Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Molecular Medicine Reports
Join Editorial Board Propose a Special Issue
Print ISSN: 1791-2997 Online ISSN: 1791-3004
Journal Cover
March-2016 Volume 13 Issue 3

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
March-2016 Volume 13 Issue 3

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Anti-inflammatory potential of ursolic acid in Mycobacterium tuberculosis-sensitized and Concanavalin A-stimulated cells

  • Authors:
    • Tamanna Zerin
    • Minjung Lee
    • Woong Sik Jang
    • Kung‑Woo Nam
    • Ho‑Yeon Song
  • View Affiliations / Copyright

    Affiliations: Department of Microbiology, School of Medicine, Soonchunhyang University, Cheonan, Chungnam 330‑090, Republic of Korea, Regional Innovation Center, Soonchunhyang University, Asan, Chungnam 336‑745, Republic of Korea, Department of Life Science and Biotechnology, College of Natural Science, Soonchunhyang University, Asan, Chungnam 336‑745, Republic of Korea
  • Pages: 2736-2744
    |
    Published online on: February 1, 2016
       https://doi.org/10.3892/mmr.2016.4840
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

Ursolic acid (3-β-3-hydroxy-urs-12-ene-28-oic-acid; UA) is a triterpenoid carboxylic acid with various pharmaceutical properties. It is commonly found in apples, basil, berries, rosemary, peppermint, lavender, oregano, thyme, hawthorn and prunes. In the present study, the activities of UA against the Mycobacterium tuberculosis H37Rv‑induced release of a panel of inflammatory cytokines, including tumor necrosis factor-α (TNF-α), interleukin (IL)-1β and IL-6 from RAW 264.7 murine macrophages, A549 alveolar epithelial cells and in concanavalin A (Con A)-stimulated rat splenocytes were investigated. In addition, the present study examined the ability of UA to reduce the expression levels of the inflammatory mediators, cyclooxygenase‑2 (COX‑2) and inducible nitric oxide synthase (iNOS) in the stimulated cells. The reduction of nitric oxide (NO) release by UA was also examined in the stimulated cells. UA significantly inhibited the mRNA expression levels of TNF‑α, IL‑1β and IL‑6 in the stimulated cells. The expression levels of COX‑2 and iNOS were also suppressed by UA, as was the release of NO at a significant level. The data indicated the potency of UA on different cell types, which may assist in the development of anti‑inflammatory drugs. In the case of adjunct host‑directed immune therapy for tuberculosis, UA may be used, in addition to established antibiotic therapies, to improve treatment efficacy and outcome due to their anti‑inflammatory potential. Further detailed investigations are required to establish its use as an anti-inflammatory.

Introduction

Inflammation is a complex biological response, acting as a self-defense mechanism against harmful environmental insults, which involves a network of cellular responses, cytokines, including interleukin (IL)-1β, IL-6, tumor necrosis factor-α (TNF-α), and humoral factors (1,2). However, their persistence may lead to chronic inflammation, which may be associated with several diseases, including cancer (1,3), neoplasia, inflammatory bowel disease, ulcerative colitis (4,5), arthritis (6), asthma and Alzheimer's disease (7). The detrimental effects of chronic inflammation can be controlled by conventional treatments, however, resistance to the drugs used and their side-effects necessitate the development of novel anti-inflammatory drugs (8). Previous studies have investigated the use of adjunct immunotherapies to improve treatment success for tuberculosis (TB). Among these, the immunosuppression-mediated reduction of TNF-α levels by current antibiotic therapies may eventually be effective in treating highly contagious TB (9).

In general, when M. tuberculosis enters the lung, it interacts with macrophages. Macrophages have been the most commonly examined cells in investigations of TB, although epithelial cells are being increasingly examined in TB, as they are essential in the immune response during pulmonary tuberculosis (10–13). Nitric oxide (NO) is an important mediator in cell signaling, neurotransmission and in the host defense mechanism (14,15). M. tuberculosis infection induces the activity of inducible nitric oxide synthase (iNOS) in A549 cells, which leads to the production of a significant level of NO (13).

A natural triterpenoid carboxylic acid, 3-β-3-hydroxy-urs-12-ene-28-oic-acid (uracil; UA), is present in a wide variety of foods (16). Its biochemical and pharmacological effects include anti-inflammatory, antioxidant, antiproliferative, anticancer, antimutagenic, antihypertensive, and antiviral properties (17,18). UA can also inhibit the immunoregulatory transcription factor, nuclear factor κ-light-chain-enhancer of activated B cells (NF-κB), in response to a wide variety of carcinogens and inflammatory agents (19). There is also evidence supporting the anti-inflammatory effects of UA (2).

In the present study, M. tuberculosis-induced RAW 264.7 mouse monocyte macrophages, A549 type II alveolar cells and mitogen, concanavalin A-induced rat splenocytes were used to examine the effect of UA on immune regulation. The aim of the present study was to investigate the anti-inflammatory potential of UA, a candidate drug for controlling inflammation-associated diseases.

Materials and methods

Cell culture

RAW 264.7 mouse monocyte macrophages and A549 type II alveolar cells, purchased from American Type Culture Collection (ATCC; Manassas, VA, USA) were maintained in Dulbecco's Modified Eagle's Medium (DMEM) supplemented with 10% heat-inactivated fetal bovine serum (FBS), 100 U/ml penicillin and 100 µg/ml streptomycin (Invitrogen; Thermo Fisher Scientific, Inc., Waltham, MA, USA) at 37°C in a humidified incubator with 5% CO2 and sub-cultured every 2–3 days.

Reagents, treatment conditions and durations

The UA, NG-monomethyl-L-arginine (L-NMMA), and concanavalin A (Con A) were obtained from Sigma-Aldrich (St. Louis, MO, USA). Throughout the present study, the cells (1×105 cells/ml) were treated with 10 µg/ml UA and 5 mM L-NMMA for 6 h following M. tuberculosis infection, following which they were incubated for the specified durations. Immediately prior to infection or treatment, the medium were replaced with serum-free DMEM. In the case of the splenocytes, the cells (1×106 cells/ml) were co-treated with 5 µg/ml Con A and 10 µg/ml UA for the specified durations.

Animals and primary splenocyte collection

Female Wistar rats (190–220 g; 8-weeks old; n=8) were purchased from Nara Biotech, Ltd. (Pyeongtaek-si, Korea). The animals were housed in a solid-bottomed cage at 23±2°C, maintained under a 12 h light-dark cycle and fed standard rodent chow (Purina Rodent Chow; Purina Co., Ltd., Seoul, Korea) and water ad libitum. The present study was performed according to the guidelines of the United States National Institutes of Health, and was approved by the ethics committee of Soonchunhyang University (Asan, Korea; SCH14-0031).

Primary splenocytes were collected from the rats following sacrifice by cervical dislocation, and aseptic collection of the spleen was performed. Each spleen was immersed in RPMI 1640 culture medium supplemented with 10% (v/v) heat-inactivated FBS and a 1% (v/v) antibiotic/antimycotic cocktail, comprising 100 U/ml penicillin, 100 µg/ml streptomycin and 0.25 µg/ml amphotericin B (Invitrogen; Thermo Fisher Scientific, Inc.). The cells were passed through a cell strainer (BD Biosciences, Durham, NC, USA) to form a single cell suspension. Erythrocytes were excluded from the resulting cell suspension using lysis buffer (Life Technologies, Seoul, Korea), containing 0.15 M NH4Cl, 10 mM KHCO3 and 0.1 mM Na2EDTA (pH 7.3). The cells were washed once with phosphate-buffered saline (PBS) and cultured at a density of 106 cells/ml. Cell viability was determined according to the exclusion of Trypan blue (Sigma-Aldrich). The cells were maintained under standard culture conditions at 37°C.

Mycobacterium infection/invasion

The M. tuberculosis H37Rv strain was purchased from ATCC and was grown in Middlebrook 7H11 agar (Becton Dickinson, Sparks, MD, USA) or Ogawa medium for ~3 weeks. Isolated colonies were inoculated in Middlebrook 7H9 broth (Becton Dickinson) in am incubator with agitation for 15 days. To avoid clumping, the bacterial suspension was vortexed vigorously with glass beads, and then passed through an 8-µm filter to form a single cell suspension. The suspension was allowed to stand for several minutes to settle and two-thirds of the clear upper portion of suspension was used for quantification at 600 nm using the UVmini-1240 spectrophotometer (Shimadzu, Kyoto, Japan) adjusted with McFarland standards. A 0.5 McFarland standard was prepared by mixing 0.05 ml of 1.175% barium chloride dihydrate with 9.95 ml of 1% sulfuric acid. Subsequently, 10 µl of the suspension was inoculated in Middlebrook 7H11 agar or Ogawa medium at 37°C in an atmosphere of 5% CO2 for 3–4 weeks to quantify the bacterial number in colony forming units (cfu). Following count determination, the bacterial suspension was aliquoted and stored at −76°C as a single volume

For in vitro infection, the RAW 264.7 (2×105 cells) and A549 (2×105 cells) cells were grown in six-well plates overnight and infected with M. tuberculosis H37Rv at a 1:10 ratio for 3 h in the aforementioned cell culture conditions. The cells were washed with warm PBS three to five times to remove extracellular bacteria. To confirm successful invasion of the bacteria, the final wash medium and cell extract (100 µl), following cell dissolution with 0.1% Triton X-100 (Sigma-Aldrich), were inoculated in Middlebrook 7H11 agar for colony counting, Middlebrook 7H9 broth for a resazurin assay (20) and in a Bactec MGIT system (Becton Dickinson) for the determination of time to detection (TTD) (21), as described previously (22). Prior to proceeding, it was confirmed that the bacteria present in the final wash medium were absent or few in number, compared with the high numbers of viable bacteria in the extracted cell suspension, which confirmed successful bacterial invasion.

Cell viability assay

The cell viability assay performed in the present study was based on the conversion of 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT; Sigma-Aldrich) to formazan crystals by the mitochondrial dehydrogenase enzyme (23). In brief, the cells (1×105 cells/ml) were seeded overnight to achieve ~80% confluence and were treated with 10 µg/ml UA for 0, 6, 12, 24, 48 and 72 h. At the determined time, 20 µl of 5 mg/ml MTT reagent was added. Following 4 h incubation at 37°C, the medium were aspirated, and 100 µl of dimethylsulfoxide (Samchun Pure Chemical Co., Ltd., Pyeongtaek, Korea) was added to dissolve the formazan crystals. The absorbance was measured at 570 nm using a Victor™ X3 multilabel reader (Perkin Elmer, Inc., Waltham, MA, USA).

Splenocyte viability was determined using an MTS-based assay (24). In brief, the cells were treated for the indicated times periods, and the detection reagent was prepared using MTS and phenazine methosulfate (Sigma-Aldrich) at a ratio of 20:1, which was added at a 1:5 ratio of reagent mixture to cell culture. The absorbance was detected at 492 nm using the Victor™ X3 multilabel reader.

RNA extraction and reverse transcription-quantitative polymerase chain reaction (RT-qPCR)

The cells were infected and/or treated for the indicated time periods, following which the total RNA was extracted using an RNeasy Mini kit (Qiagen, Valencia, CA, USA) and quantified using an ND-1000 spectrophotometer (NanoDrop Technologies, Wilmington, NC, USA) at 260 nm. The assay used RNA at a 260:280 nm ratio of 1.8–2.0, indicating high purity. Subsequently, cDNA was prepared using 1,000 ng of the total RNA using Oligo dT15 Primer (Maxime™ RT PreMix kit; Intron Biotechnology, Inc., Seongnam, Korea) in a Veriti® 96-Well Thermal Cycler (Applied Biosystems; Thermo Fisher Scientific, Inc.). Subsequently, qPCR was performed to amplify the cDNA using an iQ SYBR Green Supermix kit (Bio-Rad Laboratories, Inc., Hercules, CA, USA), according to the manufacturer's protocol, in a CFX96TM real-time PCR detection system (Bio-Rad Laboratories, Inc.). The temperature cycle followed for qPCR was as follows: 95°C for 5 min, followed by 40 cycles of 95°C for 10 sec, 42°C for 10 sec and 72°C for 20 sec. A dissociation curve was acquired to ensure the specificity of the PCR product in every PCR assay. The assay results were normalized to the endogenous control gene, glyceraldehyde 3-phosphate dehydrogenase. The primers used were purchased from Bioneer Corporation (Seoul, Korea) and are listed in Table I, with the exception of human interleukin 1-β (IL-1β), and interleukin 6 (IL-6), which were also purchased from Bioneer Corporation (Seoul, Korea; cat. nos. N-1058 and N-1063, respectively). Relative quantification was obtained using the comparative threshold cycle (∆∆Cq) method. A CFX96™ real-time PCR detection system (Bio-Rad Laboratories, Inc.) with a default calculation system was used.

Table I

List of primers used for reverse transcription-quantitative polymerase chain reaction analysis.

Table I

List of primers used for reverse transcription-quantitative polymerase chain reaction analysis.

GeneForward primer (5′→3′)Reverse primer (5′→3′)
Mouse
 TNF-α TGTCTCAGCCTCTTCTCATT AGATGATCTGAGTGTGAGGG
 IL-6 TTGCCTTCTTGGGACTGATG CCACGATTTCCCAGAGAACA
 IL-1β GGGCTGCTTCCAAACCTTTG TGATACTGCCTGCCTGAAGCTC
 iNOS CCCTTCCGAAGTTTCTGGCAGCAGC GGCTGTCAGAGCCTCGTGGCTTTGG
 COX-2 CCAGCACTTCACCCATCAGTT ACCCAGGTCCTCGCTTATGA
 L32 GCCAGGAGACGACAAAAAT AATCCTCTTGCCCTGATCC
Human
 TNF-α TCTTCTCGAACCCCGAGTGA CCTCTGATGGCACCACCAG
 iNOS CCTCTGATGGCACCACCAG ACCCTGCCAACGTGGAATTCACTCAG
 COX-2 TTCAAATGAGATTGTGGGAAAATTGCT AGATCATCTCTGCCTGAGTATCTT
 GAPDH TCCCATCACCATCTTCCA CATCACGCCACAGTTTCC
Rat
 TNF-α GACCCTCACACTCAGATCATCTTCT TGCTACGACGTGGGCTACG
 IL-6 CGAGCCCACCAGGAACGAAAGTC CTGGCTGGAAGTCTCTTGCGGAG
 IL-1β CCCTGCAGCTGGAGAGTGTGG TGTGCTCTGCTTGAGAGGTGCT
 iNOS GTGCTAATGCGGAAGGTCATG GCTTCCGACTTTCCTGTCTCAGTA
 COX-2 GTGTCCCTTTGCCTCTTTCAAT GAGGCACTTGCGTTGATGGT
 GAPDH ATGATTCTACCCACGGCAAG CTGGAAGATGGTGATGGGTT

[i] TNF-α, tumor necrosis factor-α; IL, interleukin; iNOS, inducible nitric oxide synthase; COX-2, cyclooxygenase-2; GAPDH, glyceraldehyde 3-phosphate dehydrogenase.

NO release assay

NO release was measured by detecting the concentration of nitrite produced, using the Griess reagent system (Promega Corporation, Madison, WI, USA). Briefly, nitrite standards were prepared, ranging between 100 and 1.56 µM (100, 50, 25, 12.5, 6.25, 3.13 and 1.56 µM) by serial 2-fold dilutions. The cell-free supernatants were obtained by centrifugation at 2,000 × g for 1 min at room temperature. The nitrite standards and cell-free supernatants from the infected and/or treated samples (50 µl) were added to a 96-well tissue culture plate in triplicate. Subsequently, 50 µl sulphanilamide solution was added to each well, and incubated for 10 min at room temperature in the dark, followed by the addition of 50 µl N-1-napthylethylenediamine dihydrochloride. The absorbance was measured at 540 nm using the Victor™ X3 multilabel reader.

Statistical analysis

Data are presented as the mean ± standard deviation. At least three individual experiments were performed. Statistical analyses were performed using SPSS 17.0 (SPSS, Inc., Chicago, IL, USA), Differences between groups were analyzed using one-way analysis of variance, followed by the Student's t-test. P<0.05 was considered to indicate a statistically significant difference.

Results

Effect of UA on cell viability

Prior to the experiments, it was necessary to evaluate the effect of UA on cell viability. Cell viability was determined using an MTT assay for the RAW 264.7 and A549 cells (Fig. 1A), and using an MTS assay for the rat splenocytes (Fig. 1B). Measurements over time established that significant cytotoxicity was evident, beginning at 24 h, in the two cell lines. At 72 h, 10 µg/ml UA resulted in cytotoxicity towards the RAW 264.7 cells, which was almost 11% higher than that in the A549 cells (Fig. 1A). By contrast, the splenocytes showed less cytotoxicity under similar treatment conditions between 24 and 72 h, compared with the RAW 264.7 and A549 cells. No significant difference in splenocyte viability was found at any time point, with the exception of 72 h (Fig. 1B), at which the cell viability was decreased by almost 35%, which was marginal, compared with the other two cell types at 72 h (Fig. 1B).

Figure 1

Effect of UA on cell viability using a 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide assay. (A) RAW 264.7 and A549 cells were treated with 10 µg/ml UA for 6–72 h and (B) rat splenocytes were treated with similar doses of UA for 24–72 h. Data are presented as the mean ± standard deviation of three independent experiments. *P<0.05, vs. control; UA, ursolic acid; c, control.

UA suppresses infection- and Con A-induced cytokine expression

Cytokines are critical in the development and regulation of immune responses. Several phytochemicals are involved in the immunomodulatory activities of the immune system and, thus, are key in immunosuppression. The expression levels of genes encoding TNF-α, IL-6 and IL1-β in different cells was evaluated following infection and/or treatment. The M. tuberculosis-infected RAW 264.7 cells showed a significant induction of the mRNA expression of TNF-α at 12 and 24 h (Fig. 2A). This induction was significantly reduced by treatment of the RAW 264.7 cells with UA. In the A549 cells, the induction of TNF-α by infection, and the reduction by UA were not significant (Fig. 2B). UA treatment alone reduced the mNRA levels of TNF-α in the RAW 264.7 cells at 12 h, however, the expression returned to a basal level at 24 h. In the A549 cells, UA did not induce significant changes at any time point (Fig. 2A and B). In the splenocytes, the Con A mitogen was used to investigate the immunoregulatory activity of UA. Con A increased the mRNA expression of TNF-α by ~2-fold at 12 h, which increased to 3-fold at 24 h. At both time points, UA significantly reduced the mRNA expression levels of TNF-α, compared with the control (Fig. 2C).

Figure 2

UA has an inhibitory effect on the expression of TNF-α. (A) RAW 264.7 cells and (B) A549 cells were infected with M. tuberculosis H37Rv (1:10) for 3 h and/or treated with 10 µg/ml UA for 6 h. (C) Rat splenocytes were co-treated with 5 µg/ml Con A and/or 10 µg/ml UA. Following 12 and 24 h treatment, the cells were harvested for total RNA collection, cDNA preparation and reverse transcription-quantitative polymerase chain reaction analysis. Data is presented as the mean ± standard deviation of three independent experiments. *P<0.05, vs. control; #P<0.05, inf+UA, vs. inf or Con A. TNF-α, tumor necrosis factor-α; c, control; inf, infection; UA, ursolic acid; Con A, concanavalin A.

IL-6 acts as pro-inflammatory, as well as an anti-inflammatory, cytokine. In the RAW 264.7 cells, infection induced the mRNA expression of IL-6 at 24 h, and was significantly reduced by UA treatment. Of note, the reduction was even lower than the basal level. Treatment with UA alone had no significant effect on the mRNA expression of IL-6 (Fig. 3A). In the A549 cells, infection and/or treatment showed no significant change at 12 h, however, at 24 h the mRNA expression of IL-6 increased almost 5-fold. UA significantly reduced this induced expression (Fig. 3B). No significant changes in the mRNA expression of IL-6 mRNA were observed in the Con A and/or UA-treated splenocytes at 12 h. However, at 24 h, the expression of IL-6 was significantly induced when treated with Con A, and UA successfully reduced this induced expression (Fig. 3C).

Figure 3

UA has an inhibitory effect on the expression of IL-6 in RAW 264.7 cells, A549 cells and rat splenocytes. (A) RAW 264.7 cells and (B) A549 cells were infected with M. tuberculosis H37Rv for 3 h and/or treated with 10 µg/ml UA for 6 h. (C) Rat splenocytes were treated with 5 µg/ml Con A and/or 10 µg/ml UA. Following 12 and 24 h of incubation, the cells were harvested for total RNA collection, cDNA preparation and reverse transcription-quantitative polymerase chain reaction analysis of IL-6 mRNA. Data is presented as the mean ± standard deviation of three independent experiment. *P<0.05, vs, control; #P<0.05, inf+UA, vs. inf or Con A. IL, interleukin; c, control; inf, infection; UA, ursolic acid; Con A, concanavalin A.

IL-1β is a pro-inflammatory cytokine, which was found to be significantly induced by M. tuberculosis H37Rv infection in RAW 264.7 cells (Fig. 4A) and A549 cells (Fig. 4B) at 12 and 24 h. Their induction was effectively reduced by UA treatment, however, in the RAW 264.7 cells, the reduction was below the basal level at 12 h, compared with the control (Fig. 4A and B). Compared with the RAW 264.7 and A549 cells, no significant changes were observed in the splenocytes treated with Con A and/or UA at 12 h. However, at 24 h, Con A induced the expression of IL-1β, whereas UA had no significant effect (Fig. 4C).

Figure 4

Effect of UA on the mRNA expression of IL-1β. (A) RAW 264.7 cells, (B) A549 cells were infected and/or treated with UA, and (C) rat splenocytes were infected and/or treated with Con A. Following indicated period of incubation, the cells were harvested for total RNA collection, cDNA preparation and reverse transcription-quantitative polymerase chain reaction analysis for IL-1β. Data is presented as the mean ± standard deviation of three independent experiments *P<0.05, vs. control; #P<0.05 vs. Inf or Con A. IL, interleukin; c, control; inf, infection; UA, ursolic acid; Con A, concanavalin A.

Infection- and Con A-induced expression of iNOS and COX-2 expression is regulated by UA

The iNOS and COX-2 genes are usually induced by inflammation. To evaluate the effect of UA on their expression levels, the present study infected RAW 264.7 cells with M. tuberculosis H37Rv and/or treated the cells with UA. Infection induced the expression of the two genes significantly at 12 and 24 h. These levels of expression were significantly suppressed by UA at both time points. The gene expression of iNOS and COX-2 were suppressed below the basal level at 24 h. No significant changes in the gene expression of iNOS or COX-2 were observed in the cells treated with UA only (Fig. 5A and B).

Figure 5

UA suppresses the expression of the iNOS and COX-2 inflammatory mediators. (A and B) RAW 264.7 cells were infected and/or treated with UA. (C and D) rat splenocytes were treated with con A and/or UA. Following incubation, the cells were harvested, total RNA was collected, cDNA was prepared and reverse transcription-quantitative polymerase chain reaction analysis was performed for iNOS and COX-2. Data is presented as the mean ± standard deviation of three independent experiments *P<0.05, vs. control; #P<0.05, vs. inf or Con A. iNOS, inducible nitric oxide synthase; COX-2, cyclooxygenase-2; c, control; inf, infection; UA, ursolic acid; Con A, concanavalin A.

The inflammatory response was induced in the splenocytes by treatment with the Con A mitogen. At 24 h, the expression of the iNOS gene was induced almost 5-fold, compared with the control, however, UA suppressed the expression by ~2-fold. No significant changes in the expression of iNOS were evident at 12 h in the samples treated with Con A and/or UA (Fig. 5C). However, at 12 and 24 h, the expression of COX-2 was induced significantly by Con A treatment. UA treatment reduced this induced expression significantly at 24 h, but not at 12 h (Fig. 5D). Treatment of the splenocytes with UA alone did not significantly alter the gene expression levels of iNOS or COX-2 from the basal level (Fig. 5C and D).

UA suppresses NO release in RAW 264.7 and A549 cells

NO is a signaling molecule, which is important in modulating the release of various inflammatory mediators from a wide range of cells (25). Infection of RAW 264.7 (Fig. 6A) and A549 (Fig. 6B) cells with M. tuberculosis H37Rv produced a significant release of NO into the culture medium at 24 and 48 h, respectively. The alveolar epithelial A549 cells did not appear to release NO prior to 48 h. In addition, treatment with UA or the NO synthase inhibitor significantly reduced the release of NO in the two cell types at these time points. Of note, UA and the NO synthase inhibitor also induced NO release in the two cell type, although without statistical significance (Fig. 6A and B).

Figure 6

UA inhibits NO release. M. tuberculosis H37Rv infected (A) RAW 264.7 cells and (B) A549 (B) cells were treated with UA or L-NMMA for 6 h, or left untreated, and incubated for 24 and 48 h, respectively. Data is presented as the mean ± standard deviation of three independent experiments. *P<0.05, vs. control; #P<0.05, vs. inf. NO, nitric oxide; L-NMMA, NG-monomethyl-L-arginine; c, control; inf, infection; UA, ursolic acid; Con A, concanavalin A.

Discussion

Inflammation is a healing process in the body, however, when it is prolonged, various diseases can result (26). Immunomodulatory therapy of TB reduces excessive inflammation and restricts pathology. Pro- and anti-inflammatory drugs may have significant potential in tailoring TB treatment, when administered with routine anti-TB drugs (27–29). In the present study, M. tuberculosis H37Rv was selected to infect mouse monocyte macrophages, RAW 264.7 and A549 type II alveolar cells. In the majority of previous studies, alveolar macrophages were considered for TB-associated studies. Alveolar epithelial cells are now also considered to be involved in pathogenesis and in the innate immune response (30,31). Natural compounds are a valuable source for a wide array of prospective biomedical uses, due to their limited side effects. UA shows anti-inflammatory potential in RAW 264.7 cells by attenuating the expression of iNOS and COX-2 (32,33). The anti-inflammatory potential of UA has also been reported in activated T cells, B cells and macrophages (34). The mechanism underlying these effects has been attributed to the inhibition of mitogen-induced phosphorylation of extracellular signal-regulated kinase and c-Jun, N-terminal kinase, and the suppression of immunoregulatory transcription factors, NF-κB and nuclear factor of activated T cells and activator protein-1. Notably, UA mitigates lipopoly-saccharide-induced expression of TNF-α, IL-1β and IL-6 in splenic adherent macrophages (34). In the present study, UA was investigated for its potential anti-inflammatory activity in differentially stimulated cells. A comparative investigation was performed to determine the gene expression levels of the TNF-α, IL-1β and IL-6 cytokines, the iNOS and COX-2 inflammatory mediators, and the important signal transducer, NO. As a model, M. tuberculosis H37Rv was used to sensitize RAW 264.7 cells and A549 cells, and Con A-stimulated rat splenocytes.

The present study focused on the expression of COX-2 and iNOS, as they are usually induced during inflammatory conditions, and are reduced by the effect of flavonoids (35,36). Abnormal upregulation of COX-2 and/or iNOS may be associated with certain types of cancer or inflammatory disorders (37,38). In the present study, infection by M. tuberculosis H37Rv or treatment with Con A significantly increased the mRNA levels of COX-2 and/or iNOS, which were downregulated by UA. NO, the product of iNOS, is crucial during inflammation. In addition to downregulating the expression levels of COX-2 and iNOS, UA decreased the release of NO, which was induced following mycobacterial infection, in the cell culture medium. The infected A549 cells exhibited delayed NO release, compared with the RAW 264.7 cells. It has been reported that mycobacterial antigenic components produce significantly higher levels of NO at 48 h in A549 cells (39).

To detect anti-inflammatory activity, the present study examined the ability of UA to reduce the production of TNF-α in the mycobacteria-infected RAW 267.4 and A549 cells, and Con A-stimulated rat splenocytes. TNF-α is pivotal in inflammation, and its effect on the reduction of IL-1β and IL-6 were examined in similar treatment conditions. All three cytokines were upregulated when stimulated by M. tuberculosis H37Rv in the RAW 267.4 cells, A549 cells and Con A-stimulated rat splenocytes. The three cytokines were induced by different stimuli in different cells, however, UA significantly reduced their expression levels at the transcriptional level in the present study. Upon stimulation, the expression levels of various cytokines, inflammatory mediators, including iNOS and COX-2, and NO release were induced at varying magnitudes and at different times.

UA induced marked inhibitory effects on the expression levels of cytokines and immunomodulatory mediators, and on NO release. These findings, and the results of previous reports suggest that UA has significant potential in mitigating the induced inflammatory response. Further detailed investigations of UA are required, to determine its potential as a functional remedy to control inflammation in various diseases.

Acknowledgments

This study was supported by a Grant from the Ministry of Health & Welfare R&D Project, Republic of Korea (grant no. HI13C0828).

References

1 

Coussens LM and Werb Z: Inflammation and cancer. Nature. 420:860–867. 2002. View Article : Google Scholar : PubMed/NCBI

2 

Checker R, Sandur SK, Sharma D, Patwardhan RS, Jayakumar S, Kohli V, Sethi G, Aggarwal BB and Sainis KB: Potent anti-inflammatory activity of ursolic acid, a triterpenoid antioxidant, is mediated through suppression of NF-kB, AP-1 and NF-AT. PLoS One. 7:e313182012. View Article : Google Scholar

3 

Dalgleish AG and O'Byrne KJ: Chronic immune activation and inflammation in the pathogenesis of AIDS and cancer. Adv Cancer Res. 84:231–276. 2002. View Article : Google Scholar : PubMed/NCBI

4 

Kaser A, Zeissig S and Blumberg RS: Inflammatory bowel disease. Annu Rev Immunol. 28:573–621. 2010. View Article : Google Scholar : PubMed/NCBI

5 

Ishiguro Y: Mucosal proinflammatory cytokine production correlates with endoscopic activity of ulcerative colitis. J Gastroenterol. 34:66–74. 1999. View Article : Google Scholar : PubMed/NCBI

6 

Scott DL, Wolfe F and Huizinga TW: Rheumatoid arthritis. Lancet. 376:1094–1108. 2010. View Article : Google Scholar : PubMed/NCBI

7 

Lee YJ, Han SB, Nam SY, Oh KW and Hong JT: Inflammation and alzheimer's disease. Arch Pharm Res. 33:1539–1556. 2010. View Article : Google Scholar : PubMed/NCBI

8 

Achoui M, Appleton D, Abdulla MA, Awang K, Mohd MA and Mustafa MR: In vitro and in vivo anti-inflammatory activity of 17-O acetylacuminolide through the inhibition of cytokines, NF-kB translocation and IKKβ activity. PLoS One. 5:e151052010. View Article : Google Scholar

9 

Zumla A, Rao M, Parida SK, Keshavjee S, Cassell G, Wallis R, Axelsson-Robertsson R, Doherty M, ersson J and Maeurer M: Inflammation and tuberculosis: Host-directed therapies. J Intern Med. 277:373–387. 2014. View Article : Google Scholar : PubMed/NCBI

10 

Ellner JJ: Review: The immune response in tuberculosis implication for tuberculosis control. J Infect Dis. 176:1351–1359. 1997. View Article : Google Scholar : PubMed/NCBI

11 

Fenton MJ and Vermeulen MW: Immunopathology of tuberculosis: Roles of macrophages and monocytes. Infect Immun. 64:683–690. 1996.PubMed/NCBI

12 

Rich EA, Torres M, Sada E, Finegan CK, Hamilton BD and Toossi Z: Mycobacterium tuberculosis (MTB)-stimulated production of nitric oxide by human alveolar macrophages and relationship of nitric oxide production to growth inhibition of MTB. Tubercle Lung Dis. 78:247–255. 1997. View Article : Google Scholar

13 

Roy S, Sharma S, Sharma M, Aggarwal R and Bose M: Induction of nitric oxide release from the human alveolar epithelial cell line A549: An in vitro correlate of innate immune response to mycobacterium tuberculosis. Immunology. 112:471–480. 2004. View Article : Google Scholar : PubMed/NCBI

14 

Celada A and Nathan C: Macrophage activation revisited. Immunol Today. 15:100–102. 1994. View Article : Google Scholar : PubMed/NCBI

15 

Nathan CF and Hibbs JB Jr: Role of nitric oxide synthesis in macrophage antimicrobial activity. Curr Opin Immunol. 3:65–70. 1991. View Article : Google Scholar : PubMed/NCBI

16 

Liu J: Pharmacology of oleanolic acid and ursolic acid. J Ethnopharmacol. 49:57–68. 1995. View Article : Google Scholar : PubMed/NCBI

17 

Ikeda Y, Murakami A and Ohigashi H: Ursolic acid: An anti- and proinflammatory triterpenoid. Mol Nutr Food Res. 52:26–42. 2008. View Article : Google Scholar : PubMed/NCBI

18 

Tsai SJ and Yin MC: Antioxidative and anti-inflammatory protection of oleanolic acid and ursolic acid in PC12 cells. J Food Sci. 73:H174–H178. 2008. View Article : Google Scholar : PubMed/NCBI

19 

Shishodia S, Majumdar S, Banerjee S and Aggarwal BB: Ursolic acid inhibits nuclear factor-kappaB activation induced by carcinogenic agents through suppression of IkappaBalpha kinase and p65 phosphorylation: Correlation with down-regulation of cyclooxygenase 2, matrix metalloproteinase 9 and cyclin D1. Cancer Res. 63:4375–4383. 2003.PubMed/NCBI

20 

Martin A, Camacho M, Portaels F and Palomino JC: Resazurin microtiter assay plate testing of mycobacterium tuberculosis susceptibilities to second-line drugs: Rapid, simple and inexpensive method. Antimicrob Agents Chemother. 47:3616–3619. 2003. View Article : Google Scholar : PubMed/NCBI

21 

Diacon AH, Maritz JS, Venter A, van Helden PD, Andries K, McNeeley DF and Donald PR: Time to detection of the growth of mycobacterium tuberculosis in MGIT 960 for determining the early bactericidal activity of antituberculosis agents. Eur J Clin Microbiol Infect Dis. 29:1561–1565. 2010. View Article : Google Scholar : PubMed/NCBI

22 

Zerin T, Lee M, Jang WS, Nam KW and Song HY: Ursolic acid reduces Mycobacterium tuberculosis-induced nitric oxide release in human alveolar A549 cells. Mol Cells. 38:610–615. 2015. View Article : Google Scholar : PubMed/NCBI

23 

Zerin T, Kim YS, Hong SY and Song HY: Protective effect of methylprednisolone on paraquat-induced A549 cell cytotoxicity via induction of efflux transporter, P-glycoprotein expression. Toxicol Lett. 208:101–107. 2012. View Article : Google Scholar

24 

Lee HJ, Zerin T, Kim YH, Lee BE and Song HY: Immunomodulation potential of Artemisia capillaris extract in rat splenocytes. Intern J Phytomed. 5:356–361. 2013.

25 

Wallace JL: Nitric oxide as a regulator of inflammatory processes. Mem Inst Oswaldo Cruz. 100(Suppl 1): S5–S9. 2005. View Article : Google Scholar

26 

Medzhitov R: Origin and physiological roles of inflammation. Nature. 454:428–435. 2008. View Article : Google Scholar : PubMed/NCBI

27 

Subbian S, Tsenova L, O'Brien P, Yang G, Koo MS, Peixoto B, Fallows D, Dartois V, Muller G and Kaplan G: Phosphodiesterase-4 inhibition alters gene expression and improves isoniazid-mediated clearance of mycobacterium tuberculosis in rabbit lungs. PLoS Pathog. 7:e10022622011. View Article : Google Scholar : PubMed/NCBI

28 

Tobin DM, Roca FJ, Oh SF, McFarland R, Vickery TW, Ray JP, Ko DC, Zou Y, Bang ND, Chau TT, et al: Host genotype-specific therapies can optimize the inflammatory response to mycobacterial infections. Cell. 148:434–446. 2012. View Article : Google Scholar : PubMed/NCBI

29 

Skerry C, Harper J, Klunk M, Bishai WR and Jain SK: Adjunctive TNF inhibition with standard treatment enhances bacterial clearance in a murine model of necrotic TB granulomas. PLoS One. 7:e396802012. View Article : Google Scholar : PubMed/NCBI

30 

Bermudez LE and Goodman J: Mycobacterium tuberculosis invades and replicates within type II alveolar cells. Infect Immun. 64:1400–1406. 1996.PubMed/NCBI

31 

Garcia-Perez BE, Mondragon-Flores R and Luna-Herrera J: Internalization of mycobacterium tuberculosis by macropinocytosis in non-phagocytic cells. Microb Pathog. 35:49–55. 2003. View Article : Google Scholar : PubMed/NCBI

32 

Suh N, Honda T, Finlay HJ, Barchowsky A, Williams C, Benoit NE, Xie QW, Nathan C, Gribble GW and Sporn MB: Novel triterpenoids suppress inducible nitric oxide synthase (iNOS) and inducible cyclooxygenase (COX-2) in mouse macrophages. Cancer Res. 58:717–723. 1998.PubMed/NCBI

33 

Ryu SY, Oak MH, Yoon SK, Cho DI, Yoo GS, Kim TS and Kim KM: Anti-allergic and anti-inflammatory triterpenes from the herb of Prunella vulgaris. Planta Med. 66:358–360. 2000. View Article : Google Scholar : PubMed/NCBI

34 

Checker R, Sandur SK, Sharma D, Patwardhan RS, Jayakumar S, Kohli V, Sethi G, Aggarwal BB and Sainis KB: Potent anti-inflammatory activity of ursolic acid, a triterpenoid antioxidant, is mediated through suppression of NF-κB, AP-1 and NF-AT. PLoS One. 7:e313182012. View Article : Google Scholar

35 

Moita E, Gil-Izquierdo A, Sousa C, Ferreres F, Silva LR, Valentão P, Domínguez-Perles R, Baenas N and Andrade PB: Integrated analysis of COX-2 and iNOS derived inflammatory mediators in LPS-stimulated RAW macrophages pre-exposed to Echium plantagineum L. bee pollen extract. PLoS One. 8:e591312013. View Article : Google Scholar : PubMed/NCBI

36 

Kim JB, Han AR, Park EY, Kim JY, Cho W, Lee J, Seo EK and Lee KT: Inhibition of LPS-induced iNOS, COX-2 and cytokines expression by poncirin through the NF-kappaB inactivation in RAW 264.7 macrophage cells. Biol Pharm Bull. 30:2345–2351. 2007. View Article : Google Scholar : PubMed/NCBI

37 

Weinberg JB: Nitric oxide synthase 2 and cyclooxygenase 2 interactions in inflammation. Immunol Res. 22:319–341. 2000. View Article : Google Scholar

38 

Camuesco D, Comalada M, Rodríguez-Cabezas ME, Nieto A, Lorente MD, Concha A, Zarzuelo A and Gálvez J: The intestinal anti-inflammatory effect of quercitrin is associated with an inhibition in iNOS expression. Br J Pharmacol. 143:908–918. 2004. View Article : Google Scholar : PubMed/NCBI

39 

Roy S, Sharma S, Sharma M, Aggarwal R and Bose M: Induction of nitric oxide release from the human alveolar epithelial cell line A549: An in vitro correlate of innate immune response to mycobacterium tuberculosis. Immunology. 112:471–480. 2004. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Zerin T, Lee M, Jang WS, Nam KW and Song HY: Anti-inflammatory potential of ursolic acid in Mycobacterium tuberculosis-sensitized and Concanavalin A-stimulated cells. Mol Med Rep 13: 2736-2744, 2016.
APA
Zerin, T., Lee, M., Jang, W.S., Nam, K., & Song, H. (2016). Anti-inflammatory potential of ursolic acid in Mycobacterium tuberculosis-sensitized and Concanavalin A-stimulated cells. Molecular Medicine Reports, 13, 2736-2744. https://doi.org/10.3892/mmr.2016.4840
MLA
Zerin, T., Lee, M., Jang, W. S., Nam, K., Song, H."Anti-inflammatory potential of ursolic acid in Mycobacterium tuberculosis-sensitized and Concanavalin A-stimulated cells". Molecular Medicine Reports 13.3 (2016): 2736-2744.
Chicago
Zerin, T., Lee, M., Jang, W. S., Nam, K., Song, H."Anti-inflammatory potential of ursolic acid in Mycobacterium tuberculosis-sensitized and Concanavalin A-stimulated cells". Molecular Medicine Reports 13, no. 3 (2016): 2736-2744. https://doi.org/10.3892/mmr.2016.4840
Copy and paste a formatted citation
x
Spandidos Publications style
Zerin T, Lee M, Jang WS, Nam KW and Song HY: Anti-inflammatory potential of ursolic acid in Mycobacterium tuberculosis-sensitized and Concanavalin A-stimulated cells. Mol Med Rep 13: 2736-2744, 2016.
APA
Zerin, T., Lee, M., Jang, W.S., Nam, K., & Song, H. (2016). Anti-inflammatory potential of ursolic acid in Mycobacterium tuberculosis-sensitized and Concanavalin A-stimulated cells. Molecular Medicine Reports, 13, 2736-2744. https://doi.org/10.3892/mmr.2016.4840
MLA
Zerin, T., Lee, M., Jang, W. S., Nam, K., Song, H."Anti-inflammatory potential of ursolic acid in Mycobacterium tuberculosis-sensitized and Concanavalin A-stimulated cells". Molecular Medicine Reports 13.3 (2016): 2736-2744.
Chicago
Zerin, T., Lee, M., Jang, W. S., Nam, K., Song, H."Anti-inflammatory potential of ursolic acid in Mycobacterium tuberculosis-sensitized and Concanavalin A-stimulated cells". Molecular Medicine Reports 13, no. 3 (2016): 2736-2744. https://doi.org/10.3892/mmr.2016.4840
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team