Open Access

Renoprotective effect of curcumin against the combined oxidative stress of diabetes and nicotine in rats

  • Authors:
    • Zein Shaban Ibrahim
    • Mohamed Elsayed Alkafafy
    • Mohamed Mohamed Ahmed
    • Mohamed Mohamed Soliman
  • View Affiliations

  • Published online on: February 22, 2016     https://doi.org/10.3892/mmr.2016.4922
  • Pages: 3017-3026
  • Copyright: © Ibrahim et al. This is an open access article distributed under the terms of Creative Commons Attribution License.

Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )


Abstract

The progression of diabetic nephropathy (DN) is accelerated by smoking. The current study investigated the ability of curcumin to protect the kidneys against damage from oxidative stress induced by diabetes mellitus (DM) and nicotine (NC). A total of 24 male Wistar rats were divided into four groups of six rats each. DM was induced by a single intraperitoneal injection of streptozotocin 60 mg/kg body weight. DM rats were treated with or without NC in the absence or presence of curcumin for 8 weeks. As compared with the controls, DM rats exhibited reduced serum levels of high density lipoprotein, superoxide dismutase and glutathione peroxidase, and decreased renal mRNA expression levels of synaptopodin, connexin 43 and erythropoietin (EPO), which were further suppressed by NC and restored to normal levels by curcumin treatment. Additionally, DM rats exhibited increases in their lipid profiles (cholesterol, triacylglycerol and phospholipids), oxidative markers (malondialdehyde, γ‑glutamyltranspeptidase and nitric oxide), kidney function markers (urea and creatinine) and the mRNA expression levels of vimentin, desmin, SREBP‑1, iNOS and TGF‑β1. These effects were further enhanced by NC, but counteracted by curcumin treatment. Kidneys from DM rats displayed glomerular hypertrophy, sclerosis and tubulo‑interstitial changes represented by tubular lipid deposition, interstitial mononuclear cell infiltration and fibroplasia. Pancreatic islets exhibited cellular vacuolation, morphological irregularity and damaged or reduced in size β‑cells. These renal and pancreatic changes became more severe following NC treatment and were ameliorated by curcumin. Therefore, NC‑induced DN progression may predominantly operate by increasing oxidative stress, reducing the levels of antioxidants, suppressing EPO levels, and causing perturbations to gap junction and podocyte structure. Curcumin may ameliorate the damaging effects of DM and NC on the kidney through normalization of the mRNA expression levels of several genes important in the progression of DN.

Introduction

Diabetic nephropathy (DN) is a common complication of diabetes mellitus (DM), which is a major health problem worldwide (1). Chronic inflammation and oxidative stress are crucial contributors to the progression of DN (2). Various preventable factors, including hypertension, alcoholism and smoking, also accelerate DN progression. Epidemiological studies suggest that cigarette smoking increases the progression rate of renal failure among insulin-and non-insulin-dependent patients with DM (3), and is associated with elevated serum creatinine levels (4). A dose-dependent relationship between the number of cigarettes smoked and the development of albuminuria was reported in type 1 DM (5). Additionally, the prevalence of microalbuminuria and macroalbuminuria was significantly higher in patients with type 2 DM that were smokers. A possible role of smoking in the acceleration of renal remodeling and damage was postulated to operate via a mechanism independent of the damage caused by DM (6). Evidence from the European population indicates that smoking may be associated with the progression of chronic kidney disease (CKD), particularly in men (7).

Previous studies have focused on anti-inflammatory and anti-oxidative treatments as a method to delay the progression of glomerulopathy (2,8). Curcumin, derived from the rhizome of the herb Curcuma longa, has been indicated to possess a variety of beneficial effects, including anti-inflammatory and anti-oxidative activities (9). Curcumin has been demonstrated to be protective against nephropathy and islet damage in streptozotocin (STZ)-induced diabetic rats (10,11). Curcumin was previously reported to be effective in preventing glucose-induced oxidative stress in the endothelial cells and hearts of diabetic animals (12).

The current study aimed to investigate the potential protective effects of curcumin against the combined oxidative stress of DM and nicotine (NC), a major component of cigarette smoke.

Materials and methods

Animals

A total of 24 adult male Wistar rats (65–70 days old, 190–220 g) were purchased from the Experimental Animal Center, Faculty of Pharmacy, King Saud University (Riyadh, Saudi Arabia). Animals were housed in the animal facility of the College of Science, Taif University (Taif, Saudi Arabia) at 22°C and 55% humidity with a 12 h light/dark cycle. The rats were fed a standard pellet diet and provided with water ad libitum. The present study was approved by the ethical committee of Taif University.

Reformation of animal food with the addition of curcumin

As curcumin is water insoluble, it was added to the food of the animals at a concentration of 1.5 g/kg of food. The food pellet was crushed to a powder and mixed thoroughly with curcumin powder (Nature's Purest, West Los Angeles, CA, USA). A small volume of water was added to create a paste and the pellets were reformed. The pellets were left to air dry for 4 days. The concentration of curcumin was selected based on the average body weight of the rats (~200 g) and the estimated average daily feed consumption (~25–30 g/day). The NC (Merck Millipore, Darmstadt, Germany) concentration was also selected according to the average body weight and the average daily water consumption (~25 ml/day).

Experimental design

Following 1-week acclimatization, the rats were divided into 2 groups as follows: 18 rats were fasted for 8 hrs, after which they were injected intraperitonealy with a single dose of streptozotocin (STZ; 60 mg/kg body weight; Sigma-Aldrich, St. Louis, MO, USA) freshly dissolved in citrate buffer (pH 4.5); and a negative control group (6 rats) were injected with an equivalent volume of vehicle (citrate buffer, pH 4.5). Following injection, the rats were provided with free access to food and water, and were given a 5% glucose solution to drink overnight to counteract hypoglycemic shock. DM in the rats was identified by moderate polydipsia and marked polyuria. After 3 days, the fasting blood glucose levels were measured in tail blood samples (Accu-Chek Aviva Blood Glucose Meter; Roche Diagnostics, Indianapolis, IN, USA). The rats with glucose levels >200 mg/100 ml were considered to be diabetic and selected for further experimentation. The diabetic rats were divided into three groups of six rats each as follows: i) The DM group; ii) the DM + NC group; and iii) the DM + NC + curcumin group. NC was added to the drinking water of the DM + NC and the DM + NC + curcumin group rats at a concentration of 12 µg/ml to attain a treatment dose of 1.5 mg/kg body weight. The food of the DM + NC + curcumin group rats was additionally supplemented with curcumin at a concentration of 1.5 g/kg body weight to obtain a final concentration of 1.5 mg/kg body weight. Treatments were continued for the 8 weeks following induction of DM. Random blood glucose levels were measured from tail blood samples every week to ensure the rats remained diabetic. At the end of the experiment, the rats were fasted for 8 h and anesthetized with diethyl ether (≥99.0%; Sigma-Aldrich), while blood samples were taken from the medial canthus of the eyes into heparinized tubes. The rats were sacrificed by head dislocation and tissue samples were taken for RNA extraction and stored at −80°C prior to use. Samples for histological examination were stored in 10% formalin (Sigma-Aldrich) until processing.

Biochemical analysis

Urea and plasma creatinine assays were performed using the UREA liquicolor (cat. no. 10505) and CREATININE liquicolor (cat. no. 10051) Complete Test kits purchased from HUMAN Gesellschaft für Biochemica und Diagnostica mbH (Wiesbaden, Germany). Cholesterol, triacylglycerol (TG) and high density lipoprotein (HDL) levels were measured using kits (cat. nos. 024-100, 059L-050 and 041-050, respectively) purchased from United Diagnostics Industry (Dammam, Saudi Arabia). Commercial kits were purchased from Nanjing Jiancheng Bioengineering Research Institute (Nanjing, China) to measure the levels of plasma malondialdehyde (MDA; A003-1), and the activities of γ-glutamyltranspeptidase (GGT), superoxide dismutase (SOD; A001-1) and glutathione peroxidase (GPx; A005). The plasma phospholipid levels were determined using the Phospholipid Assay kit (MAK122; Sigma-Aldrich), according to the manufacturer's protocol. The concentrations of the measured biochemical constituents were calculated according to the manufacturer's instructions.

RNA extraction

For preparation of total RNA, 50 mg of kidney tissue sample was homogenized in 1 ml QIAzol (Qiagen, Inc., Valencia, CA, USA) and 0.3 ml chloroform (Nanjing Jiancheng Bioengineering Research Institute) was added to the homogenate. The mixtures were then shaken for 30 sec followed by centrifugation at 4°C and 12,000 × g for 20 min. The supernatant layers were transferred to a new set of tubes, and an equal volume of isopropanol (Sigma-Aldrich) was added to the samples. The samples were shaken for 15 sec and centrifuged at 4°C and 12,000 x g for 15 min. The RNA pellets were washed with 70% ethanol, briefly dried and dissolved in diethylpyrocarbonate (DEPC) water. The prepared RNA integrity was determined by 1.5% agarose gel electrophoresis. The RNA concentration and purity were determined spectrophotometrically at 260 nm using the GelDoc-It Imaging System (UVP, Inc., Upland, CA, USA). The ratio of the 260/280 nm optical density of all RNA samples was 1.7–1.9.

cDNA synthesis

DNase treatment of the extracted RNA was performed prior to cDNA synthesis using the RQ1 RNase-Free DNase kit (M6101; Promega Corporation, Madison, WI, USA). For synthesis of cDNA, a mixture of 2 µg total RNA and 0.5 ng Oligo (dT)15 primers (Macrogen, Inc., Seoul, Korea) in a total volume of 11 µl sterilized DEPC water was incubated in the Thermo Hybaid PXE 0.2 Thermal Cycler (Thermo Fisher Scientific, Inc., Waltham, MA, USA) at 70°C for 10 min for denaturing. Subsequently, 4 µl 5X RT-buffer, 2 µl 10 mM dNTPs and 100 units RevertAid Premium reverse transcriptase (Fermentas; Thermo Fisher Scientific, Inc., Pittsburgh, PA, USA) were added to the reaction mixture and DEPC water was used to bring the total volume to 20 µl. The mixture was then incubated in the thermal cycler at 30°C for 10 min, 42°C for 1 h and 90°C for 10 min. The resulting cDNA was then preserved at −20°C until use.

Semi-quantitative polymerase chain reaction (PCR)

The mRNA expression levels of gene markers of kidney damage, kidney protection and integrity, and inflammation and fibrosis were analyzed by semi-quantitative PCR using the corresponding gene-specific primers (Table I). The genes analyzed were vimentin, desmin, synaptopodin (SPD), connexin 43 (Cx43), sterol regulatory element-binding protein-1c (SREBP-1c), transforming growth factor β1 (TGF-β1) and erythropoietin (EPO). As a reference gene, the expression of GAPDH mRNA was determined. The primers were designed using the Oligo Primer Analysis software, version 4 (www.oligo.net) and nucleotide sequences published in Genbank (www.ncbi.nlm.nih.gov/genbank; Table I). The primers were synthesized by Macrogen, Inc. PCR was conducted in a final reaction volume of 25 µl consisting of 1 µl cDNA, 1 µl of each 10 pM forward and reverse primers, 12.5 µl PCR master mix (Promega Corporation) and nuclease-free deionized water. PCR was conducted using the thermal cycler with a cycle sequence of denaturing at 94°C for 4 min for 1 cycle, followed by 25–32 cycles of denaturation at 94°C for 1 min, annealing at the specific temperature corresponding to each primer (see Table I) and extension at 72°C for 1 min, with an additional final extension step at 72°C for 5 min. A pilot study was performed to optimize the specific number of cycles for each gene according to its expression level. The PCR products were electrophoresed on a 1% agarose A (Bio Basic Canada, Inc., Markham, ON, Canada) gel in Tris-EDTA buffer at 100 V for 30 min, and stained with ethidium bromide. The PCR products were visualized under UV light and images were captured using the GelDoc-It Imaging System. The intensities of the bands were densitometrically quantified using NIH Image software (National Institutes of Health, Bethesda, MD, USA; rsb.info.nih.gov/nih-image).

Table I

Primers and polymerase chain reaction conditions used for the tested genes.

Table I

Primers and polymerase chain reaction conditions used for the tested genes.

GeneProduct size (bp)Annealing temperature (°C)CyclesPrimerSequence (5′-3′)
GAPDH3095225Sense AGATCCACAACGGATACATT
Antisense TCCCTCAAGATTGTCAGCAA
Vimentin1905530Sense GAGTCAAACGAATACCGGAGAC
Antisense GTGGTGCTGAGAAGTCTCATTG
Desmin4205428Sense TCACAATCACCTCTTTGTGGTC
Antisense CAGCACCTTCCAGTTCTCTCTT
Synaptopodin4575932Sense ACGCCCACTAAGGTGTATAGTGA
Antisense CTTCCAAAATTCCTGTCTTGTTG
Connexin 434355930Sense TACTTGGCCCATGTGTTCTATG
Antisense AACGCCTTTGAAGAAGACGTAG
SREBP-1c1915828Sense GGAGCCATGGATTGCACATT
Antisense AGGAAGGCTTCCAGAGAGGA
TGF-β13045830Sense TGAGTGGCTGTCTTTTGACG
Antisense TGGTTGTAGAGGGCAAGGAC
Erythropoietin5306029Sense TACGTAGCCTCACTTCACTGCTT
Antisense GCAGAAAGTATCCGCTGTGAGTGTTC
iNOS3785932Sense GGTGTTCTTTGCTTCTGTGCTA
Antisense TGAGACAGTTTCTGGTCGATGT

[i] SREBP-1c, sterol regulatory element binding protein 1; TGF-β1, transforming growth factor β1; iNOS, inducible nitric oxide synthase.

Histological examination

Small specimens (1.5×0.5 cm) from the pancreas and kidneys were fixed in 10% neutral-buffered formalin (Sigma-Aldrich) for 24 h, then washed under a running tap and preserved in 70% ethanol. The samples were dehydrated in ascending grades of ethanol, cleared in xylene (Sigma-Aldrich), embedded in Paraplast Plus (Sigma-Aldrich) and sectioned to 5 µm thickness. Tissue sections were mounted onto positively charged, coated slides (Thermo Fisher Scientific, Inc.). Sections were stained with hematoxylin and eosin (Sigma-Aldrich) for studying the general histological analyses (13).

Immunohistochemistry

For immunohistochemical detection of insulin granules, paraffin-embedded sections of the pancreas were deparaffinized in xylene, rehydrated in descending grades of alcohol and then immersed in 0.3% hydrogen peroxide (Sigma-Aldrich) for 30 min to inactivate endogenous peroxidase activity. The samples were heated in 10 mM citrate buffer (Sigma-Aldrich) at 121°C for 30 min for antigen retrieval, blocked in 5% normal serum (Sigma-Aldrich) for 20 min, and incubated with a rabbit polyclonal anti-insulin [dilution, 1:100 in phosphate-buffered saline (PBS); sc-9168; Santa Cruz Biotechnology Inc., Dallas, TX, USA] antibody overnight at 4°C. Subsequently, three PBS washes were performed and the sections were incubated with a goat anti-rabbit biotin-conjugated secondary antibody (dilution, 1:2,000 in PBS; sc-2040; Santa Cruz Biotechnology, Inc.) for 20 min at room temperature. After further incubation with horseradish peroxidase-labeled streptavidin (Vector Laboratories, Inc., Burlingame, CA, USA), the antibody binding was visualized with diaminobenzidine (Sigma-Aldrich) and sections were counterstained with hematoxylin. Negative controls, in which the primary or secondary antibodies, or the avidin-biotin complex reagent was omitted, produced no positive staining. Positive controls were used according to the instructions provided by the manufacturer's of the primary antibodies.

Photomicrography

Photomicrographs were captured using a Leica DM LB light microscope (Leica Microsystems, Inc., Buffalo Grove, IL, USA) and a Leica EC3 digital camera (Leica Microsystems, Inc.).

Statistic analysis

Statistical analysis was performed using analysis of variance and Scheffe's protected least-significant difference test on SPSS software, version 13.0 (SPSS, Inc., Chicago, IL, USA). P<0.05 was considered to indicate a statistically significant difference. Results are expressed as the mean ± standard error.

Results

Effect of curcumin on the plasma levels of biochemical parameters in diabetic rats

In the present study, plasma levels of the anti-oxidant enzymes, SOD and GPx, were significantly decreased in diabetic rats compared with controls (Table II), which may be caused by oxidative stress generated by the development of DM. Further reduction of these anti-oxidant enzyme levels was observed in diabetic rats treated with NC, however, the levels were increased to a level similar to that of the control by curcumin supplementation (Table II). The plasma concentrations of the oxidative markers, MDA and γ-glutamyltranspeptidase (GGT), and the lipid profile, including cholesterol, TG and phospholipids, were increased in diabetic rats compared with control rats. This increase was enhanced by NC treatment. Curcumin supplementation reversed these effects of DM and NC. The diabetic nephropathy markers, urea and creatinine, were increased in rats of the diabetic group compared with levels in the control group. These were further enhanced in the DM + NC group, while almost normalized with curcumin supplementation.

Table II

Serum biochemical analysis.

Table II

Serum biochemical analysis.

ParameterControlDMDM + NCDM + NC + Cr
Glucose (mg/dl)101.00±0.70 479.30±50.00a 416.00±49.50a 483.30±47.10a
Superoxide dismutase (U/ml)11.67±0.167.94±0.17a5.80±2.00a,b10.73±0.30c
Glutathione peroxidase (U/ml)115.67±3.8085.67±3.30a69.00±0.71a,b105.30±9.40c
Malondialdehyde (nmol/ml)3.00±0.804.40±2.108.74±1.20b3.63±0.16c
γ-Glutamyltranspeptidase (U/l)4.91±0.507.53±0.41a10.50±0.71a,b6.10±1.10c
Cholesterol (mg/dl)72.30±2.5995.30±0.47a114.00±0.71a,b79.70±0.94c
Triacylglycerol (mg/dl)52.30±8.0063.30±12.5081.70±4.50a,b61.70±14.00c
High density lipoprotein (mg/dl)18.70±1.2015.30±0.50a11.30±1.20a,b21.00±1.01c
Phospholipid (mg/dl)91.00±2.8094.70±3.80122.30±4.00a,b92.70±12.90c
Urea (mg/dl)68.30±9.3395.00±4.95a 138.00±24.75a,b85.33±21.50b
Creatinine (mg/dl)1.09±0.072.30±0.061a2.88±0.18a,b1.60±0.23c
Nitric oxide (µmol/l)22.70±1.7062.00±4.70a39.00±0.70b28.70±0.30c

{ label (or @symbol) needed for fn[@id='tfn2-mmr-13-04-3017'] } Values are presented as the mean ± standard error (n=8).

a P<0.05 vs. the control group;

b P<0.05 vs. the DM group;

c P<0.05 vs. the DM + NC group. DM, diabetes mellitus; NC, nicotine; Cr, curcumin.

Effect of curcumin on the mRNA expression of gene markers of kidney damage

Diabetic rats demonstrated upregulation of vimentin and desmin mRNA expression levels compared with control rats (P<0.05; Fig. 1). Treatment of diabetic rats with NC decreased the expression levels of these genes compared with untreated diabetic rats (P<0.05), however, the expression remained increased compared with the control group (P<0.05). Following curcumin treatment, the DM and NC-induced upregulation of vimentin and desmin mRNA expression levels were comparable to the control group (Fig. 1).

Effect of curcumin on the mRNA expression of gap junction and podocytes integrity gene markers

Diabetic rats demonstrated no changes to SPD mRNA expression level. However, diabetic rats treated with NC exhibited significantly reduced SPD mRNA expression levels compared with diabetic or control rats (P<0.05; Fig. 2A). Diabetic rats treated with NC and curcumin exhibited increased levels of SPD mRNA expression compared with the diabetic rats with NC treatment (P<0.05; Fig. 2A).

DM significantly decreased the Cx43 mRNA expression compared with the control levels (P<0.05; Fig. 2B). Administration of NC to DM rats resulted in a further reduction of the Cx43 mRNA expression level. However, curcumin supplementation abrogated the combined inhibitory effect of DM and NC on the Cx43 mRNA, restoring its expression, as compared with the DM + NC group (P<0.05; Fig. 2B).

Diabetic rats exhibited a downregulation of EPO mRNA expression levels compared with the control rats (P<0.05; Fig. 2C). NC treatment of diabetic rats caused further suppression of EPO mRNA expression compared with the diabetic group (P<0.05). Curcumin supplementation prevented the diabetic and NC-induced suppression of EPO (P<0.05) and further increased EPO expression levels compared with control levels (P<0.05; Fig. 2C).

Effect of curcumin on mRNA expression of kidney oxidative stress markers

Diabetic rats exhibited upregulated SREBP-1c mRNA expression levels compared with control rats (P<0.05; Fig. 3A). NC treatment of diabetic rats did not demonstrate any significant change to the SREBP-1c mRNA expression compared with diabetic rats. However, the DM-induced SREBP-1c mRNA expression was abolished by curcumin supplementation, as compared with the DM + NC group (P<0.05; Fig. 3A).

Diabetic rats exhibited a significant increase of TGF-β1 mRNA expression levels compared with the control group (P<0.05; Fig. 3B). NC treatment of diabetic rats decreased TGF-β1 mRNA expression levels compared with diabetic rats, however, the levels remained significantly higher compared with the control rats (P<0.05). The DM-induced increases in the TGF-β1 mRNA expression level was significantly inhibited by curcumin supplementation, as compared with the DM + NC group (P<0.05), and was normalized to control levels (Fig. 3B).

Diabetic rats exhibited upregulated iNOS mRNA expression levels compared with control rats. NC treatment of diabetic rats further increased iNOS mRNA expression levels, as compared with diabetic rats. However, the increased level of iNOS mRNA was inhibited by curcumin supplementation, compared with the DM and NC group (P<0.05; Fig. 3C).

Histopathological findings

The effect of curcumin on the histological structure of the pancreas was investigated. Pancreatic sections from control rats exhibited islets of Langerhans cells, and contained lightly stained acidophilic cells arranged in branching and anastomosing cords (Fig. 4A). Sections immunostained for the presence of insulin displayed positive β-cells within the islets (Fig. 4A). Sections from diabetic rats displayed damaged islets, represented by cytoplasmic vacuolations, pyknotic nuclei and a decrease in insulin antibody reaction (Fig. 4B). β-Cells from diabetic rats that received NC exhibited more severe islet alterations (Fig. 4C). Sections from diabetic rats that received NC and curcumin exhibited decreased β-cell damage and increased numbers of positive insulin-reacted cells (Fig. 4D).

Effect of curcumin on the kidney histological structure

Kidney sections of control rats displayed the cortex to be occupied by renal corpuscles and surrounding proximal and distal convoluted tubules (Fig. 5A, left panel), and the medulla tissue exhibited straight proximal and distal tubules, collecting ducts and thin tubules distinguished from medullary blood capillaries (Fig. 5A, right panel). Kidney tissues from DM rats displayed tissue damage, including glomerular hypertrophy, hypercellularity, mesangial expansion, pronounced glomerular sclerosis, severe tubulo-interstitial changes represented by lipid accumulation in the cortical tubules, tubular dilatation, interstitial mononuclear cell infiltration and fibroplasia (Fig. 5B). NC treatment further enhanced tissue damage, which was represented by increases in glomerular hypertrophy, sclerosis, mesangial expansion and severe tubulo-interstitial changes (Fig. 5C). However, curcumin treatment reduced the incidence of glomerular sclerosis, lipid accumulation and tubular dilatation compared with that of diabetic rats receiving NC without curcumin treatment (Fig. 5D).

Discussion

The results of the present study demonstrated vimentin and desmin mRNA levels to be upregulated in diabetic rats. This indicates tissue injury, as vimentin is an important marker of tubular epithelial-mesenchymal transition (EMT) (14). Desmin upregulation is considered to be a marker of podocyte injury (15). The downregulation of vimentin and desmin in diabetic rats by NC indicated that NC-induced DN exaggeration may require vimentin and desmin upregulation. However, their normalization following curcumin supplementation suggested that curcumin protects against DN. The results of the current study are in agreement with a previous finding demonstrating that fasudil (a renal anti-fibrotic drug) prevented high glucose-induced EMT via decreased vimentin expression (16).

The slit diaphragm is important in the prevention of glomerular protein leakage during physiological and pathological processes (17). The slit diaphragm consists of proteins specifically expressed by podocytes, including nephrin, podocin, and SPD (18). The observation of reduced expression of SPD and Cx43 mRNA levels in diabetic rats in the present study corroborates previous studies that have demonstrated Cx43 reduction in the kidneys of STZ-diabetic rats (19) and reduced SPD expression in the glomeruli of patients with DM (20). The further downregulation of SPD and Cx43 mRNA levels by NC exposure implies that the NC-induced progression of DN may act via gap junctions and perturbation of podocytes. The reduction of SPD mRNA expression levels in diabetic rats may indicate the loss of podocytes in the urine, and its further reduction in diabetic rats treated with NC may indicate that NC increases the loss of podocytes in urine. Previous studies have demonstrated increased gene expression levels of podocyte markers, including SPD, in the urine of patients with DN, implying increased excretion of podocytes (21). The prevention of the suppressive effect of DM and NC on SPD and Cx43 mRNA levels by curcumin indicates that curcumin may protect podocytes and renal gap junctions against the oxidative stress caused by DM and smoking.

The downregulation of EPO mRNA expression levels in diabetic rats may be associated with the high risk of anemia, as patients with DN have a greater risk of developing anemia (22). DM-associated events in DN, such as tubulo-interstitial damage, result in the impairment of EPO production by peritubular fibroblasts, leading to the development of anemia (23). In the present study, the further suppression of EPO mRNA levels in diabetic rats exposed to NC indicated the ability of NC to increase cumulative oxidative stress and suppress EPO. Smoking during pregnancy was previously reported to be associated with a high risk of compromised child development due to maternal anemia and fetal hypoxia (24). Curcumin protected EPO mRNA expression levels from the combined inhibition by DM and NC, indicating that curcumin may be able to protect the kidney from anemia caused by DM and NC. A previous study suggested that EPO administration may reduce anemia and slow the progression of CKD (25). EPO upregulation by curcumin in the current study may also represent a pathway via which curcumin mediates its reported protective activity against obesity-induced oxidative stress in mice (26).

Renal SREBP-1c upregulation is an important mechanism leading to renal TG accumulation and DN (27). In the current study, SREBP-1c mRNA upregulation was indicated, consistent with trends observed in previous studies on mesangial cells (28) and rats with type 1 DM (29). TGF-β1 is considered as one of the main cytokines that aggravates DN (30). ECM accumulation is one of the characteristic structural abnormalities associated with DN, in addition to kidney hypertrophy and increased thickness of the glomerular basement membrane (31). In the present study, the upregulation TGF-β1 in diabetic rats may be caused by SREBP-1c activation. Previously, high glucose-induced TGF-β1 upregulation was demonstrated to be caused by the binding of activated SREBP-1c to the TGF promoter (28). In the current study, the partial downregulation of TGF-β1 caused by NC in DM rats may indicate that NC is able to partially inactivate the SREBP-1c protein, as the mRNA expression level of SREBP-1c was not affected. NC was previously demonstrated to improve the serum lipid profile, decrease insulin serum levels, and to reduce steatosis and inflammation (32). The normalization of the SREBP-1 mRNA expression levels by curcumin supplementation in diabetic rats may be important for the normalization of TGF-β1 and may represent a pathway by which curcumin protects the kidney from DN. Zhenqing recipe (a Chinese herbal prescription for improvement of renal function) has been reported to improve DN through the downregulation of SREBP-1c mRNA, which is overexpressed in rats with type 2 DM (33). Additionally, TEMPOL (a SOD-mimicking drug) was reported to ameliorate the pathological changes in diabetic glomeruli by reducing the TGF-β1 expression levels (34). The results of the current study indicated that NC has 2 opposing effects on the kidney as follows: A protective effect represented by the downregulation of vimentin and desmin expression; and a detrimental effect represented by the downregulation of SPD, Cx43 and EPO and the upregulation of iNOS mRNA expression levels. However, the net effects of NC on the kidney demonstrate an increase in the markers of kidney function (creatinine, urea and MDA), further reductions in the levels of GPx and SOD in the serum, and the histopathological changes to the kidney structure. These changes demonstrate the overwhelmingly destructive effects of NC. Notably, destructive effects of combined DM and NC were ameliorated by curcumin supplementation.

The morphological changes in pancreatic islets from STZ-induced diabetic rats, including cytoplasmic vacuolations, pyknotic nuclei and the decrease in insulin-positive granules, are in agreement with previous reports (35). STZ-induced DM is caused by oxidative stress on β-cells, which are particularly susceptible to oxidative insult due to their relatively low levels of antioxidants (36). NC-induced oxidative stress (37) increases the insult on the cells and may cause NC-induced β-cell apoptosis and permanent β-cell loss (38,39). Abnormal lipid deposits have been previously reported in the renal cortical tubules of patients with DM (40) and have been proposed to participate in the pathogenesis of DN in STZ-induced diabetic rats (41). Curcumin amelioration of Langerhans lesions in rat pancreatic islets may be due to the anti-oxidative activity of curcumin, which may be mediated by decreased iNOS and/or increased EPO expression levels. Additionally, curcumin may exert its anti-oxidative effect via increased ROS scavenging activity through the upregulation of SOD and GPx mRNA levels. The infiltration of macrophages and mesangial accumulation of ECM proteins are commonly associated with DN (42). In a previous study, curcumin exhibited renoprotective effects in STZ-induced type 1 DN, it reduced the proteinuria and pathological changes associated with DM through the inhibition of macrophage infiltration. Curcumin was suggested to have antifibrotic and anti-inflammatory effects (43).

Increased lipid deposition in the kidney tubules of diabetic rats indicated disturbance in lipid metabolism caused by oxidative stress (44). Additional lipid deposition due to NC exposure indicated that NC increases oxidative stress further in DM. The increased lipid deposition in the kidney contributes to cellular damage and to the progression of DN (41). The ameliorative effect of curcumin against DM and the effects of NC may be due to its effects on a wide range of molecular targets that control lipid accumulation (45). Curcumin was reported to protect against DN progression through the phosphorylation of AMP-activated kinase and SREBP-1c suppression, and the reduction of renal TG accumulation (41).

In conclusion, the current study investigated the mechanisms through which curcumin protects against the combined oxidative stress of DM and NC exposure. Curcumin acts through normalizing the expression levels of various factors important during DN progression. This includes normalization of the levels of the suppressed antioxidants, SPD, Cx43 and EPO, and the DM-induced factors, MDA, GGT, vimintin, desmin, SREBP-1c, TGF-β1 and iNOS. Clarification of the underlying mechanisms of curcumin activity may provide novel therapeutic targets for the treatment of DN.

Acknowledgments

The present work was supported in part by a research project grant (no. 1/434/2799) from Taif University. The authors are thankful to Associate Professor Samir Ahmed El-shzely, at the Department of Biotechnology, College of Science (Taif University) and to Dr Mohamed Abdo Nassan (Department of Pathology, Faculty of Veterinary Medicine, Zagazig University, Egypt) for their help with the practical part of the study.

Abbreviations:

DN

diabetic nephropathy

STZ

streptozotocin

HDL

high density lipoprotein

SOD

superoxide dismutase

GPx

glutathione peroxidase

SPD

synaptopodin

Cx43

connexin 43

EPO

erythropoietin

TG

triacylglycerol

MDA

malondialdehyde

GGT

γ-glutamyltranspeptidase or glutathione hydrolase

SREBP-1

sterol regulatory element binding protein 1

iNOS

inducible nitric oxide synthase

TGF-β1

transforming growth factor β1

DM

diabetes mellitus

EMT

epithelial-mesenchymal transition

ECM

extracellular matrix

References

1 

Gao Q, Shen W, Qin W, Zheng C, Zhang M, Zeng C, Wang S, Wang J, Zhu X and Liu Z: Treatment of db/db diabetic mice with triptolide: A novel therapy for diabetic nephropathy. Nephrol Dial Transplant. 25:3539–3547. 2010. View Article : Google Scholar : PubMed/NCBI

2 

Forbes JM, Coughlan MT and Cooper ME: Oxidative stress as a major culprit in kidney disease in diabetes. Diabetes. 57:1446–1454. 2008. View Article : Google Scholar : PubMed/NCBI

3 

Rossing P, Hougaard P and Parving HH: Risk factors for development of incipient and overt diabetic nephropathy in type 1 diabetic patients: A 10-year prospective observational study. Diabetes Care. 25:859–864. 2002. View Article : Google Scholar : PubMed/NCBI

4 

Sawicki PT, Didjurgeit U, Mühlhauser I, Bender R, Heinemann L and Berger M: Smoking is associated with progression of diabetic nephropathy. Diabetes Care. 17:126–131. 1994. View Article : Google Scholar : PubMed/NCBI

5 

Mühlhauser I, Bender R, Bott U, Jörgens V, Grüsser M, Wagener W, Overmann H and Berger M: Cigarette smoking and progression of retinopathy and nephropathy in type 1 diabetes. Diabet Med. 13:536–543. 1996. View Article : Google Scholar : PubMed/NCBI

6 

De Cosmo S, Lamacchia O, Rauseo A, Viti R, Gesualdo L, Pilotti A, Trischitta V and Cignarelli M: Cigarette smoking is associated with low glomerular filtration rate in male patients with type 2 diabetes. Diabetes Care. 11:2467–2470. 2006. View Article : Google Scholar

7 

Hallan SI and Orth SR: Smoking is a risk factor in the progression to kidney failure. Kidney Int. 80:516–523. 2011. View Article : Google Scholar : PubMed/NCBI

8 

Winer S, Chan Y, Paltser G, Truong D, Tsui H, Bahrami J, Dorfman R, Wang Y, Zielenski J, Mastronardi F, et al: Normalization of obesity-associated insulin resistance through immunotherapy. Nat Med. 15:921–929. 2009. View Article : Google Scholar : PubMed/NCBI

9 

Aggarwal BB, Sundaram C, Malani N and Ichikawa H: Curcumin: The Indian solid gold. Adv Exp Med Biol. 595:1–75. 2007. View Article : Google Scholar : PubMed/NCBI

10 

Sharma S, Kulkarni SK and Chopra K: Curcumin, the active principle of turmeric (Curcuma longa), ameliorates diabetic nephropathy in rats. Clin Exp Pharmacol Physiol. 33:940–945. 2006. View Article : Google Scholar : PubMed/NCBI

11 

Meghana K, Sanjeev G and Ramesh B: Curcumin prevents streptozotocin-induced islet damage by scavenging free radicals: A prophylactic and protective role. Eur J Pharmacol. 577:183–191. 2007. View Article : Google Scholar : PubMed/NCBI

12 

Chiu J, Khan ZA, Farhangkhoee H and Chakrabarti S: Curcumin prevents diabetes-associated abnormalities in the kidneys by inhibiting p300 and nuclear factor-kappaB. Nutrition. 25:964–972. 2009. View Article : Google Scholar : PubMed/NCBI

13 

Suvarna SK, Layton C and Bancroft JD: The hematoxylins and eosin. Bancroft's Theory and Practice of Histological Techniques. 7th edition. Churchill Livingstone; London: pp. 172–186. 2013

14 

Liu DG and Wang TM: Role of connective tissue growth factor in experimental radiation nephropathy in rats. Chin Med J (Engl). 121:1925–1931. 2008.

15 

Zheng CX, Chen ZH, Zeng CH, Qin WS, Li LS and Liu ZH: Triptolide protects podocytes from puromycin aminonucleoside induced injury in vivo and in vitro. Kidney Int. 74:596–612. 2008. View Article : Google Scholar : PubMed/NCBI

16 

Gu L, Gao Q, Ni L, Wang M and Shen F: Fasudil inhibits epithelial-myofibroblast transdifferentiation of human renal tubular epithelial HK-2 cells induced by high glucose. Chem Pharm Bull (Tokyo). 61:688–694. 2013. View Article : Google Scholar

17 

Lan X, Rai P, Chandel N, Cheng K, Lederman R, Saleem MA, Mathieson PW, Husain M, Crosson JT, Gupta K, et al: Morphine induces albuminuria by compromising podocyte integrity. PLoS One. 8:e557482013. View Article : Google Scholar : PubMed/NCBI

18 

Benzing T: Signaling at the slit diaphragm. J Am Soc Nephrol. 15:1382–1391. 2004. View Article : Google Scholar : PubMed/NCBI

19 

Satriano J, Mansoury H, Deng A, Sharma K, Vallon V, Blantz RC and Thomson SC: Transition of kidney tubule cells to a senescent phenotype in early experimental diabetes. Am J Physiol Cell Physiol. 299:C374–C380. 2010. View Article : Google Scholar : PubMed/NCBI

20 

Miyauchi M, Toyoda M, Kobayashi K, Abe M, Kobayashi T, Kato M, Yamamoto N, Kimura M, Umezono T and Suzuki D: Hypertrophy and loss of podocytes in diabetic nephropathy. Intern Med. 48:1615–1620. 2009. View Article : Google Scholar : PubMed/NCBI

21 

Zheng M1, Lv LL, Ni J, Ni HF, Li Q, Ma KL and Liu BC: Urinary podocyte-associated mRNA profile in various stages of diabetic nephropathy. PLoS One. 6:e204312011. View Article : Google Scholar : PubMed/NCBI

22 

Dousdampanis P, Trigka K and Fourtounas C: Prevalence of anemia in patients with type II diabetes and mild to moderate chronic kidney disease and the impact of anti-RAS medications. Saudi J Kidney Dis Transpl. 25:552–557. 2014. View Article : Google Scholar : PubMed/NCBI

23 

Singh DK, Winocour P and Farrington K: Erythropoietic stress and anemia in diabetes mellitus. Nat Rev Endocrinol. 5:204–210. 2009. View Article : Google Scholar : PubMed/NCBI

24 

Habek D, Habek JC, Ivanisević M and Djelmis J: Fetal tobacco syndrome and perinatal outcome. Fetal Diagn Ther. 6:367–371. 2002. View Article : Google Scholar

25 

Gouva C, Nikolopoulos P, Ioannidis JP and Siamopoulos KC: Treating anemia early in renal failure patients slows the decline of renal function: A randomized controlled trial. Kidney Int. 66:753–760. 2004. View Article : Google Scholar : PubMed/NCBI

26 

Martínez-Morúa A, Soto-Urquieta MG, Franco-Robles E, Zúñiga-Trujillo I, Campos-Cervantes A, Pérez-Vázquez V and Ramírez-Emiliano J: Curcumin decreases oxidative stress in mitochondria isolated from liver and kidneys of high-fat diet-induced obese mice. J Asian Nat Prod Res. 15:905–915. 2013. View Article : Google Scholar : PubMed/NCBI

27 

Ishigaki N, Yamamoto T, Shimizu Y, Kobayashi K, Yatoh S, Sone H, Takahashi A, Suzuki H, Yamagata K, Yamada N and Shimano H: Involvement of glomerular SREBP-1c in diabetic nephropathy. Biochem Biophys Res Commun. 364:502–508. 2007. View Article : Google Scholar : PubMed/NCBI

28 

Uttarwar L, Gao B, Ingram AJ and Krepinsky JC: SREBP-1 activation by glucose mediates TGF-β upregulation in mesangial cells. Am J Physiol Renal Physiol. 302:F329–F341. 2012. View Article : Google Scholar

29 

Jun H, Song Z, Chen W, Zanhua R, Yonghong S, Shuxia L and Huijun D: In vivo and in vitro effects of SREBP-1 on diabetic renal tubular lipid accumulation and RNAi-mediated gene silencing study. Histochem Cell Biol. 3:327–345. 2009. View Article : Google Scholar

30 

Basile DP: Transforming growth factor-beta as a target for treatment in diabetic nephropathy. Am J Kidney Dis. 38:887–892. 2001. View Article : Google Scholar : PubMed/NCBI

31 

Lv S, Liu G, Sun AG, Wang J, Cheng J, Wang W, Liu X, Nie H and Guan G: Mesenchymal stem cells ameliorate diabetic glomerular fibrosis in vivo and in vitro by inhibiting TGF-β signalling via secretion of bone morphogenetic protein 7. Diab Vasc Dis Res. 11:251–261. 2014. View Article : Google Scholar : PubMed/NCBI

32 

Seoane-Collazo P, Martínez de Morentin PB, Fernø J, Diéguez C, Nogueiras R and López M: Nicotine improves obesity and hepatic steatosis and ER stress in diet-induced obese male rats. Endocrinology. 155:1679–1689. 2014. View Article : Google Scholar : PubMed/NCBI

33 

Wen X, Zeng Y, Liu L, Zhang H, Xu W, Li N and Jia X: Zhenqing recipe alleviates diabetic nephropathy in experimental type 2 diabetic rats through suppression of SREBP-1c. J Ethnopharmacol. 142:144–150. 2012. View Article : Google Scholar : PubMed/NCBI

34 

Luan J, Li W, Han J, Zhang W, Gong H and Ma R: Renal protection of in vivo administration of tempol in streptozotocin-induced diabetic rats. J Pharmacol Sci. 119:167–176. 2012. View Article : Google Scholar : PubMed/NCBI

35 

Simsek N, Kaya M, Kara A, Can I, Karadeniz A and Kalkan Y: Effects of melatonin on islet neogenesis and beta cell apoptosis in streptozotocin-induced diabetic rats: An immunohistochemical study. Domest Anim Endocrinol. 43:47–57. 2012. View Article : Google Scholar : PubMed/NCBI

36 

Akinola OB, Caxton Martins EA and Dini L: Chronic treatment with ethanolic extract of the leaves of Azadirachta indica ameliorates lesions of pancreatic islets in streptozotocin diabetes. Int J Morphol. 28:291–302. 2010.

37 

Bruin JE, Kellenberger LD, Gerstein HC, Morrison KM and Holloway AC: Fetal and neonatal nicotine exposure and postnatal glucose homeostasis: Identifying critical windows of exposure. Journal of Endocrinology. 194:171–178. 2007. View Article : Google Scholar : PubMed/NCBI

38 

Bruin JE, Petre MA, Lehman MA, Raha S, Gerstein HC, Morrison KM and Holloway AC: Maternal nicotine exposure increases oxidative stress in the offspring. Free Radic Biol Med. 44:1919–1925. 2008. View Article : Google Scholar : PubMed/NCBI

39 

Abdul-Hamid M and Moustafa N: Protective effect of curcumin on histopathology and ultrastructure of pancreas in the alloxan treated rats for induction of diabetes. J Appl Zool. 66:169–179. 2013. View Article : Google Scholar

40 

Ong AC, Jowett TP, Firth JD, Burton S, Kitamura M and Fine LG: Human tubular-derived endothelin in the paracrine regulation of renal interstitial fibroblast function. Exp Nephrol. 2:1341994.PubMed/NCBI

41 

Soetikno V, Suzuki K, Veeraveedu PT, Arumugam S, Lakshmanan AP, Sone H and Watanabe K: Molecular understanding of curcumin in diabetic nephropathy. Drug Discov Today. 18:756–63. 2013. View Article : Google Scholar : PubMed/NCBI

42 

Sassy-Prigent C, Heudes D, Mandet C, Bélair MF, Michel O, Perdereau B, Bariéty J and Bruneval P: Early glomerular macrophage recruitment in streptozotocin-induced diabetic rats. Diabetes. 49:466–475. 2000. View Article : Google Scholar : PubMed/NCBI

43 

Soetikno V, Sari FR, Veeraveedu PT, Thandavarayan RA, Harima M, Sukumaran V, Lakshmanan AP, Suzuki K, Kawachi H and Watanabe K: Curcumin ameliorates macrophage infiltration by inhibiting NF-κB activation and proinflammatory cytokines in streptozotocin induced-diabetic nephropathy. Nutr Metab (Lond). 8:352001. View Article : Google Scholar

44 

Asaba K, Tojo A, Onozato ML, Goto A, Quinn MT, Fujita T and Wilcox CS: Effects of NADPH oxidase inhibitor in diabetic nephropathy. Kidney Int. 67:1890–1898. 2005. View Article : Google Scholar : PubMed/NCBI

45 

Goel A, Kunnumakkara AB and Aggarwal BB: Curcumin as 'Curecumin': From kitchen to clinic. Biochem Pharmacol. 75:787–809. 2008. View Article : Google Scholar

Related Articles

Journal Cover

April-2016
Volume 13 Issue 4

Print ISSN: 1791-2997
Online ISSN:1791-3004

Sign up for eToc alerts

Recommend to Library

Copy and paste a formatted citation
x
Spandidos Publications style
Ibrahim ZS, Alkafafy ME, Ahmed MM and Soliman MM: Renoprotective effect of curcumin against the combined oxidative stress of diabetes and nicotine in rats. Mol Med Rep 13: 3017-3026, 2016
APA
Ibrahim, Z.S., Alkafafy, M.E., Ahmed, M.M., & Soliman, M.M. (2016). Renoprotective effect of curcumin against the combined oxidative stress of diabetes and nicotine in rats. Molecular Medicine Reports, 13, 3017-3026. https://doi.org/10.3892/mmr.2016.4922
MLA
Ibrahim, Z. S., Alkafafy, M. E., Ahmed, M. M., Soliman, M. M."Renoprotective effect of curcumin against the combined oxidative stress of diabetes and nicotine in rats". Molecular Medicine Reports 13.4 (2016): 3017-3026.
Chicago
Ibrahim, Z. S., Alkafafy, M. E., Ahmed, M. M., Soliman, M. M."Renoprotective effect of curcumin against the combined oxidative stress of diabetes and nicotine in rats". Molecular Medicine Reports 13, no. 4 (2016): 3017-3026. https://doi.org/10.3892/mmr.2016.4922