Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Molecular Medicine Reports
Join Editorial Board Propose a Special Issue
Print ISSN: 1791-2997 Online ISSN: 1791-3004
Journal Cover
September-2017 Volume 16 Issue 3

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
September-2017 Volume 16 Issue 3

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article Open Access

Spectrum construction of differentially expressed circular RNAs in patients with leukoaraiosis and function analysis of differentially expressed genes

  • Authors:
    • Te Mi
    • Changjiang Luo
    • Yawei Hu
    • Chuanqiang Qu
    • Xiang Wang
    • Shougang Guo
    • Yifeng Du
  • View Affiliations / Copyright

    Affiliations: Department of ICU, Jining No. 1 People's Hospital, Jining, Shandong 272000, P.R. China, Department of Neurology, Provincial Hospital Affiliated to Shandong University (South Branch), Jinan, Shandong 250002, P.R. China, Department of Neurosurgery, Affiliated Hospital of Jining Medical University Jining, Shandong 272029, P.R. China, Department of Neurology, Provincial Hospital Affiliated to Shandong University, Jinan, Shandong 250021, P.R. China
    Copyright: © Mi et al. This is an open access article distributed under the terms of Creative Commons Attribution License.
  • Pages: 2563-2569
    |
    Published online on: June 28, 2017
       https://doi.org/10.3892/mmr.2017.6871
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

Circular RNAs (circRNAs) are class of endogenous RNAs that have a role in the regulation of gene expression. The present study aimed to investigate the diagnostic value and role of circRNA in the pathogenesis of leukoaraiosis (LA). The present study performed Arraystar Human circRNA Array analysis of 6 samples from LA cases and 6 samples from control cases. Differentially expressed (DE) circRNAs between two samples were identified through fold‑change (>1.5‑fold) screening. Afterwards, based on DE circRNAs, the gene ontology (GO) analysis of upregulated DE genes identified from DE circRNAs demonstrated that DE genes were primarily associated with cellular metabolic processes, membrane‑bound organelles and binding. However, none were enriched in the Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway. Downregulated DE genes were enriched in cellular localization, cytoplasm and kinase binding. For the KEGG pathways, the downregulated DE genes were primarily associated with the insulin signaling pathway. The results of the present study indicated that the DE genes from differently expressed circRNAs may have an important role in the pathogenesis of LA and may be a novel targfet for further research.

Introduction

Leukoaraiosis (LA), a common form of cerebral white matter lesion (WML), is characterized by punctuate or patchy hyperintensities in the periventricular or subcortical white matter observed via magnetic resonance imaging (MRI). Although it remains asymptomatic, LA is not considered to be benign, and has been demonstrated to be associated with poor clinical outcomes and increased risk of disability, dementia, depression, stroke, and the overall morbidity and mortality (1). LA is associated with increased age, hypertension, diabetes mellitus, history of stroke and chronic atherosclerotic diseases (2). As hypertension is reported to be one of the major determinants of WMLs, the present study only included subjects with a history of hypertension. Despite intensive research, an understanding of the pathological mechanism remains incomplete, and is likely to be multifactorial. Therefore, identifying biomarkers is essential to improve the early diagnosis of LA.

Circular RNAs (circRNAs) are a class of endogenous RNAs that have a stable structure (3), which is a clear advantage of using circRNAs as a diagnostic marker. Previous studies have demonstrated that circRNAs are involved in the development of several types of diseases, including nervous system disorders (4,5). However, limited information is available regarding the association of circRNAs with LA. The present study, based on the hypertension population, compared the circRNA expression profiles of LA sufferers and controls. By performing a circRNA array analysis and reverse transcription-quantitative polymerase chain reaction (RT-qPCR), the present study demonstrated that certain circRNAs, including has_circ_102533 and has_circ_103783, may have potential as a novel type of biomarker for the diagnosis of LA. In addition, the gene ontology and KEGG analysis of differentially expressed (DE) genes may contribute to an improved understanding of the pathogenesis of LA.

Materials and methods

Subjects and clinical specimens

The current study was performed in accordance with the guidelines of the Helsinki Declaration. Written informed consent was obtained from all subjects and the Ethics Committee of Shandong Provincial Hospital Affiliated to Shandong University (Jinan, China) approved all aspects of the present study. A total of 30 subjects were recruited between August 2014 and September 2015 at Shandong Provincial Hospital Affiliated to Shandong University. All cases had a history of hypertension for 5–15 years. The groups were as follows: Test (LA sufferers; n=20; 7 males and 13 females) and control (no LA; n=10; 3 males and 7 females). The mean age was 58±5.7 years. The subjects had a mean systolic pressure of 150±7.1 mmHg and a mean diastolic pressure of 84±4.2 mmHg. LA is defined as punctuate or patchy hyperintensities in the periventricular or subcortical white matter, observed by MRI. Hypertension is defined as a history of high blood pressure (≥140/90 mmHg) reported by the respondent, or by the current use of antihypertensive medication. None of the cases suffered from diabetes mellitus, heart diseases, dyslipidemia, hypotension, immune system diseases, hematological disorders, malnutrition, malignant tumors, serious liver and kidney diseases (including severe hepatitis or nephritis), liver or kidney failure, or had a history of heavy smoking (20 cigarettes daily) or alcoholism. Fresh fasting peripheral blood samples (3 ml) were collected early in the morning and subsequently stored at −80°C.

Microarray expression analysis

Based on random sampling, Arraystar Human circRNA Microarray analysis version 2.0 (Arraystar, Inc., Rockville, MD, USA) of 6 samples from LA cases and 6 samples from control cases was performed. The sample preparation and microarray hybridization were performed based on the Arraystar's standard protocols. Total RNA from each sample was quantified using the NanoDrop® ND-1000 (NanoDrop Technologies; Thermo Fisher Scientific, Inc., Wilmington, DE, USA). RNA Integrity and genomic DNA contamination test was performed by denaturing agarose gel electrophoresis. Sample labeling and array hybridization were performed according to the manufacturer's protocol (Arraystar Inc.). Briefly, 2,600 ng/µl total RNA (including 28s and 18s ribosomal RNA from each sample was treated with RNase R (Epicentre, Inc.) to enrich circRNA. The enriched RNA was subsequently amplified and transcribed into fluorescent complementary RNA (cRNA) utilizing random primers according to the Arraystar Super RNA Labeling kit protocol (Arraystar, Inc.). The labeled cRNAs were hybridized onto the Arraystar Human circRNA Mircoarrays (8×15K; Arraystar, Inc.) and incubated for 17 h at 65°C in an Agilent hybridization oven. After washing four times in hybridization buffer the labeled cRNAs, slides were scanned with an Agilent G2505C Microarray Scanner System (Agilent Technologies, Inc., Santa Clara, CA, USA).

Data collection and analysis

Scanned images were imported into Agilent Feature Extraction software version 11.0.1.1 (Agilent Technologies, Inc.) for raw data extraction. Quantile normalization of raw data and subsequent data processing were performed using the R software package (R Project for Statistical Computing, Vienna, Austria). After quantile normalization of the raw data, low intensity filtering was performed, and the circRNAs that were flagged as ‘P’ or ‘M’ (‘All Targets Value’) in at least 3 out of 6 samples were retained for further analyses. When comparing profile differences between two groups (including disease vs. control), the ‘fold change’ (i.e., the ratio of the group mean averages) between the groups for each circRNA was computed. The statistical significance of the difference was determined by a t-test. circRNAs with fold changes >1.5 and P<0.05 were selected as significantly differentially expressed circRNAs. circRNA sequences were predicted by bioinformatics methods, as described previously (6).

RT-qPCR detection of hsa_circ_102470, hsa_circ_101396, hsa_circ_102533 and hsa_circ_103783

Total RNA in plasma was extracted using TRIzol® reagent (Invitrogen; Thermo Fisher Scientific, Inc., Waltham, MA, USA) and was quantified using the NanoDrop® ND-1000, according to the manufacturer's protocol. cDNA was synthesized by RT (Arraystar Super RNA Labeling kit; Arraystar, Inc., Rockville, MD, USA) 3 times using random primers and the Gene Amp PCR system 9700, according to the manufacturer's protocol. A total of 1 µg RNA, 1 µl random (N9), 1.6 µl dNTP mix (2.5 mM dATP, dGTP, dCTP, and dTTP, provided by HyTest Ltd) was combined to make the annealing mixture. This mixture was incubated in a 65°C water bath for 5 min and then put on ice for 2 min. After brief centrifugation at 12,000 × g or 15 min at 4°C, the RT reactant solution (4 µl 5X First-Strand Buffer, 1 µl 0.1 M DTT, 0.3 µl RNase inhibitor and 0.2 µl SuperScript III RT, provided by Invitrogen; Thermo Fisher Scientific, Inc.) was added to a centrifuge tube and incubated at 37°C in a water bath for 1 min. The tube was then incubated at 50°C in a water bath for 60 min, followed by 70°C for 15 min. Subsequently, cDNA was placed on ice. qPCR was performed using Arraystar SYBR®-Green qPCR Master Mix (ROX-), 5 ml on the ViiA™ 7 Real-time PCR system. Cycling conditions were as follows: An initial predenaturation step at 94°C for 20 sec, followed by 40 cycles of denaturation at 95°C for 10 sec, annealing at 60°C for 60 sec and extension at 72°C for 15 sec. The primers used to quantify levels of the 4 circRNAs (hsa_circ_102470, hsa_circ_101396, hsa_circ_102533 and hsa_circ_103783) and GAPDH are presented in Table I. The data were analyzed using the relative values following internal calibration, presented as hsa_circ_102470/GAPDH, hsa_circ_101396/GAPDH, hsa_circ_102533/GAPDH and hsa_circ_103783/GAPDH. Subsequently, the ratios (average relative values in test group divided by the average relative values in control group) of the 4 circRNAs were further analyzed. The 2−∆∆Cq method was used for quantification (5).

Table I.

Primers for reverse transcription-quantitative polymerase chain reaction.

Table I.

Primers for reverse transcription-quantitative polymerase chain reaction.

Sequence

GeneForwardReverseAnnealing temperature (°C)Product length (bp)
GAPDH 5′GGGAAACTGTGGCGTGAT3′ 5′GAGTGGGTGTCGCTGTTGA3′60299
hsa_circRNA_102533 5′GCTGCCAAAAGCATAACCAA3′ 5′CCCCTTTTCTGCTAAATGAACTCT3′60198
hsa_circRNA_103783 5′AAGCTGTTAGCATGATCCCACC3′ 5′GATGAAACTTTTCCAAGTGTGGC3′60133
hsa_circRNA_101396 5′AAAGGTCCACTTCGTATGCTG3′ 5′ACTCTGTCATTGGAGCAACTGTAT3′60221
hsa_circRNA_102470 5′CCTAAATTTCACGACACCAG3′ 5′ATTCAGATTGCTCAAGGTAACT3′60144

[i] circRNA, circular RNA.

Prediction of DE genes and the function analysis of DE genes

GO covers three domains, including biological process, cellular component and molecular function. Fisher's exact test is used by professionals to establish whether there is a higher overlap between the DE list and the GO annotation list than expected by chance. The P-value denotes the significance of GO term enrichment in the DE genes. The lower the P-value, the higher the significance of the GO Term (P<0.05 is recommended). Pathway analysis is a functional analysis that maps genes to KEGG pathways. The P-value (EASE-score, Fisher-P-value or Hypergeometric-P-value) denotes the significance of the pathway associated with the conditions; the lower the P-value, the higher the significance of the pathway (The recommended P-value cut-off is 0.05).

Statistical analysis

Data are presented as the mean ± standard deviation (continuous variables) or as a proportion (discrete variables). The differences between groups were analyzed by Student's t-test (continuous variables) or chi-squared test (discrete variables). SPSS 17.0 software (SPSS, Inc., Chicago, IL, USA) was used for statistical analysis.

Results

Differential expression of circRNAs

The characteristics of age- and sex-matched test and control group subjects are presented in Table II. Compared with the controls, certain circRNAs exhibited >1.5-fold change (P<0.05) in the LA group; 32 were upregulated and 132 were downregulated. Among the upregulated circRNAs, hsa_circ_103783, hsa_circ_101396 and hsa_circ_102533 exhibited the highest statistically significant difference in expression, while of the downregulated circRNAs, hsa_circ_102470 was identified to exhibit the largest difference in expression between the LA and control groups. The results of the RT-qPCR detection of hsa_circ_102470, hsa_circ_101396, hsa_circ_102533 and hsa_circ_103783 are presented in Fig. 1. The expression of hsa_circ_103783 and hsa_circ_102533 in the test group was significantly higher compared with the control group, with fold increases in expression of 3.67 (P<0.001) and 3.52 (P<0.05), respectively. The expression of hsa_circ_101396 was 1.25-fold higher in the test group compared with the control; however, this was not statistically significant (P=0.05). Comparing the expression of hsa_circ_102470 between the two groups, a 0.8-fold downregulation, which was not statistically significant, was observed in the test group (P=0.39).

Figure 1.

Mean relative expression of 4 circRNAs in LA and control groups. Mean relative expression of hsa_circ_102470, hsa_circ_101396, hsa_circ_102533 and hsa_circ_103783 was determined in LA and control groups. circRNAs, circular RNAs; LA, leukoaraiosis. *P<0.05 and **P<0.001.

Table II.

Subject characteristics.

Table II.

Subject characteristics.

CharacteristicTotalLAControlP-value
Age, years58±5.759±6.356±2.40.074
Number of males (%)  10 (33.3)  7 (35)3 (30)0.784
Systolic pressure, mmHg150 (±7.1)148 (±3.2)  153 (±11.0)0.059
Diastolic pressure, mmHg  84 (±4.2)  82 (±3.9)  85 (±4.6)0.162

[i] Data are presented as the mean ± standard deviation (continuous variables) or as a proportion (discrete variables). LA, leukoaraiosis.

GO analysis of DE genes

The top 10 most significant enrichment GO terms of the upregulated DE genes are presented in Tables III–V. The biological process was primarily enriched in metabolic processes, including nucleobase-containing compounds, and heterocycle and cellular aromatic compound metabolic processes. The major cellular components were organelles, membrane-bounded organelles, intracellular membrane-bounded organelles and intracellular organelles. The molecular function predominantly enriched in the activity of histone acetyltransferase and acetyl-CoA were L-lysine, N6-acetyltransferase and ion channel activity. The top 10 most significantly enriched GO terms among the downregulated DE genes are presented in Tables VI–VIII. The present study demonstrated that cellular localization was the most enriched biological process of DE genes, and the major cellular components involved were the cytoplasm and cytosol. The molecular function was predominantly enriched in kinase, enzyme and protein kinase binding.

Table III.

Top ten gene ontology BP terms that upregulated genes were enriched in.

Table III.

Top ten gene ontology BP terms that upregulated genes were enriched in.

BP term, metabolic processEnrichment scoreP-value
Nucleobase-containing compound2.660.002
Heterocycle2.510.003
Cellular aromatic compound2.500.003
Organic cyclic compound2.330.004
Cellular nitrogen compound2.330.004
Regulation of nucleobase-containing compound2.330.004
Regulation of nitrogen compound0.520.005
Nitrogen compound2.240.009
Single organismal cell-cell adhesion2.030.013
Nucleic acid1.860.014

[i] BP, biological process.

Table V.

Top ten MF terms that upregulated genes were enriched in.

Table V.

Top ten MF terms that upregulated genes were enriched in.

MF termEnrichment scoreP-value
Histone acetyltransferase activity2.460.003
Acetyl-CoA:L-lysine2.460.003
N6-acetyltransferase
Ion channel activity2.460.003
Substrate-specific channel activity2.420.004
Channel activity2.340.005
Passive transmembrane transporter activity2.340.005
Enzyme activator activity2.290.005
Anion channel activity2.120.008
N-acetyltransferase activity2.110.008
GTPase activator activity2.090.008

[i] MF, molecular function.

Table VI.

Top ten BP terms that downregulated genes were enriched in.

Table VI.

Top ten BP terms that downregulated genes were enriched in.

BP termEnrichment scoreP-value
Cellular localization4.97<0.001
Establishment of localization in cell4.92<0.001
Intracellular transport4.39<0.001
Macromolecular complex subunit organization4.26<0.001
Cytoplasmic transport4.18<0.001
Modification-dependent macromolecule catabolic process4.10<0.001
Organic substance catabolic process3.98<0.001
Catabolic process3.97<0.001
Cytoskeleton organization3.84<0.001
Organelle localization3.83<0.001

[i] BP, biological process.

Table VIII.

Top ten MF terms that downregulated genes were enriched in.

Table VIII.

Top ten MF terms that downregulated genes were enriched in.

MF termEnrichment scoreP-value
Kinase binding6.17<0.001
Enzyme binding5.05<0.001
Protein kinase binding4.53<0.001
Protein binding3.74<0.001
Transferase activity3.48<0.001
Nucleotide binding3.01<0.001
Nucleoside phosphate binding3.01<0.001
Protein homodimerization activity2.89   0.001
ATP binding2.82   0.002
Protein domain specific binding2.81   0.002

[i] MF, molecular function.

KEGG analysis of DE genes

KEGG enrichment was identified for downregulated DE genes; however, not for upregulated DE genes. The top 10 most significant enrichment KEGG terms are listed in Table IX. The major KEGG item was the insulin signaling pathway, with 10.3% of downregulated DE genes involved in it (Fig. 2; http://www.genome.jp/kegg-bin/show_pathway?scale=1.0&query=&map=hsa04910&scale=0.67&auto_image=&show_description=hide&multi_query= and http://www.kegg.jp/kegg/legal.html).

Figure 2.

Insulin signaling pathway. KEGG enrichment analysis identified that genes that were significantly downregulated in patients with leukoaraiosis compared with controls were enriched in the insulin signaling pathway. The yellow boxes indicate the main compounds in the insulin signaling pathway.

Table IX.

Top ten KEGG pathways that downregulated genes were enriched in.

Table IX.

Top ten KEGG pathways that downregulated genes were enriched in.

KEGG pathwayEnrichment scoreP-value
Insulin signaling pathway, Homo sapiens2.970.001
B cell receptor signaling2.520.003
Thyroid hormone signaling2.510.003
Axon guidance2.380.004
mTOR signaling1.860.014
Transcriptional misregulation in cancer1.770.017
Chemokine signaling1.680.02
Glyoxylate and dicarboxylate metabolism1.640.02
Propanoate metabolism1.640.02
Platelet activation1.620.02

[i] KEGG, Kyoto Encyclopedia of Genes and Genomes.

Discussion

At present, understanding of the pathogenesis of LA remains to be fully elucidated, and there no reliable indicator for the early diagnosis of LA in the hypertension population. Previous studies have eported that LA may be associated with various factors, including age, sex (7), hypertension (2), small vessel disease and atherosclerosis (8). Hypertension is one of the most important established risk factors for LA (9), and pulse pressure was previously demonstrated to be independently associated with LA, regardless of classical cardiovascular risk factors in elderly men (10). However, patients with hypertension do not necessarily suffer from LA. To predict the potential for development of LA among patients with hypertension, the present study investigated potential predictors at the circRNA level.

Previously, circRNA was demonstrated to be a highly prevalent RNA species in the human transcriptome (6), and they may have important roles in the regulation of gene expression (11). circRNA expression levels can be >10-fold higher compared with their linear isomers (6,12). The two most important properties of circRNAs are highly conserved sequences and have a high degree of stability in mammalian cells (13). Certain circRNAs regulate gene expression by serving as competing endogenous RNAs (14). circRNAs block the inhibitory effect of microRNAs (miRNAs) on the target RNA by combining with miRNAs, so as to regulate the expression level of the target RNA (15). Currently, the circRNA with the most compelling evidence for a biological function is the miRNA-7 sponge, CDR1as (16). miRNA-7 was previously demonstrated to serve a key role in Parkinson's and Alzheimer's diseases (17,18).

Although an increasing number of studies have investigated the potential functions of circRNAs in the brain, to the best of our knowledge, the present study is the first to investigate the association between circRNAs and LA. The current study was the first to construct a spectrum of differentially expressed circRNAs in patients with LA, and to identify potential biomarkers for the diagnosis of LA and its pathogenesis. At present, there is no circRNA database for LA. The present study aimed to search a circRNA database for patients with LA and hypertension, via an Arraystar Human circRNA Microarray analysis of 6 test samples and 6 control samples. Subsequently, 32 upregulated and 132 downregulated circRNAs were screened out. Furthermore, 3 upregulated circRNAs (hsa_circ_101396, hsa_circ_102533 and hsa_circ_103783) and 1 downregulated circRNA (hsa_circ_102470) were selected based on a >1.5 fold-change (P<0.05), which were further assessed by RT-qPCR. The results of the current study demonstrated that the exonic RNAs, including hsa_circ_102533 (3.52-fold; P<0.05) and hsa_circ_103783 (3.67-fold; P<0.001), were significantly upregulated in the LA patients compared with the control group, indicating the potential diagnostic value of certain circRNAs for LA.

GO enrichment analysis of the upregulated DE genes indicated that DE genes were primarily associated with metabolic processes, organelles and the activity of certain transferases. However, it remains to be elucidated whether such gene products have the potential to be novel detectors for LA. In addition, GO and KEGG analysis of downregulated DE genes indicated that DE genes were primarily enriched in the cytoplasm, kinase binding and the insulin signaling pathway. The insulin signaling pathway was revealed to be pleiotropic, and included c-Cbl-associated protein, insulin receptor substrate-1, mitogen activated protein kinase, plasma cell glycoprotein-1, phosphoinositide-dependent kinase, protein kinase C and phosphatidylinositol 3-kinase (PI3-K). The involvement of phosphatidylinositol 3-kinase/protein kinase B (PI3-K/Akt) -dependent signaling pathways were found in normal cellular functions. The dysfunction of this signaling pathway has a pivotal role in atherosclerosis (19) and hypertension (20). Therefore, it was hypothesized that the PI3-K/Akt-dependent signaling pathway may contribute to the pathological changes of LA. However, this requires further investigation.

In conclusion, DE circRNAs were identified between patients with LA and controls among a hypertension population. The present study indicated that the upregulated circRNAs, hsa_circ_102533 and hsa_circ_103783, may have potential as biomarkers for the diagnosis of LA. GO and KEGG enrichment analyses of DE genes indicated that the DE genes were associated with the pathogenesis of LA. However, due to the limited number of plasma samples of LA, the present study only analyzed the expression of 4 circRNAs in 20 plasma samples with LA and 10 control samples. Future studies should increase the sample size to further confirm the diagnostic value of hsa_circ_102533 and hsa_circ_103783 for LA. Importantly, the conclusions were based on a large number of early experimental results; therefore, the specific mechanisms requires further investigation.

Acknowledgements

This study was supported by the National Natural Science Foundation of China (grant no. 30970991) and the Key Research and Development Program of Shandong Province (grant no. 2015GSF118069).

References

1 

Lin Q, Huang WQ and Tzeng CM: Genetic associations of leukoaraiosis indicate pathophysiological mechanisms in white matter lesions etiology. Rev Neurosci. 26:343–358. 2015. View Article : Google Scholar : PubMed/NCBI

2 

Ben-Assayag E, Mijajlovic M, Shenhar-Tsarfaty S, Bova I, Shopin L and Bornstein NM: Leukoaraiosis is a chronic atherosclerotic disease. ScientificWorldJournal. 2012:5321412012. View Article : Google Scholar : PubMed/NCBI

3 

Memczak S, Jens M, Elefsinioti A, Torti F, Krueger J, Rybak A, Maier L, Mackowiak SD, Gregersen LH, Munschauer M, et al: Circular RNAs are a large class of animal RNAs with regulatory potency. Nature. 495:333–338. 2013. View Article : Google Scholar : PubMed/NCBI

4 

Chen YT, Rettig WJ, Yenamandra AK, Kozak CA, Chaganti RS, Posner JB and Old LJ: Cerebellar degeneration-related antigen: A highly conserved neuroectodermal marker mapped to chromosomes X in human and mouse. Proc Natl Acad Sci USA. 87:3077–3081. 1990. View Article : Google Scholar : PubMed/NCBI

5 

Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2 (−Delta Delta C(T)) method. Methods. 25:402–408. 2001. View Article : Google Scholar : PubMed/NCBI

6 

Salzman J, Gawad C, Wang PL, Lacayo N and Brown PO: Circular RNAs are the predominant transcript isoform from hundreds of human genes in diverse cell types. PLoS One. 7:e307332012. View Article : Google Scholar : PubMed/NCBI

7 

Simoni M, Li L, Paul NL, Gruter BE, Schulz UG, Küker W and Rothwell PM: Age- and sex-specific rates of leukoaraiosis in TIA and stroke patients: Population-based study. Neurology. 79:1215–1222. 2012. View Article : Google Scholar : PubMed/NCBI

8 

Uh J, Yezhuvath U, Cheng Y and Lu H: In vivo vascular hallmarks of diffuse leukoaraiosis. J Magn Reson Imaging. 32:184–190. 2010. View Article : Google Scholar : PubMed/NCBI

9 

Avet J, Pichot V, Barthélémy JC, Laurent B, Garcin A, Roche F and Celle S: Leukoaraiosis and ambulatory blood pressure load in a healthy elderly cohort study: The PROOF study. Int J Cardiol. 172:59–63. 2014. View Article : Google Scholar : PubMed/NCBI

10 

Kim SH, Shim JY, Lee HR, Na HY and Lee YJ: The relationship between pulse pressure and leukoaraiosis in the elderly. Arch Gerontol Geriatr. 54:206–209. 2012. View Article : Google Scholar : PubMed/NCBI

11 

Guo JU, Agarwal V, Guo H and Bartel DP: Expanded identification and characterization of mammalian circular RNAs. Genome Biol. 15:4092014. View Article : Google Scholar : PubMed/NCBI

12 

Jeck WR, Sorrentino JA, Wang K, Slevin MK, Burd CE, Liu J, Marzluff WF and Sharpless NE: Circular RNAs are abundant, conserved, and associated with ALU repeats. RNA. 19:141–157. 2013. View Article : Google Scholar : PubMed/NCBI

13 

Hansen TB, Jensen TI, Clausen BH, Bramsen JB, Finsen B, Damgaard CK and Kjems J: Natural RNA circles function as efficient microRNA sponges. Nature. 495:384–388. 2013. View Article : Google Scholar : PubMed/NCBI

14 

Danan M, Schwartz S, Edelheit S and Sorek R: Transcriptome-wide discovery of circular RNAs in Archaea. Nucleic Acids Res. 40:3131–3142. 2012. View Article : Google Scholar : PubMed/NCBI

15 

Valdmanis PN and Kay MA: The expanding repertoire of circular RNAs. Mol Ther. 21:1112–1114. 2013. View Article : Google Scholar : PubMed/NCBI

16 

Hentze MW and Preiss T: Circular RNAs: Splicing's enigma variations. EMBO J. 32:923–925. 2013. View Article : Google Scholar : PubMed/NCBI

17 

Junn E, Lee KW, Jeong BS, Chan TW, Im JY and Mouradian MM: Repression of alpha-synuclein expression and toxicity by microRNA-7. Proc Natl Acad Sci USA. 106:13052–13057. 2009. View Article : Google Scholar : PubMed/NCBI

18 

Lukiw WJ: Circular RNA (circRNA) in Alzheimer's disease (AD). Front Genet. 4:3072013. View Article : Google Scholar : PubMed/NCBI

19 

Namgaladze D and Brüne B: Phospholipase A2-modified low-density lipoprotein activates the phosphatidylinositol 3-kinase-Akt pathway and increases cell survival in monocytic cells. Arterioscler Thromb Vasc Biol. 26:2510–2516. 2006. View Article : Google Scholar : PubMed/NCBI

20 

Northcott CA, Hayflick JS and Watts SW: PI3-kinase upregulation and involvement in spontaneous tone in arteries from DOCA-salt rats: Is p110delta the culprit? Hypertension. 43:885–890. 2004. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Mi T, Luo C, Hu Y, Qu C, Wang X, Guo S and Du Y: Spectrum construction of differentially expressed circular RNAs in patients with leukoaraiosis and function analysis of differentially expressed genes. Mol Med Rep 16: 2563-2569, 2017.
APA
Mi, T., Luo, C., Hu, Y., Qu, C., Wang, X., Guo, S., & Du, Y. (2017). Spectrum construction of differentially expressed circular RNAs in patients with leukoaraiosis and function analysis of differentially expressed genes. Molecular Medicine Reports, 16, 2563-2569. https://doi.org/10.3892/mmr.2017.6871
MLA
Mi, T., Luo, C., Hu, Y., Qu, C., Wang, X., Guo, S., Du, Y."Spectrum construction of differentially expressed circular RNAs in patients with leukoaraiosis and function analysis of differentially expressed genes". Molecular Medicine Reports 16.3 (2017): 2563-2569.
Chicago
Mi, T., Luo, C., Hu, Y., Qu, C., Wang, X., Guo, S., Du, Y."Spectrum construction of differentially expressed circular RNAs in patients with leukoaraiosis and function analysis of differentially expressed genes". Molecular Medicine Reports 16, no. 3 (2017): 2563-2569. https://doi.org/10.3892/mmr.2017.6871
Copy and paste a formatted citation
x
Spandidos Publications style
Mi T, Luo C, Hu Y, Qu C, Wang X, Guo S and Du Y: Spectrum construction of differentially expressed circular RNAs in patients with leukoaraiosis and function analysis of differentially expressed genes. Mol Med Rep 16: 2563-2569, 2017.
APA
Mi, T., Luo, C., Hu, Y., Qu, C., Wang, X., Guo, S., & Du, Y. (2017). Spectrum construction of differentially expressed circular RNAs in patients with leukoaraiosis and function analysis of differentially expressed genes. Molecular Medicine Reports, 16, 2563-2569. https://doi.org/10.3892/mmr.2017.6871
MLA
Mi, T., Luo, C., Hu, Y., Qu, C., Wang, X., Guo, S., Du, Y."Spectrum construction of differentially expressed circular RNAs in patients with leukoaraiosis and function analysis of differentially expressed genes". Molecular Medicine Reports 16.3 (2017): 2563-2569.
Chicago
Mi, T., Luo, C., Hu, Y., Qu, C., Wang, X., Guo, S., Du, Y."Spectrum construction of differentially expressed circular RNAs in patients with leukoaraiosis and function analysis of differentially expressed genes". Molecular Medicine Reports 16, no. 3 (2017): 2563-2569. https://doi.org/10.3892/mmr.2017.6871
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team