Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Molecular Medicine Reports
Join Editorial Board Propose a Special Issue
Print ISSN: 1791-2997 Online ISSN: 1791-3004
Journal Cover
August-2015 Volume 12 Issue 2

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
August-2015 Volume 12 Issue 2

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Attenuation of Porphyromonas gingivalis oral infection by α‑amylase and pentamidine

  • Authors:
    • Ying Li
    • Yu‑Song Miao
    • Yun Fu
    • Xi‑Ting Li
    • Shao‑Jie Yu
  • View Affiliations / Copyright

    Affiliations: Department of Periodontology, Guanghua School of Stomatology, Sun Yat‑sen University, Guangzhou, Guangdong 510055, P.R. China, Department of Dental Science, Guangzhou Chest Hospital, Guangzhou, Guangdong 510055, P.R. China
  • Pages: 2155-2160
    |
    Published online on: April 1, 2015
       https://doi.org/10.3892/mmr.2015.3584
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

The Porphyromonas gingivalis bacterium is one of the most influential pathogens in oral infections. In the current study, the antimicrobial activity of α‑amylase and pentamidine against Porphyromonas gingivalis was evaluated. Their in vitro inhibitory activity was investigated with the agar overlay technique, and the minimal inhibitory and bactericidal concentrations were determined. Using the bactericidal concentration, the antimicrobial actions of the inhibitors were investigated. In the present study, multiple techniques were utilized, including scanning electron microscopy (SEM), general structural analysis and differential gene expression analysis. The results obtained from SEM and bactericidal analysis indicated a notable observation; the pentamidine and α‑amylase treatment destroyed the structure of the bacterial cell membranes, which led to cell death. These results were used to further explore these inhibitors and the mechanisms by which they act. Downregulated expression levels were observed for a number of genes coding for hemagglutinins and gingipains, and various genes involved in hemin uptake, chromosome replication and energy production. However, the expression levels of genes associated with iron storage and oxidative stress were upregulated by α‑amylase and pentamidine. A greater effect was noted in response to pentamidine treatment. The results of the present study demonstrate promising therapeutic potential for α‑amylases and pentamidine. These molecules have the potential to be used to develop novel drugs and broaden the availability of pharmacological tools for the attenuation of oral infections caused by Porphyromonas gingivalis.

Introduction

Porphyromonas gingivalis (P. gingivalis) is a Gram-negative, rod-shaped, anaerobic pathogenic bacterium associated with several periodontal diseases (1). The occurrence of periodontitis in >47% of the US population, with a high prevalence of mild (8.7%), moderate (30%) and severe (8.5%) cases, is due to variables, such as oral hygiene, socioeconomic status and other environmental, genetic and metabolic risk factors (2). P. gingivalis exhibits a strong positive association with the diagnostic parameters of periodontitis, including gingival recession, increased sulcular pocket depth and bleeding upon probing (3). In addition, Hajishengallis et al (4) demonstrated that although P. gingivalis does not independently cause periodontal disease in a germ-free murine model, low numbers of P. gingivalis are able to disrupt host homeostasis through actions involving commensal microorganisms and complement, leading to inflammation and periodontal disease (4).

P. gingivalis produces multiple virulence factors that allow successful colonization and support evasion of host defenses, a number of which contribute to the inflammation and destruction of host tissues (5). Adhesins, such as fimbraie and hemagglutinins, promote attachment (5,6) and proteolytic enzymes, such as cysteine proteinases and hemagglutinins, are capable of degrading multiple substrates in the gingival crevice, facilitating nutrient acquisition and contributing to host tissue degradation (5,6).

The control of oral bacteria is mediated by a diverse array of specific and non-specific innate immune molecules present in saliva and on mucosal surfaces (7). There are number of functional families consisting of >45 antimicrobial proteins and peptides, including cationic peptides, metal ion chelators, histatins, defensins, bacterial adhesions and agglutinators and enzymes directed at the bacterial cell wall. However, the physiological concentration of the majority of salivary antimicrobial proteins and peptides is lower than the effective concentration in vivo (7), which suggests that there may be additional immune functions within the saliva.

The enzyme α-amylase catalyzes the hydrolysis of internal α-1,4-glycosidic linkages within carbohydrate moieties, including glucose, maltose and maltotriose units (8,9). α-amylases are used in a number of industrial processes in the food, fermentation, textiles, paper, detergent and pharmaceutical industries. Fungal and bacterial amylases may have the potential for use in the pharmaceutical and fine-chemical industries. Advances in biotechnology have led to the expansion of amylase application in numerous fields, such as biomedical and analytical chemistry, and also textiles, food, brewing and distilling industries (8,10).

The bisbenzamidine derivative, pentamidine, has proved one of the most successful agents for targeting eukaryotic parasites, and has been used clinically for >70 years (11,12). In 1938, pentamidine isethionate was identified to have anti-protozoal activity, and was approved in the United States for the treatment of Pneumocystis carinii pneumonia and other protozoal diseases (13). Pentamidine has the ability to inhibit interaction at the Ca2+/p53 site of the protein, and has been reported to inhibit S100B activity (14). On the basis of the previous studies, the present study aimed to take advantage of the antimicrobial activity of α-amylase and pentamidine to attenuate oral infection of P. gingivalis.

Materials and methods

Reagents and chemicals

α-amylase from porcine pancreas was purchased from Sigma-Aldrich (St. Louis, MO, USA). The bisbenzamidine derivative, pentamidine was purchased from Sanofi S.A. (Paris, France). The media (Terrific broth and Luria-Bertani broth) were obtained from Thermo Fisher Scientific (Pittsburgh, PA, USA). The modified BacTiter-Glo Microbial Cell Viability Assay kit (Promega Corporation, Madison, WI, USA) was purchased for the determination of minimum inhibition concentration (MIC). The polymerase chain reaction (PCR) reagents were obtained from Bio-Rad Laboratories (Hercules, CA, USA), and Invitrogen Life Technologies (Carlsbad, CA, USA).

Bacterial culture

Porphyromonas gingivalis ATCC 33277 was purchased from the German Collection of Microorganisms and Cell Cultures (DSMZ; Braunschweig, Germany). The cells were cultured in modified Gifu anaerobic medium (GAM) broth (Nissui, Tokyo, Japan), in an aerobic jar and in the presence of a deoxygenating reagent (AnaeroPack; Mitsubishi Gas Chemical Company, Inc., Tokyo, Japan) for 48 h at 37°C. Cell concentration was standardized by measuring optical density at 650 nm using a Lumetron colorimeter (Photovolt Corp., Indianapolis, IN, USA).

MIC and minimum bactericidal concentration (MBC) assay

MICs were determined with modifications for each organism according to methods described by Cole et al (15). In brief, the appropriate growth medium for P. gingivalis was used to prepare 5-ml overnight cultures to an exponential phase. Bacteria were adjusted to a concentration of 4.5×105 colony-forming units/ml, added to various concentrations of antibiotic in 96-well plates, and incubated at 37°C for a period of 18–24 h in a humidified container. The MIC was defined as the lowest concentration that prevented 50% growth of cells. MBCs were determined by plating the wells with concentrations of 50–200% MIC. Following 24–48-h growth, the MBC was determined as the lowest concentration that did not permit visible growth on the surface of the agar. All MIC assays were performed in triplicate.

Scanning electron microscopy (SEM)

P. gingivalis cultures were grown to the mid-log phase, and 10 ml cell suspension [1×104 cells/ml in modified GAM supplemented with α-amylase (12 ng/ml) or pentamidine (100 ng/ml)] was incubated at 37°C for 2 h prior to collection and fixed in 2.5% glutaraldehyde. The samples were dehydrated with graded ethanol and t-butanol, dried using the critical point method and coated with gold. Cells were observed under a JSM-6510 LV scanning electron microscope (JEOL, Ltd., Tokyo, Japan).

Determination of differential gene expression

The differential gene expression was determined by quantitative (q) PCR. The bacterial culture (P. gingivalis) grown to early exponential phase was adjusted to an optical density 600 of 0.1 and split into two groups. One half was left untreated, while the other half was treated with α-amylase (12 ng/ml) and pentamidine (100 ng/ml). Following anaerobic incubation for 2 h, the cells were harvested, and total RNA was extracted using TRIzol reagent (Invitrogen Life Technologies, Carlsbad, CA, USA). cDNA was synthesized with 1 µg total RNA using the SuperScript II reverse transcriptase (Invitrogen Life Technologies). To identify the expression value of genes associated with hemagglutination, hemolysis, proteolysis, hemin uptake, chromosome replication, energy production, iron storage and oxidative stress, qPCR was performed using specific primers for the selected genes (Table I). The housekeeping gene glyceraldehyde 3-phosphate dehydrogenase (gapA) was used as a control gene. qPCR was conducted using the MiniOpticon Real-Time PCR Detection system (Bio-Rad Laboratories) with a reaction mixture containing 10 µl iQ SYBR Green Supermix (Bio-Rad Laboratories), 1 µl cDNA and primers to a final concentration of 250 nm in a final volume of 20 µl. To confirm that a single PCR product was amplified, a melting curve analysis was performed under the following conditions: 65°C to 95°C, with a heating rate of 0.2°C/sec. All quantifications were normalized to the P. gingivalis 16S ribosomal RNA gene.

Table I

Primer sequences used in the current study.

Table I

Primer sequences used in the current study.

Target geneGene identificationPrimer sequence (5′-3′)
16S ribosomal RNA F:TGTTACAATGGGAGGGACAAAGGG
R:TTACTAGCGAATCCAGCTTCACGG
gapAGAPDH, type I F:GGCAAACTGACGGGTATGTC
R:ATGAAGTCGGAGGAAACCAC
atpAATP synthase subunit A F:ATCAGGACGGGAAAGACCAC
R:ACGATGGGGTTGAAAGTGTC
cydACytochrome d ubiquinol oxidase, subunit I F:TGGATTCTTATCGCCAATGC
R:ATACGCCCAAAGCAAATACG
dnaGDNA primase F:GACACAGGGCTTTCCATCC
R:GCGAGCAATCTCTTTCTTGG
dpsDps family protein F:CAGAAGTGAAGGAAGAGCACGAA
R:GTAGGCAGACAGCATCCAAACG
RbrRubrerythrin F:TCCACGGCTGAGAACTTGCG
R:TGCTCGGCTTCCACCTTTGC
ftnFerritin F:CGTGGCGGCGAGGTGAAG
R:CGGAAGCAGCCCTTACGACAG
sodBSuperoxide dismutase, Fe-Mn F:GCCAAACCCTCAACCACAATCTC
R:GCCATACCCAGCCCGAACC
hagAHemagglutinin protein HagA F:ACAGCATCAGCCGATATTCC
R:CGAATTCATTGCCACCTTCT
hagBHemagglutinin protein HagB F:TGTCACTTGACACTGCTACCAA
R:ATTCAGAGCCAAATCCTCCA
rgpAArginine-specific cysteine proteinase F:GCCGAGATTGTTCTTGAAGC
R:AGGAGCAGCAATTGCAAAGT
rgpBArginine-specific cysteine proteinase F:CGCTGATGAAACGAACTTGA
R:CTTCGAATACCATGCGGTTT
kgpLysine-specific cysteine proteinase F:GCTTGATGCTCCGACTACTC
R:GCACAGCAATCAACTTCCTAAC

Results

Minimum inhibition and bactericidal concentration assay

The minimum inhibitory activity against P. gingivalis ATCC 33277 cell growth was measured using differential concentrations of α-amylase (2, 4, 6 and 8 ng/ml) and pent-amidine (50, 75, 100 and 125 ng/ml). The concentrations that prevented 50% growth of cells observed for 24 h were considered to be the MIC and were determined as 6 and 100 ng/ml α-amylase and pentamidine, respectively (Fig. 1). The MBC was tested using concentrations of 50–200% MIC and cells were cultured for 24–48 h. The MBCs were determined as 12 and 100 ng/ml for α-amylase and pentamidine, respectively (Fig. 2). This is the lowest concentration that did not permit visible growth on the surface of the agar, suggesting that P. gingivalis cells underwent significant cellular damage.

Figure 1

Concentration required to inhibit 50% growth of P. gingivalis indicated the minimum inhibitory concentration of α-amylase and pentamidine treatment.

Figure 2

Concentration required to kill 50% P. gingivalis was denoted as the minimum bacterial concentration of α-amylase and pentamidine treatment.

SEM analysis

SEM results demonstrated that P. gingivalis cells treated with α-amylase (Fig. 3A) or pentamidine (Fig. 3B) exhibited various stages of lysis. Cellular debris and detached pieces of membrane lay adjacent to the cells. A number of cells were distorted with irregular morphology and loss of cellular content. In addition, the cells were more closely aggregated and increased numbers of external blebs were present on and around the bacteria compared with those in controls (Fig. 3A). Similar to α-amylase-treated bacteria, pentamidine-treated P. gingivalis (Fig. 3B) was also distorted with irregular morphology and presented various stages of lysis with loss of intracellular content. Untreated P. gingivalis (Fig. 3C) cells exhibited an external structure typical of a healthy Gram-negative coccobacillus 7 bacterium with multiple blebs present on the cell surface.

Figure 3

Scanning electron microscopy images presenting the effects of α-amylase and pentamidine on P. gingivalis. Treatment of P. gingivalis with (A) α-amylase or (B) pentamidine for 1 h resulted in evidence of cellular distortion with aggregation of cells and lysis, and detached pieces of membrane lying adjacent to the cells. (C) Untreated cells exhibited a morphology typical of healthy P. gingivalis Gram-negative coccobacilli.

Determination of differential gene expression

Following determination of the MBC, differential gene expression was investigated by exposing the culture to the MBC. The genes associated with iron storage (dps, rbr and ftn) and oxidative stress (sodB) were indicated to have upregulated expression levels, while levels of genes encoding gingipains (rgpA, rgpB and kgp) and hemagglutinins (hagA and hagB) were downregulated by α-amylase and pentamidine (Fig. 4). The inhibitors also downregulated the expression of genes associated with energy production (atpA and cydA) and chromosome replication (dnaG). The expression levels of the control gene gapA were not significantly affected.

Figure 4

Expression levels of genes associated with hemin uptake, hemagglutination, hemolysis, proteolysis, energy production, chromosome replication, iron storage and oxidative stress. GapA was used as the control gene. Gene expression was measured by quantitative-polymerase chain reaction and normalized to that of the 16S ribosomal RNA gene. The expression level of each gene in the absence of inhibitors (α-amylase and pentamidine) was set as 1-fold. The results are presented as the mean ± standard error of three independent experiments.

Discussion

In the current study, two potent inhibitors of the P. gingivalis species (α-amylase and pentamidine) were investigated. These amylases, which are endogenous to saliva and oral mucosa are antimicrobial for P. gingivalis, and induce structural damage. α-amylase and pentamidine demonstrated significant inhibitory activity against P. gingivalis cell growth, and had MICs of 6 and 100 ng/ml, respectively. Similarly, the MBCs of α-amylase and pentamidine were determined as 12 and 100 ng/ml, respectively. SEM analysis suggested that the cell membrane structure of bacterial cells was compromised, likely resulting from damage caused by the inhibitors. However, the nature and mechanisms of action of the inhibitors remain unclear.

The results of the present study are in agreement with growing evidence that pentamidine kills bacteria in a dose-dependent manner and induces cellular damage. For example, E. coli and S. aureus treated with sphingosine, phytosphingosine or dihydrosphingosine exhibit extensive and differential intracellular and extracellular damage (16). Bibel et al (17) also demonstrated that sphinganine (dihydrosphingosine) treatment of S. aureus results in ultrastructural damage similar to antibiotic treatment, including lesions of the cell wall, membrane evaginations and leakage. In addition, treatment of Helicobacter pylori with oleic or linoleic acid results in altered morphology, with a disruption of cellular membranes and cell lysis (18). The present study indicates that there may be different mechanisms underlying the actions of different inhibitors. Antimicrobial activity and ultrastructural damage are dependent upon the specific lipid treatment. These data, combined with a previous observation that fatty acids and sphingoid bases exhibit differential activity across bacterial species (19), suggest that the antimicrobial activity of fatty acids and sphingoid bases is a specific interaction that depends upon characteristics of the bacterium and a particular lipid. The current study indicates that the mechanisms for the antimicrobial activity of α-amylase and pentamidine against bacteria involve membrane disruption by detergent activity and incorporation of lipids into the bacterial plasma membrane.

Surface-accumulated hemin is transported into bacterial cells so that it can be utilized. To evaluate the effect of α-amylase and pentamidine on P. gingivalis, the expression levels of selected genes were analyzed to determine whether they were up- or downregulated. The genes associated with iron storage (dps, rbr and ftn) and oxidative stress (sodB) presented upregulated expression levels. Notably, pentamidine increased the level of cell-associated hemin, which suggests that surplus hemin is accumulated on the bacterial cell surface regardless of energy-driven transport in the presence of pentamidine. A small decrease in the level of kgp was observed, the suppressed formation of µ-oxo bisheme may be explained by the fact that RgpA or RgpB, or the two together, with kgp activity are required by P. gingivalis to produce µ-oxo bisheme (20). The formation of µ-oxo bisheme represents an oxidative buffer mechanism for inducing an anaerobic miroenvironment and protects from hemin-mediated cell damage (20,21). Therefore, excessive accumulation of hemin in the vicinity of the bacterial cell surface without formation of µ-oxo bisheme by the bacterium may cause oxidative stress on P. gingivalis. This expectation was confirmed by qPCR, which indicated upregulation of the genes involved in oxidative stress, such as dps, rbr, ftn and sodB. An oxidative-stress-like phenomenon is one of the shared downstream events leading to bacterial cell death initiated by bactericidal antibiotics (22). Additionally, during bacterial cell death, genes for energy production, chromosome replication and nucleotide metabolism have been demonstrated to be inactivated (23). Therefore, the observation of the oxidative-stress-like response of P. gingi-valis and decreased expression of the genes required for ATP synthesis and chromosome replication of the bacterium grown with α-amylase and pentamidine in the current study may also support the idea that these inhibitors have a bactericidal effect.

In conclusion, the present study demonstrated that the use of the growth inhibitors α-amylase and pentamidine for controlling bacterial infection and aiding the innate immune system, in addition to promoting gene expression, may be an effective strategy for the prevention and treatment of oral cavity infection. Following comparison of these two inhibitors, pentamidine was demonstrated to be more effective at inhibiting the growth of P. gingivalis cells. However, further investigation is required to investigate its suitability for use in humans.

References

1 

Darveau RP, Tanner A and Page RC: The microbial challenge in periodontitis. Periodontol 2000. 14:12–32. 1997. View Article : Google Scholar : PubMed/NCBI

2 

Eke PI, Dye BA, Wei L, et al CDC Periodontal Disease Surveillance Workgroup: Prevalence of periodontitis in adults in the United States: 2009 and 2010. J Dent Res. 91:914–920. 2012. View Article : Google Scholar : PubMed/NCBI

3 

Hutter G, Schlagenhauf U, Valenza G, et al: Molecular analysis of bacteria in periodontitis: evaluation of clone libraries, novel phylotypes and putative pathogens. Microbiology. 149:67–75. 2003. View Article : Google Scholar : PubMed/NCBI

4 

Hajishengallis G, Liang S, Payne MA, et al: Low-abundance biofilm species orchestrates inflammatory periodontal disease through the commensal microbiota and complement. Cell Host Microbe. 10:497–506. 2011. View Article : Google Scholar : PubMed/NCBI

5 

Holt SC, Kesavalu L, Walker S and Genco CA: Virulence factors of Porphyromonas gingivalis. Periodontol 2000. 20:168–238. 1999. View Article : Google Scholar : PubMed/NCBI

6 

Lamont RJ and Jenkinson HF: Subgingival colonization by Porphyromonas gingivalis. Oral Microbiol Immunol. 15:341–349. 2000. View Article : Google Scholar

7 

Gorr SU: Antimicrobial peptides in periodontal innate defense. Front Oral Biol. 15:84–98. 2012.

8 

Gupta R, Gigras P, Mohapatra H, et al: Microbial α-amylases: a biotechnological perspective. Process Biochem. 38:1599–1616. 2003. View Article : Google Scholar

9 

Rajagopalan G and Krishnan C: Alpha-amylase production from catabolite derepressed Bacillus subtilis KCC103 utilizing sugarcane bagasse hydrolysate. Bioresour Technol. 99:3044–3050. 2008. View Article : Google Scholar

10 

Pandey A, Nigam P, Soccol CR, et al: Advances in microbial amylases. Biotechnol Appl Biochem. 31(Pt 2): 135–152. 2000. View Article : Google Scholar : PubMed/NCBI

11 

Burchmore RJ, Ogbunude PO, Enanga B and Barrett MP: Chemotherapy of human African trypanosomiasis. Curr Pharm Des. 8:256–267. 2002. View Article : Google Scholar : PubMed/NCBI

12 

Wilson WD, Tanious F, Mathis A, et al: Antiparasitic compounds that target DNA. Biochimie. 90:999–1014. 2008. View Article : Google Scholar : PubMed/NCBI

13 

Pearson RD and Hewlett EL: Pentamidine for the treatment of Pneumocystis carinii pneumonia and other protozoal diseases. Ann Intern Med. 103:782–786. 1985. View Article : Google Scholar : PubMed/NCBI

14 

Charpentier TH, Wilder PT, Liriano MA, et al: Divalent metal ion complexes of S100B in the absence and presence of pent-amidine. J Mol Biol. 382:56–73. 2008. View Article : Google Scholar : PubMed/NCBI

15 

Cole AM, Weis P and Diamond G: Isolation and characterization of pleurocidin, an antimicrobial peptide in the skin secretions of winter flounder. J Biol Chem. 272:12008–12013. 1997. View Article : Google Scholar : PubMed/NCBI

16 

Fischer CL, Walters KS, Drake DR, et al: Sphingoid bases are taken up by Escherichia coli and Staphylococcus aureus and induce ultrastructural damage. Skin Pharmacol Physiol. 26:36–44. 2013. View Article : Google Scholar :

17 

Bibel DJ, Aly R, Shah S and Shinefield HR: Sphingosines: antimicrobial barriers of the skin. Acta Derm Venereol. 73:407–411. 1993.PubMed/NCBI

18 

Khulusi S, Ahmed HA, Patel P, Mendall MA and Northfield TC: The effects of unsaturated fatty acids on Helicobacter pylori in vitro. J Med Microbiol. 42:276–282. 1995. View Article : Google Scholar : PubMed/NCBI

19 

Fischer CL, Drake DR, Dawson DV, et al: Antibacterial activity of sphingoid bases and fatty acids against Gram-positive and Gram-negative bacteria. Antimicrob Agents Chemother. 56:1157–1161. 2012. View Article : Google Scholar :

20 

Smalley JW, Birss AJ, Szmigielski B and Potempa J: The HA2 haemagglutinin domain of the lysine-specific gingipain (Kgp) of Porphyromonas gingivalis promotes micro-oxo bishaem formation from monomeric iron(III) protoporphyrin IX. Microbiology. 152:1839–1845. 2006. View Article : Google Scholar : PubMed/NCBI

21 

Lewis JP, Dawson JA, Hannis JC, Muddiman D and Macrina FL: Hemoglobinase activity of the lysine gingipain protease (Kgp) of Porphyromonas gingivalis W83. J Bacteriol. 181:4905–4913. 1999.PubMed/NCBI

22 

Wright GD: On the road to bacterial cell death. Cell. 130:781–783. 2007. View Article : Google Scholar : PubMed/NCBI

23 

Asakura Y and Kobayashi I: From damaged genome to cell surface: transcriptome changes during bacterial cell death triggered by loss of a restriction-modification gene complex. Nucleic Acids Res. 37:3021–3031. 2009. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Li Y, Miao YS, Fu Y, Li XT and Yu SJ: Attenuation of Porphyromonas gingivalis oral infection by α‑amylase and pentamidine. Mol Med Rep 12: 2155-2160, 2015.
APA
Li, Y., Miao, Y., Fu, Y., Li, X., & Yu, S. (2015). Attenuation of Porphyromonas gingivalis oral infection by α‑amylase and pentamidine. Molecular Medicine Reports, 12, 2155-2160. https://doi.org/10.3892/mmr.2015.3584
MLA
Li, Y., Miao, Y., Fu, Y., Li, X., Yu, S."Attenuation of Porphyromonas gingivalis oral infection by α‑amylase and pentamidine". Molecular Medicine Reports 12.2 (2015): 2155-2160.
Chicago
Li, Y., Miao, Y., Fu, Y., Li, X., Yu, S."Attenuation of Porphyromonas gingivalis oral infection by α‑amylase and pentamidine". Molecular Medicine Reports 12, no. 2 (2015): 2155-2160. https://doi.org/10.3892/mmr.2015.3584
Copy and paste a formatted citation
x
Spandidos Publications style
Li Y, Miao YS, Fu Y, Li XT and Yu SJ: Attenuation of Porphyromonas gingivalis oral infection by α‑amylase and pentamidine. Mol Med Rep 12: 2155-2160, 2015.
APA
Li, Y., Miao, Y., Fu, Y., Li, X., & Yu, S. (2015). Attenuation of Porphyromonas gingivalis oral infection by α‑amylase and pentamidine. Molecular Medicine Reports, 12, 2155-2160. https://doi.org/10.3892/mmr.2015.3584
MLA
Li, Y., Miao, Y., Fu, Y., Li, X., Yu, S."Attenuation of Porphyromonas gingivalis oral infection by α‑amylase and pentamidine". Molecular Medicine Reports 12.2 (2015): 2155-2160.
Chicago
Li, Y., Miao, Y., Fu, Y., Li, X., Yu, S."Attenuation of Porphyromonas gingivalis oral infection by α‑amylase and pentamidine". Molecular Medicine Reports 12, no. 2 (2015): 2155-2160. https://doi.org/10.3892/mmr.2015.3584
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team