5:87–107. 2001. View Article : Google Scholar

3 

Goodgame B, Shaheen NJ, Galanko J and El-Serag HB: The risk of end stage liver disease and hepatocellular carcinoma among persons infected with hepatitis C virus: publication bias? Am J Gastroenterol. 98:2535–2342. 2003. View Article : Google Scholar : PubMed/NCBI

4 

Simonetti RG, Cammà C, Fiorello F, Politi F, D’Amico G and Pagliaro L: Hepatocellular carcinoma: a worldwide problem and the major risk factors. Dig Dis Sci. 36:962–972. 1991. View Article : Google Scholar : PubMed/NCBI

5 

Liu J: Oleanolic acid and ursolic acid: research perspectives. J Ethnopharmacol. 100:92–94. 2005. View Article : Google Scholar : PubMed/NCBI

6 

Aggarwal BB and Shishodia S: Molecular targets of dietary agents for prevention and therapy of cancer. Biochem Pharmacol. 71:1397–1421. 2006. View Article : Google Scholar : PubMed/NCBI

7 

Hsu YL, Kuo PL and Lin CC: Proliferative inhibition, cell-cycle dysregulation, and induction of apoptosis by ursolic acid in human non-small cell lung cancer A549 cells. Life Sci. 75:2303–2316. 2004. View Article : Google Scholar : PubMed/NCBI

8 

Choi BM, Park R, Pae HO, et al: Cyclic adenosine monophosphate inhibits ursolic acid-induced apoptosis via activation of protein kinase A in human leukaemic HL-60 cells. Pharmacol Toxicol. 86:53–58. 2000. View Article : Google Scholar : PubMed/NCBI

9 

Choi YH, Baek JH, Yoo MA, et al: Induction of apoptosis by ursolic acid through activation of caspases and down-regulation of c-IAPs in human prostate epithelial cells. Int J Oncol. 17:565–571. 2000.PubMed/NCBI

10 

Huang MT, Ho CT, Wang ZY, et al: Inhibition of skin tumorigenesis by rosemary and its constituents carnosol and ursolic acid. Cancer Res. 54:701–708. 1994.PubMed/NCBI

11 

Nishino H, Nishino A, Takayasu J, et al: Inhibition of the tumor-promoting action of 12-O-tetradecanoylphorbol-13-acetate by some oleanane-type triterpenoid compounds. Cancer Res. 48:5210–5215. 1988.PubMed/NCBI

12 

Cha HJ, Bae SK, Lee HY, et al: Anti-invasive activity of ursolic acid correlates with the reduced expression of matrix metalloproteinase-9 (MMP-9) in HT1080 human fibrosarcoma cells. Cancer Res. 56:2281–2284. 1996.PubMed/NCBI

{ label needed for ref[@id='b13-mmr-09-06-2505'] } 

[13] Saxelin ML, Nurmiaho-Lassila EL, Meriläinen VT and Forsén RI: Ultrastructure and host specificty of bacteriophages of Streptococcus cremoris, Streptococcus lactis subsp diacetylactis, and Leuconostoc cremoris from Finnish fermented milk ‘viili’. Appl Environ Microbiol. 52:771–777. 1986.PubMed/NCBI

14 

Liu L, Wu J, Zhang J, et al: A compatibility assay of ursolic acid and foodborne microbial exopolysaccharides by antioxidant power and anti-proliferative properties in hepatocarcinoma cells. J Food Agric Environ. 10:111–114. 2012.

15 

Kitazawa H, Yamaguchi T and Itoh T: B-cell mitogenic activity of slime products produced from slime-forming, encapsulated Lactococcus lactis ssp cremoris. J Dairy Sci. 75:2946–2951. 1992. View Article : Google Scholar : PubMed/NCBI

16 

Shao BM, Xu W, Dai H, et al: A study on the immune receptors for polysaccharides from the roots of Astragalus membranaceus, a Chinese medicinal herb. Biochem Biophys Res Commun. 320:1103–1111. 2004. View Article : Google Scholar : PubMed/NCBI

17 

Ross R: Atherosclerosis - an inflammatory disease. N Eng J Med. 340:115–126. 1999. View Article : Google Scholar

18 

Akhtar M, Cheng Y, Magno RM, et al: Promoter methylation regulates Helicobacter pylori-stimulated cyclooxygenase-2 expression in gastric epithelial cells. Cancer Res. 61:2399–2403. 2001.

19 

Kim H, Lim JW and Kim KH: Helicobacter pylori-induced expression of interleukin-8 and cyclooxygenase-2 in AGS gastric epithelial cells: mediation by NF-kappaB. Scand J Gastroenterol. 36:706–716. 2001.

20 

Shariat SF, Kim JH, Ayala GE, et al: Cyclooxygenase-2 is highly expressed in carcinoma in situ and T1 transitional cell carcinoma of the bladder. J Urol. 169:938–942. 2003. View Article : Google Scholar : PubMed/NCBI

21 

Leng J, Han C, Demetris AJ, et al: Cyclooxygenase-2 promotes hepatocellular carcinoma cell growth through Akt activation: evidence for Akt inhibition in celecoxib-induced apoptosis. Hepatology. 38:756–768. 2003. View Article : Google Scholar : PubMed/NCBI

22 

Baek JY, Hur W, Wang JS, et al: Selective COX-2 inhibitor, NS-398, suppresses cellular proliferation in human hepatocellular carcinoma cell lines via cell cycle arrest. World J Gastroenterol. 13:1175–1181. 2007. View Article : Google Scholar : PubMed/NCBI

23 

Mantovani A, Allavena P, Sica A and Balkwill F: Cancer-related inflammation. Nature. 454:436–444. 2008. View Article : Google Scholar

24 

Coussens LM and Werb Z: Inflammation and cancer. Nature. 420:860–867. 2002. View Article : Google Scholar : PubMed/NCBI

25 

Oztürk HS, Karayvaz M, Kaçmaz M, et al: Activities of the enzymes participating in purine and free-radical metabolism in cancerous human colorectal tissues. Cancer Biochem Biophs. 16:157–168. 1998.PubMed/NCBI

26 

Eapen CE, Madesh M, Balasubramanian KA, et al: Mucosal mitochondirial function and antioxidation defences in patients with gastric carcinoma. Scand J Gastroenterol. 33:975–981. 1998. View Article : Google Scholar : PubMed/NCBI

27 

Luo C, Urgard E, Vooder T and Metspalu A: The role of COX-2 and Nrf2/ARE in anti-inflammation and antioxidative stress: Ageing and anti-ageing. Med Hypotheses. 77:174–178. 2011. View Article : Google Scholar : PubMed/NCBI

28 

Chen C: COX-2’s new role in inflammation. Nat Chem Biol. 6:401–402. 2010.

29 

Groeger AL, Cipollina C, Cole MP, Woodcock SR, et al: Cyclooxygenase-2 generates anti-inflammatory mediators from omega-3 fatty acids. Nat Chem Biol. 6:433–441. 2010. View Article : Google Scholar : PubMed/NCBI

30 

Kerr JF, Winterford CM and Harmon BV: Apoptosis. Its significance in cancer and cancer therapy. Cancer. 73:2013–2026. 1994. View Article : Google Scholar : PubMed/NCBI

31 

Elstein KH and Zucker RM: Comparison of cellular and nuclear flow-cytometric techniques for discriminating apoptotic subpopulations. Exp Cell Res. 211:322–331. 1994. View Article : Google Scholar : PubMed/NCBI

32 

Lebeer S, Claes IJ, Verhoeven TL, et al: Exopolysaccharides of Lactobacillus rhamnosus GG form a protective shield against innateimmune factors in the intestine. Microb Biotechnol. 4:368–374. 2011.

33 

Goodman MT, Wu AH, Tung KH, et al: Association of dairy products, lactose, and calcium with the risk of ovarian cancer. Am J Epidemiol. 156:148–157. 2002. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Liu L, Zhang J, Li M, Zhang X, Zhang J, Li Z, Wang L, Wu J and Luo C: Inhibition of HepG2 cell proliferation by ursolic acid and polysaccharides via the downregulation of cyclooxygenase-2. Mol Med Rep 9: 2505-2511, 2014.
APA
Liu, L., Zhang, J., Li, M., Zhang, X., Zhang, J., Li, Z. ... Luo, C. (2014). Inhibition of HepG2 cell proliferation by ursolic acid and polysaccharides via the downregulation of cyclooxygenase-2. Molecular Medicine Reports, 9, 2505-2511. https://doi.org/10.3892/mmr.2014.2059
MLA
Liu, L., Zhang, J., Li, M., Zhang, X., Zhang, J., Li, Z., Wang, L., Wu, J., Luo, C."Inhibition of HepG2 cell proliferation by ursolic acid and polysaccharides via the downregulation of cyclooxygenase-2". Molecular Medicine Reports 9.6 (2014): 2505-2511.
Chicago
Liu, L., Zhang, J., Li, M., Zhang, X., Zhang, J., Li, Z., Wang, L., Wu, J., Luo, C."Inhibition of HepG2 cell proliferation by ursolic acid and polysaccharides via the downregulation of cyclooxygenase-2". Molecular Medicine Reports 9, no. 6 (2014): 2505-2511. https://doi.org/10.3892/mmr.2014.2059
Copy and paste a formatted citation
x
Spandidos Publications style
Liu L, Zhang J, Li M, Zhang X, Zhang J, Li Z, Wang L, Wu J and Luo C: Inhibition of HepG2 cell proliferation by ursolic acid and polysaccharides via the downregulation of cyclooxygenase-2. Mol Med Rep 9: 2505-2511, 2014.
APA
Liu, L., Zhang, J., Li, M., Zhang, X., Zhang, J., Li, Z. ... Luo, C. (2014). Inhibition of HepG2 cell proliferation by ursolic acid and polysaccharides via the downregulation of cyclooxygenase-2. Molecular Medicine Reports, 9, 2505-2511. https://doi.org/10.3892/mmr.2014.2059
MLA
Liu, L., Zhang, J., Li, M., Zhang, X., Zhang, J., Li, Z., Wang, L., Wu, J., Luo, C."Inhibition of HepG2 cell proliferation by ursolic acid and polysaccharides via the downregulation of cyclooxygenase-2". Molecular Medicine Reports 9.6 (2014): 2505-2511.
Chicago
Liu, L., Zhang, J., Li, M., Zhang, X., Zhang, J., Li, Z., Wang, L., Wu, J., Luo, C."Inhibition of HepG2 cell proliferation by ursolic acid and polysaccharides via the downregulation of cyclooxygenase-2". Molecular Medicine Reports 9, no. 6 (2014): 2505-2511. https://doi.org/10.3892/mmr.2014.2059
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team