Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Molecular Medicine Reports
Join Editorial Board Propose a Special Issue
Print ISSN: 1791-2997 Online ISSN: 1791-3004
Journal Cover
January-2016 Volume 13 Issue 1

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
January-2016 Volume 13 Issue 1

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Association between DNMT3L polymorphic variants and the risk of endometriosis-associated infertility

  • Authors:
    • Adrianna Mostowska
    • Malgorzata Szczepańska
    • Przemyslaw Wirstlein
    • Jana Skrzypczak
    • Paweł P. Jagodziński
  • View Affiliations / Copyright

    Affiliations: Department of Biochemistry and Molecular Biology, Poznań University of Medical Sciences, Poznań 60‑781, Poland, Department of Obstetrics, Gynecology and Gynecological Oncology, Division of Reproduction, Poznań University of Medical Sciences, Poznań 60‑781, Poland
  • Pages: 1040-1046
    |
    Published online on: November 30, 2015
       https://doi.org/10.3892/mmr.2015.4626
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

Endometriosis is considered to be an epigenetic disease. It has previously been reported that the DNA methyltransferase 3-like (DNMT3L) rs8129776 single nucleotide polymorphism (SNP) contributes to endometrioma. In the present study, high‑resolution melting curve analysis was used to investigate the risks associated with the DNMT3L c.910‑635A/G (rs8129776), c.832C/T (rs7354779), c.812C/T (rs113593938) and c.344+62C/T (rs2276248) SNPs on stage I‑II endometriosis‑associated infertility. Included in the present study were patients presenting with stage I‑II endometriosis‑associated infertility (n=154) and a control cohort of healthy patients with confirmed fertility (n=383). No significant association between the above‑listed DNMT3L SNPs and the development of endometriosis‑associated infertility was identified. The lowest P‑values generated from trend analysis were observed in the DNMT3L c.832C/T (rs7354779) SNP (Ptrend=0.114). Furthermore, haplotype analyses of the DNMT3L SNPs failed to reveal any risk association between the development of endometriosis‑associated infertility and the above‑listed polymorphisms, even when the SNPs were present in combinations. Finally, a meta‑analysis was performed to examine the association between the DNMT3L rs8129776 SNP and the development of endometrioma, from which no association between the two was identified. On the basis of these results, the present study has demonstrated that variations in the DNMT3L gene do not contribute to stage I-II endometriosis-associated infertility.

Introduction

Endometriosis is a gynecological disorder, which is characterized by the combined and multifocal localization of ectopic endometrial implants in the abdominal organs and abdominal cavity (1), which are frequently accompanied by clinical manifestations that include severe chronic pelvic pain and infertility (1-3). It is considered that endometrial lesions arise from additive interactions between genetic and environmental factors (2).

The ability of endometrial implants to survive outside of the uterus results from their increased estrogen activity, overactive oncogenic pathways and increased production of prostaglandins, cytokines and metalloproteinases (4,5). Additionally, the survival of endometrial implants can be prolonged due to abnormal immune system functioning, such that the ectopic endometrium does not get flagged for removal from the body (4,5).

There is increasing evidence to suggest that endometriosis is an epigenetic disease (6–9). Epigenetic regulators of gene transcription include DNA methylation patterns and histone modifications, which do not require direct changes to the DNA sequence (10). Several genes have been identified to possess abnormal methylation and expression patterns in women presenting with endometriosis (11–18). DNA methylation is produced by DNA methyltransferase enzymes (DNMTs) (10). These include the maintenance methyltransferase, DNMT1, as well as the de novo DNMT3A and DNMT3B enzymes (10). Aberrant expression levels of DNMT1, DNMT3A and DNMT3B have been demonstrated in patients with endo metriosis (17). There is an additional member of the human DNMT3 family, DNMT3 like (DNMT3L), which does not possess methyltransferase activity itself, but acts in a co-operative manner with DNMT3A and DNMT3B (19).

The presence of subtelomeric hypermethylated regions of DNA, as well as regions of hypomethylated DNA, which are distributed along the chromosomes, has been demonstrated in all types of endometriosis (20). Additionally, it has been demonstrated that the DNMT3L variant, rs113593938, which is situated within exon 10, makes an important contribution to subtelomeric hypomethylation (21). Previous reports have also identified an association between the DNMT3L rs8129776 gene variant and the development of endometrioma (22). Therefore, the present study aimed to determine the relative contributions of the DNMT3L c.910-635A/G (rs8129776), c.832C/T (rs7354779), c.812C/T (rs113593938) and c.344+62C/T (rs2276248) single nucleotide polymorphisms (SNPs) on the development of stage I II endometriosis. To address this question, women were selected from the Polish population with defined stage I–II endometriosis, according to the revised American Society for Reproductive Medicine classification (23).

Materials and methods

Study subjects

Peripheral blood samples were extracted from infertile women with endometriosis (n=154) and from healthy control individuals (n=383). The patients were recruited through the Gynecologic and Obstetrical University Hospital, Division of Reproduction at Poznan University of Medical Sciences (Poznan, Poland). Suspected cases of pelvic endometrioma were investigated laparoscopically (Table I). Visualization of endometriotic lesions and histopathological criteria were used to diagnose minimal endometriosis in infertile women. Each case of endometriosis was staged according to the revised classification of the American Society for Reproductive Medicine (23). The patients in the experimental cohort in the present study exhibited regular menses, an anatomically intact reproductive tract and infertility spanning at least 1 year, despite the desire for conception. The infertility was confirmed not to be a result of male factor infertility. The control patient cohort in the present study included fertile women of reproductive age, who were identified not to have any malignant disease, endometriosis or adenomyosis following surgical examinations performed during cesarean section. Each of the women in the control group had regular menses and an anatomically intact reproductive tract. Additional inclusion and exclusion criteria for the patient cohorts have been previously described in detail (24). The study subjects were matched by age, and were all Caucasians of Polish descent (Table I). Written informed consent was obtained from all the individuals involved in the present study, and all procedures were approved by the ethics committee of Poznan University of Medical Sciences (Poznan, Poland).

Table I

Clinical characteristics of the patients with endome triosis and control subjects.

Table I

Clinical characteristics of the patients with endome triosis and control subjects.

CharacteristicEndometriosisControl
Number154383
Age (years)31 (20–42)a31 (21–39)a
ParityNA1 (1–2)a
Duration of infertility (years)3 (1–6)aNA
rASRM (stage)Stage I (n=85)
Stage II (n=69)NA

a Data are presented as the median (range). rASRM, revised American Society for Reproductive Medicine classification (23); NA, not applicable.

Evaluation of the presence of DNMT3L SNPs

The genomic DNA was isolated from peripheral blood leukocytes by salt extraction. The SNPs used in the present study were selected on the basis of previous results (24), and are shown in Fig. 1. DNA samples were genotyped for four DNMT3L SNPs, including c.910-635A/G (rs8129776), c.832C/T (rs7354779), c.812C/T (rs113593938) and c.344+62C/T (rs2276248; Table I and Fig. 1). Genotyping was performed via high resolution melting (HRM) curve analysis using the LightCycler 480 system (Roche Diagnostics, Mannheim, Germany) with 5X HOT FIREPol EvaGreen HRM mix (Solis BioDyne, Tartu, Estonia). The PCR program consisted of an initial step at 95°C for 15 min to activate HOT FIREPol DNA polymerase, followed by 50 amplification cycles of denaturation at 95°C for 10 sec, primer-dependent annealing at 60.6°C for 10 sec, and elongation at 72°C for 15 sec. Amplified DNA fragments were then subjected to HRM with 0.1°C increments in temperature ranging from 76–97°C. Primer sequences and conditions for HRM analysis are presented in Table II. The quality of genotyping was evaluated by repeating measurements on a randomly selected 10% of the samples.

Figure 1

An LD plot of HapMap SNPs within the DNMT3L gene. The plot was generated using the genotypic data from the HapMap CEU samples and the Haploview 4.0 software package (Broad Institute, Cambridge, MA, USA). The names of the SNPs selected for examination are enclosed in boxes, and the asterisks correspond to the SNPs available in HapMap. The numbers within diamonds indicate the percentage of LD between a given pair of SNPs (D′ values). LD, linkage disequilibrium; SNP, single nucleotide polymor phism; DNMT3L, DNA methyltransferase 3 like.

Table II

High resolution melting curve conditions for genotyping of DNMT3L polymorphic variants.

Table II

High resolution melting curve conditions for genotyping of DNMT3L polymorphic variants.

rs no.Chromosome locationSNP function Alleles3MAFbPrimers for PCR amplification (5′–3′)PCR product length (bp)Annealing temp. (°C)Melt temp, range (°C)
rs8129776Chr21:45669629IntronA/G0.38F: GAACAGAGGTCGTAAGTTCCA
R: GTTATGGAGGAGCGGTGA
8557.876–91
rs7354779Chr21:45670770Missense p.Arg278GlyC/T0.25F: CACCAGATTGTCCACGAAC
R: GGTACCTGTTCCAGTTCCAC
9557.880–95
rs113593938Chr21:45670790Missense p.Arg271GlnC/T0.01F: GGGGCTGCCTGGCTTGGGC
R: CCTCAGCCCTGCCCCCTCACC
9270.082–97
rs2276248Chr21:45679258IntronC/T0.02F: AAATCCACCCACACTCCAGA
R: CTGCGGAAACCCTGATTG
11157.880–95

a According to the SNP database; the underlining denotes the minor allele in the control samples.

b MAF, minor allele frequency from the 1000 Genomes project for the Total European Ancestry (EUR) samples. F, forward; R, reverse; SNP, single nucleotide polymorphism; PCR, polymerase chain reaction.

Statistical analysis

For each SNP, the Hardy Weinberg equilibrium (HWE) was assessed using Pearson's goodness-of-fit χ2 statistic. Differences in allele and genotype frequencies between the case and control subjects were evaluated using Fisher's test. The associations between the SNPs selected for the present study and the development of endometriosis were evaluated using the Cochran-Armitage trend test. Statistical analyses were conducted using Statistica version 10 (Stat Soft, Inc., Tulsa, USA). Odds ratios (ORs) and associated 95% confidence intervals (95% CIs) were also determined. The data were analyzed using recessive and dominant inheritance models. Pair wise linkage disequilibrium (LD) between the selected SNPs was computed as D′ and r2 values using HaploView 4.0 software (http://www.broadinstitute.org//scientific-community/software). HaploView 4.0 software was also used for haplotype assessment. Significant P-values were corrected using a 1,000 fold permutation test.

Meta-analysis of the c.910- 635A/G (rs8129776) SNP

A meta-analysis of two independent datasets, of Borghese et al (22) and the present study, was performed using either fixed- or random-effect modeling. A fixed-effect model was used when no evidence of significant heterogeneity was identified between the two datasets, and a random-effect model was used when heterogeneity was observed. The heterogeneity between the two studies was assessed using χ2 based Cochrane Q and I2 statistics (25,26). P values generated using Cochrane's Q test that were <0.10 were considered to indicate the presence of heterogeneity between the two datsets. I2 values of 25, 50 and 75% were considered to indicate low, moderate and high levels of heterogeneity, respectively. The effects of contrast between alleles (G, vs. A) and between the dominant (AG+GG, vs. AA) and recessive (GG, vs. AG+AA) models were also estimated. All statistical calculations were conducted using Comprehensive Meta-Analysis version 2.0 software (www.MetaAnalysis.com).

Results

Distribution of DNMT3L c.910-635A/G (rs8129776), c.832C/T (rs7354779), c.812C/T (rs113593938) and c.344+62C/T (rs2276248) polymorphisms in patients with endometriosis-associated infertility

No divergence from the HWE was identified in the frequency of any of the genotypes examined in any of the groups (P>0.05). The number of genotypes, OR and 95% CI calculations for each of the four DNMT3L SNPs are shown in Table III. The lowest P values determined by the trend test were observed in the DNMT3L c.832C/T (rs7354779) SNP (Ptrend=0.114). No association was identified between any of the four DNMT3L SNPs and endometriosis associated infertility (Table III). In the dominant and recessive inheritance models for the c.910-635A/G polymorphism, the ORs were 1.150 (95% CI=0.783–1.689; P=0.476) and 1.085 (95% CI=0.633-1.860; P=0.767), respectively. In evaluating the same inheritance models for the c.832C/T SNP, the ORs were 1.346 (95% CI=0.925–1.961; P=0.120) and 1.320 (95% CI=0.700–2.491; P=0.390), respectively. In the dominant model for the c.812C/T and the c.344+62C/T SNPs, the ORs were measured as 2.215 (95% CI=0.351–18.011; P=0.324) and 0.826 (95% CI=0.295–2.313; P=0.806), respectively.

Table III

Association between DNMT3L polymorphic variants and the risk of endometriosis.

Table III

Association between DNMT3L polymorphic variants and the risk of endometriosis.

rs no.Position Alleles3Genotype casesbGenotype controlsbPtrend value ORdommnt(95%CI)c; P-value ORrecessive (95% CI)d; P-value
rs8129776 c.910–635A>GA/G22/74/5851/175/1570.5091.150 (0.783–1.689); 0.4761.085 (0.633–1.860); 0.767
rs7354779c.832T>CC/T16/70/6831/155/1980.1141.346 (0.925–1.961); 0.1201.320 (0.700–2.491); 0.390
rs 113593938c.812C>TC/T0/2/1520/2/3820.3422.215 (0.351–18.011); 0.324fNA
rs2276248c.344+62T>CC/T0/5/1490/15/3690.7150.826 (0.295–2.313); 0.806fNA

a According to the Single Nucleotide Polymorphism database; the underlining denotes the minor allele in the control samples.

b Genotypes (dd/Dd/DD), with d as the minor allele in the controls.

c Dominant model (dd+Dd, vs. DD) with d being the minor allele. dRecessive model (dd, vs. Dd+DD) with d as the minor allele. Fisher's exact test was used to determine the OR, 95% CI and P-values. CI, confidence interval; NA, not applicable; OR, odds ratio.

Association between DNMT3L haplotypes and endometriosis-associated infertility

The haplotype analyses of the DNMT3L SNPs did not suggest any polymorphism combination to be a risk factor for the development of endometriosis associated infertility (Table IV). The lowest overall P values; P=0.046, (Pcorr=0.094) and P=0.046, (Pcorr=0.109), were observed for haplotypes ATC (rs8129776/rs7354779/rs113593938) and AT (rs8129776/rs7354779). The DNMT3L SNPs featured in the present study ranged between complete and weak pairwise LD values. The D′ and r2 values, as calculated from the control samples, ranged between 0.001 and 1.000 (Table V).

Table IV

Haplotype analysis of DNMT3L polymorphic variants.

Table IV

Haplotype analysis of DNMT3L polymorphic variants.

PolymorphismHaplotypeFrequencyCase, control ratioχ2P valuePcorr valuea
rs8129776_rs7354779GT0.3640.374, 0.3590.2140.6440.887
AT0.3400.295, 0.3583.9940.0460.109
AC0.2910.322, 0.2782.1120.1460.301
rs7354779_rs113593938TC0.7030.666, 0.7172.8370.0920.097
CC0.2940.328, 0.2802.4450.1180.122
rs113593938_rs2276248CT0.9780.977, 0.9780.0040.9531.000
CC0.0190.016, 0.0200.1310.7170.930
rs8129776_rs7354779_rs113593938GTC0.3620.371, 0.3590.1390.7090.941
ATC0.3400.295, 0.3583.9920.0460.094
ACC0.2880.319, 0.2762.0270.1550.331
rs7354779_rs113593938_rs2276248TCT0.6840.649, 0.6982.4020.1210.188
CCT0.2940.328, 0.2802.4420.1180.185
TCC0.0190.016, 0.0200.1310.7170.992
rs8129776_rs7354779_rs113593938_rs2276248GTCT0.3480.356, 0.3450.1240.7250.985
ATCT0.3390.294, 0.3583.9650.0470.131
ACCT0.2850.318, 0.2722.3640.1240.361
GTCC0.0140.015, 0.0140.0070.9331.000

a P value calculated using the permutation test with a total of 1,000 permutations.

Table V

Linkage disequilibrium between polymorphic variants of the DNMT3L gene in the control samples.

Table V

Linkage disequilibrium between polymorphic variants of the DNMT3L gene in the control samples.

PolymorphismPolymorphism
rs8129776rs7354779rs113593938rs2276248
rs8129776–0.960a1.000a0.554a
rs73547790.209–1.0000.603a
rs1135939380.001b0.007b–1.000a
rs22762480.011b0.003b0.000b–

a D′ values;

b r2 values.

Meta-analysis

The association between the DNMT3L rs8129776 polymorphism and the risk of endometriosis is shown in Table VI. The meta-analysis was performed between two datasets, comprising a French population from a study by Borghese et al (22) and the Polish population in the present study. Under the assumption of a dominant model, no heterogeneity was identified between the studies (Q test P value=0.255; I2=22.7%). The OR (fixed-effect model) for patients with endometriosis with AG+GG, vs. AA was 1.007 (95% CI: 0.739–1.370; P=0.967). Under the assumption of a recessive and allelic model, a high level of heterogeneity was observed between the two datasets (Q test P value=0.006 and 0.013, respectively; I2>83%). The OR (random effect model) for patients with endometriosis with the GG, vs. AG+AA was 0.596 (95% CI: 0.176–2.010; P=0.404). The OR (random effect model) for the G allele in patients with endometriosis was 0.836 (95% CI: 0.480–1.456; P=0.527).

Table VI

Meta-analysis of the association between the DNMT3L rs8129776 polymorphism and endometriosis risk.

Table VI

Meta-analysis of the association between the DNMT3L rs8129776 polymorphism and endometriosis risk.

ModelModel and studyOdds ratioLower limitUpper limitZ valueHeterogeneity
P valueQ valueaP valueaI2 value
Dominant model (AG+GG, vs. AA)
Borghese et al (22)0.7910.4721.3270.8880.3751.2930.25522.675
Present study1.1500.7831.6890.7120.476
Fixed effect1.0070.7391.3700.0420.967
Recessive model (GG, vs. AG+AA)
Borghese et al (22)0.3130.1550.6323.2420.0017.5690.00686.789
Present study1.0850.6331.860.2960.767
Random effect0.5960.1762.010−0.8350.404
Allelic model (G, vs. A)
Borghese et al (22)0.6220.4360.8892.6100.0096.1200.01383.659
Present study1.0960.8341.4400.6610.509
Random effect0.8360.4801.456−0.6330.527

a χ2 based Cochrane Armitage Q test.

Discussion

Endometriosis is an estrogen dependent inflammatory disease, which is considered to arise in response to epigenetic changes (13,16,27). Such changes lead to enhancements in the estrogen activity and invasiveness of endometriotic cells, and may be associated with hypomethylation of the steroidogenic factor 1 (SF-1), aromatase, estrogen receptor 2 and E-cadherin (13,16,27,28) genes. By contrast, infertility in women presenting with endometriosis may be associated with the hypermethylation of the homeobox A10 (HOXA10), HOXA11 and progesterone receptor (PR-B) genes (14,15,28,29).

DNMT3L is one of the essential molecules involved in de novo DNA methylation during the epigenetic reprogramming of cells (30). DNMT3L interacts with either DNMT3A or DNMT3B to effect de novo DNA methylation. DNMT3L may also bind to selective chromatin regions that have specific histone modifications capable of modulating DNMT3A action (31–33). The ability of DNMT3L to bind to histone deacetylase 1 further suggests the active role that DNMT3L has in regulating transcriptional repression at the chromatin level (34). It has also been suggested that hyperacetylation of histones may account for the overexpression of G protein coupled estrogen receptor 1, SF-1 and hypoxia inducible factor 1α in endometrial lesions (35–38). Furthermore, decreased expression and hypoacetylation of histones have been observed in endometriotic cells for the CCAAT/enhancer binding protein, cyclin dependent kinase (CDK) inhibitor 2A, CDK inhibitor 1A, CDK inhibitor 1B, checkpoint kinase 2, death receptor 6, E-cadherin and HOXA10 genes (8,35,38,39).

The DNMT3L c.812C/T transition (rs113593938), associated with subtelomeric hypomethylation, leads to the replacement of an arginine residue with glutamine at position 271 of the DNMT3L protein, which can effect the stimulation of DNMT3A (21). No significant associations between the DNMT3L rs8129776, rs7354779, rs113593938 or rs2276248 polymorphisms and stage I II endometriosis associated infertility were identified in the present study, either on an individual SNP basis or in combinations of SNPs. By contrast, Borghese et al (22) demonstrated an association between rs8129776 and the development of endometrioma (22), and it was further demonstrated that the ACCC+T haplotypes for rs8129776, rs7354779, rs113593938 and rs2276248 served as risk factors for endometrioma (22). Such discrepancies between studies may be due to the use of patient cohorts presenting with different classes of endometriosis. Neither the meta-analyses performed by Borghese et al (22) nor the meta-analysis performed in the present study revealed any association between the rs8129776 SNP and the development of endometriosis.

In addition, two genome wide association studies (GWAS), which were performed in Caucasian and Japanese populations failed to demonstrate an association between DNMT3L SNPs and endometriosis (40,41). However, the Caucasian patients included in these studies presented with an assortment of disparate categories of endometriosis (40), although no histological analyses were performed to confirm the presence of systematic endometriosis in the Japanese patient cohort (41). The GWAS also eliminated several of the genetic variants, which were demonstrated to be associated with disease, due to low significance.

In conclusion, the present study demonstrated that the DNMT3L SNPs; rs8129776, rs7354779, rs113593938 and rs2276248, are not risk factors for endometriosis. The present study was performed on patients presenting with infertility and stage I II endometriosis, and further investigations are required in the future to include additional categories of endometriosis, using a larger groups of patients from disparate cohorts.

Acknowledgments

This study was supported by Poznan University of Medical Sciences (grant. no. 502-01-01124182-07474).

References

1 

Chapron C, Fauconnier A, Vieira M, Barakat H, Dousset B, Pansini V, Vacher Lavenu MC and Dubuisson JB: Anatomical distribution of deeply infiltrating endometriosis: Surgical implications and proposition for a classification. Hum Reprod. 18:157–161. 2003. View Article : Google Scholar : PubMed/NCBI

2 

Dun EC, Taylor RN and Wieser F: Advances in the genetics of endometriosis. Genome Med. 2:752010. View Article : Google Scholar : PubMed/NCBI

3 

de Ziegler D, Borghese B and Chapron C: Endometriosis and infertility: Pathophysiology and management. Lancet. 376:730–738. 2010. View Article : Google Scholar : PubMed/NCBI

4 

Bulun SE: Endometriosis. N Engl J Med. 360:268–279. 2009. View Article : Google Scholar : PubMed/NCBI

5 

Berbic M and Fraser IS: Regulatory T cells and other leukocytes in the pathogenesis of endometriosis. J Reprod Immunol. 88:149–155. 2011. View Article : Google Scholar : PubMed/NCBI

6 

Zheng Y, Tabbaa ZM, Khan Z, Schoolmeester JK, El Nashar S, Famuyide A, Keeney GL and Daftary GS: Epigenetic regulation of uterine biology by transcription factor KLF11 via posttranslational histone deacetylation of cytochrome p450 metabolic enzymes. Endocrinology. 155:4507–4520. 2014. View Article : Google Scholar : PubMed/NCBI

7 

Izawa M, Taniguchi F, Terakawa N and Harada T: Epigenetic aberration of gene expression in endometriosis. Front Biosci (Elite Ed). 5:900–910. 2013. View Article : Google Scholar

8 

Kai K, Nasu K, Kawano Y, Aoyagi Y, Tsukamoto Y, Hijiya N, Abe W, Okamoto M, Moriyama M and Narahara H: Death receptor 6 is epigenetically silenced by histone deacetylation in endometriosis and promotes the pathogenesis of endometriosis. Am J Reprod Immunol. 70:485–496. 2013. View Article : Google Scholar : PubMed/NCBI

9 

Fung JN, Rogers PA and Montgomery GW: Identifying the biological basis of GWAS hits for endometriosis. Biol Reprod. 92:872015. View Article : Google Scholar : PubMed/NCBI

10 

Turek Plewa J and Jagodziński PP: The role of mammalian DNA methyltransferases in the regulation of gene expression. Cell Mol Biol Lett. 10:631–647. 2005.PubMed/NCBI

11 

Lee B, Du H and Taylor HS: Experimental murine endometriosis induces DNA methylation and altered gene expression in eutopic endometrium. Biol Reprod. 80:79–85. 2009. View Article : Google Scholar

12 

Wu Y, Strawn E, Basir Z, Halverson G and Guo SW: Promoter hypermethylation of progesterone receptor isoform B (PR B) in endometriosis. Epigenetics. 1:106–111. 2006. View Article : Google Scholar

13 

Xue Q, Lin Z, Cheng YH, Huang CC, Marsh E, Yin P, Milad MP, Confino E, Reierstad S, Innes J and Bulun SE: Promoter meth ylation regulates estrogen receptor 2 in human endometrium and endometriosis. Biol Reprod. 77:681–687. 2007. View Article : Google Scholar : PubMed/NCBI

14 

Wu Y, Starzinski Powitz A and Guo SW: Prolonged stimulation with tumor necrosis factor alpha induced partial methylation at PR B promoter in immortalized epithelial like endometriotic cells. Fertil Steril. 90:234–237. 2008. View Article : Google Scholar

15 

Wu Y, Halverson G, Basir Z, Strawn E, Yan P and Guo SW: Aberrant methylation at HOXA10 may be responsible for itsaberrant expression in the endometrium of patients with endometriosis. Am J Obstet Gynecol. 193:371–380. 2005. View Article : Google Scholar : PubMed/NCBI

16 

Xue Q, Lin Z, Yin P, Milad MP, Cheng YH, Confino E, Reierstad S and Bulun SE: Transcriptional activation of steroidogenic factor 1 by hypomethylation of the 5′ CpG island in endometriosis. J Clin Endocrinol Metab. 92:3261–3267. 2007. View Article : Google Scholar : PubMed/NCBI

17 

Wu Y, Strawn E, Basir Z, Halverson G and Guo SW: Aberrant expression of deoxyribonucleic acid methyltransferases DNMT1, DNMT3A and DNMT3B in women with endometriosis. Fertil Steril. 87:24–32. 2007. View Article : Google Scholar

18 

Borghese B, Mondon F, Noël JC, Fayt I, Mignot TM, Vaiman D and Chapron C: Gene expression profile for ectopic versus eutopic endometrium provides new insights into endometriosis oncogenic potential. Mol Endocrinol. 22:2557–2562. 2008. View Article : Google Scholar : PubMed/NCBI

19 

Kareta MS, Botello ZM, Ennis JJ, Chou C and Chédin F: Reconstitution and mechanism of the stimulation of de novo methylation by human DNMT3L. J Biol Chem. 281:25893–25902. 2006. View Article : Google Scholar : PubMed/NCBI

20 

Borghese B, Barbaux S, Mondon F, Santulli P, Pierre G, Vinci G, Chapron C and Vaiman D: Research resource: Genome wide profiling of methylated promoters in endometriosis reveals a subtelomeric location of hypermethylation. Mol Endocrinol. 24:1872–1885. 2010. View Article : Google Scholar : PubMed/NCBI

21 

El Maarri O, Kareta MS, Mikeska T, Becker T, Diaz-Lacava A, Junen J, Nüsgen N, Behne F, Wienker T, Waha A, et al: A systematic search for DNA methyltransferase polymorphisms reveals a rare DNMT3L variant associated with subtelomeric hypomethylation. Hum Mol Genet. 18:1755–1768. 2009. View Article : Google Scholar : PubMed/NCBI

22 

Borghese B, Santulli P, Héquet D, Pierre G, de Ziegler D, Vaiman D and Chapron C: Genetic polymorphisms of DNMT3L involved in hypermethylation of chromosomal ends are associated with greater risk of developing ovarian endometriosis. Am J Pathol. 180:1781–1786. 2012. View Article : Google Scholar : PubMed/NCBI

23 

Revised american society for reproductive medicine classification of endometriosis: 1996.Fertil Steril. 67:817–821. 1997.

24 

Szczepańska M, Wirstlein P, Skrzypczak J and Jagodziński PP: Polymorphic variants of CYP17 and CYP19A and risk of infertility in endometriosis. Acta Obstet Gynecol Scand. 92:1188–1193. 2013.

25 

Ioannidis JP, Patsopoulos NA and Evangelou E: Uncertainty in heterogeneity estimates in meta-analyses. BMJ. 335:914–916. 2007. View Article : Google Scholar : PubMed/NCBI

26 

Higgins JP, Thompson SG, Deeks JJ and Altman DG: Measuring inconsistency in meta-analyses. BMJ. 327:557–560. 2003. View Article : Google Scholar : PubMed/NCBI

27 

Izawa M, Taniguchi F, Uegaki T, Takai E, Iwabe T, Terakawa N and Harada T: Demethylation of a nonpromoter cytosine phosphate guanine island in the aromatase gene may cause the aberrant up regulation in endometriotic tissues. Fertil Steril. 95:33–39. 2011. View Article : Google Scholar

28 

Szczepańska M, Wirstlein P, Skrzypczak J and Jagodziński PP: Expression of HOXA11 in the mid luteal endometrium from women with endometriosis associated infertility. Reprod Biol Endocrinol. 10:12012. View Article : Google Scholar

29 

Wu Y, Starzinski Powitz A and Guo SW: Trichostatin A, a histone deacetylase inhibitor, attenuates invasiveness and reactivates E-cadherin expression in immortalized endometriotic cells. Reprod Sci. 14:374–382. 2007. View Article : Google Scholar : PubMed/NCBI

30 

Liao HF, Tai KY, Chen WS, Cheng LC, Ho HN and Lin SP: Functions of DNA methyltransferase 3-like in germ cells and beyond. Biol Cell. 104:571–587. 2012. View Article : Google Scholar : PubMed/NCBI

31 

Hu JL, Zhou BO, Zhang RR, Zhang KL, Zhou JQ and Xu GL: The N-terminus of histone H3 is required for de novo DNA methylation in chromatin. Proc Natl Acad Sci USA. 106:22187–22192. 2009. View Article : Google Scholar : PubMed/NCBI

32 

Ooi SK, Qiu C, Bernstein E, Li K, Jia D, Yang Z, Erdjument-Bromage H, Tempst P, Lin SP, Allis CD, et al: DNMT3L connects unmethylated lysine 4 of histone H3 to de novo methylation of DNA. Nature. 448:714–717. 2007. View Article : Google Scholar : PubMed/NCBI

33 

Zhang Y, Jurkowska R, Soeroes S, Rajavelu A, Dhayalan A, Bock I, Rathert P, Brandt O, Reinhardt R, Fischle W and Jeltsch A: Chromatin methylation activity of Dnmt3a and Dnmt3a/3 L is guided by interaction of the ADD domain with the histone H3 tail. Nucleic Acids Res. 38:4246–4253. 2010. View Article : Google Scholar : PubMed/NCBI

34 

Deplus R, Brenner C, Burgers WA, Putmans P, Kouzarides T, de Launoit Y and Fuks F: DNMT3L is a transcriptional repressor that recruits histone deacetylase. Nucleic Acids Res. 30:3831–3838. 2002. View Article : Google Scholar : PubMed/NCBI

35 

Monteiro JB, Colón Díaz M, García M, Gutierrez S, Colón M, Seto E, Laboy J and Flores I: Endometriosis is characterized by a distinct pattern of histone 3 and histone 4 lysine modifications. Reprod Sci. 21:305–318. 2014. View Article : Google Scholar :

36 

Samartzis N, Samartzis EP, Noske A, Fedier A, Dedes KJ, Caduff R, Fink D and Imesch P: Expression of the G protein coupled estrogen receptor (GPER) in endometriosis: A tissue microarray study. Reprod Biol Endocrinol. 2012:10–30. 2012.

37 

Imesch P, Samartzis EP, Dedes KJ, Fink D and Fedier A: Histone deacetylase inhibitors down regulate G protein coupled estrogen receptor and the GPER antagonist G 15 inhibits proliferation in endometriotic cells. Fertil Steril. 100:770–776. 2013. View Article : Google Scholar : PubMed/NCBI

38 

Nasu K, Kawano Y, Kai K, Aoyagi Y, Abe W, Okamoto M and Narahara H: Aberrant histone modification in endometriosis. Front Biosci (Landmark Ed). 19:1202–1214. 2014. View Article : Google Scholar

39 

Kawano Y, Nasu K, Hijiya N, Tsukamoto Y, Amada K, Abe W, Kai K, Moriyama M and Narahara H: CCAAT/enhancer-binding protein α is epigenetically silenced by histone deacetylation in endometriosis and promotes the pathogenesis of endometriosis. J Clin Endocrinol Metab. 98:E1474–E1482. 2013. View Article : Google Scholar : PubMed/NCBI

40 

Painter JN, Anderson CA, Nyholt DR, Macgregor S, Lin J, Lee SH, Lambert A, Zhao ZZ, Roseman F, Guo Q, et al: Genome wide association study identifies a locus at 7p15.2 associated with endometriosis. Nat Genet. 43:51–54. 2011. View Article : Google Scholar :

41 

Uno S, Zembutsu H, Hirasawa A, Takahashi A, Kubo M, Akahane T, Aoki D, Kamatani N, Hirata K and Nakamura Y: A genome-wide association study identifies genetic variants in the CDKN2BAS locus associated with endometriosis in Japanese. Nat Genet. 42:707–710. 2010. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Mostowska A, Szczepańska M, Wirstlein P, Skrzypczak J and Jagodziński PP: Association between DNMT3L polymorphic variants and the risk of endometriosis-associated infertility. Mol Med Rep 13: 1040-1046, 2016.
APA
Mostowska, A., Szczepańska, M., Wirstlein, P., Skrzypczak, J., & Jagodziński, P.P. (2016). Association between DNMT3L polymorphic variants and the risk of endometriosis-associated infertility. Molecular Medicine Reports, 13, 1040-1046. https://doi.org/10.3892/mmr.2015.4626
MLA
Mostowska, A., Szczepańska, M., Wirstlein, P., Skrzypczak, J., Jagodziński, P. P."Association between DNMT3L polymorphic variants and the risk of endometriosis-associated infertility". Molecular Medicine Reports 13.1 (2016): 1040-1046.
Chicago
Mostowska, A., Szczepańska, M., Wirstlein, P., Skrzypczak, J., Jagodziński, P. P."Association between DNMT3L polymorphic variants and the risk of endometriosis-associated infertility". Molecular Medicine Reports 13, no. 1 (2016): 1040-1046. https://doi.org/10.3892/mmr.2015.4626
Copy and paste a formatted citation
x
Spandidos Publications style
Mostowska A, Szczepańska M, Wirstlein P, Skrzypczak J and Jagodziński PP: Association between DNMT3L polymorphic variants and the risk of endometriosis-associated infertility. Mol Med Rep 13: 1040-1046, 2016.
APA
Mostowska, A., Szczepańska, M., Wirstlein, P., Skrzypczak, J., & Jagodziński, P.P. (2016). Association between DNMT3L polymorphic variants and the risk of endometriosis-associated infertility. Molecular Medicine Reports, 13, 1040-1046. https://doi.org/10.3892/mmr.2015.4626
MLA
Mostowska, A., Szczepańska, M., Wirstlein, P., Skrzypczak, J., Jagodziński, P. P."Association between DNMT3L polymorphic variants and the risk of endometriosis-associated infertility". Molecular Medicine Reports 13.1 (2016): 1040-1046.
Chicago
Mostowska, A., Szczepańska, M., Wirstlein, P., Skrzypczak, J., Jagodziński, P. P."Association between DNMT3L polymorphic variants and the risk of endometriosis-associated infertility". Molecular Medicine Reports 13, no. 1 (2016): 1040-1046. https://doi.org/10.3892/mmr.2015.4626
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team