Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Molecular Medicine Reports
Join Editorial Board Propose a Special Issue
Print ISSN: 1791-2997 Online ISSN: 1791-3004
Journal Cover
August-2018 Volume 18 Issue 2

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
August-2018 Volume 18 Issue 2

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Fanconi anemia complementation group C protection against oxidative stress‑induced β‑cell apoptosis

  • Authors:
    • Sirikul Kulanuwat
    • Prapaporn Jungtrakoon
    • Watip Tangjittipokin
    • Pa‑Thai Yenchitsomanus
    • Nattachet Plengvidhya
  • View Affiliations / Copyright

    Affiliations: Siriraj Center of Research Excellence for Diabetes and Obesity, Faculty of Medicine Siriraj Hospital, Mahidol University, Bangkok 10700, Thailand
  • Pages: 2485-2491
    |
    Published online on: June 14, 2018
       https://doi.org/10.3892/mmr.2018.9163
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

Diabetes mellitus (DM) and other glucose metabolism abnormalities are commonly observed in individuals with Fanconi anemia (FA). FA causes an impaired response to DNA damage due to genetic defects in a cluster of genes encoded proteins involved in DNA repair. However, the mechanism by which FA is associated with DM has not been clearly elucidated. Fanconi anemia complementation group C (FANCC) is a component of FA nuclear clusters. Evidence suggests that cytoplasmic FANCC has a role in protection against oxidative stress‑induced apoptosis. As oxidative stress‑mediated β‑cell dysfunction is one of the contributors to DM pathogenesis, the present study aimed to investigate the role of FANCC in pancreatic β‑cell response to oxidative stress. Small interfering RNA‑mediated FANCC suppression caused a loss of protection against oxidative stress‑induced apoptosis, and that overexpression of FANCC reduced this effect in the human 1.1B4 β‑cell line. These findings were confirmed by Annexin V‑FITC/PI staining, caspase 3/7 activity assay, and expression levels of anti‑apoptotic and pro‑apoptotic genes. Insulin and glucokinase mRNA expression were also decreased in FANCC‑depleted 1.1B4 cells. The present study demonstrated the role of FANCC in protection against oxidative stress‑induced β‑cell apoptosis and established another mechanism that associates FANCC deficiency with β‑cell dysfunction. The finding that FANCC overexpression reduced β‑cell apoptosis advances the potential for an alternative approach to the treatment of DM caused by FANCC defects.

Introduction

Fanconi anemia (FA) is a genetic disorder that is caused by an abnormality in genes encoding Fanconi anemia proteins (FA proteins), which comprise a multi-protein nuclear complex that has an essential role in DNA inter-strand crosslink repair (1,2). Dysfunction of FA proteins leads to cytogenetic instability, chromosomal breakage, defective DNA repair and cellular hypersensitivity to DNA crosslinking agents (3), and these effects are known to cause developmental defects, bone marrow failure, aplastic anemia and increased cancer risk in individuals with FA (4–6). To a lesser extent, metabolic disorders associated with FA, including diabetes mellitus (DM), hyperglycemia and insulin disorders, have been reported in ~40% of patients with FA (7–9).

FA complementation group C (FANCC) is a component of the FA multiprotein nuclear complex (2). However, it has been demonstrated that instead of FANCC being an isoform targeted to the nucleus, FANCC localization in cytoplasm is essential for the correction of enhanced cytotoxicity of crosslinks in cells with predominant defects in the FANCC gene (10). Additionally, cytoplasmic FANCC has a role in prevention of oxidative DNA damage (11), and protection against oxidative stress-induced apoptosis (12). Reactive oxygen species (ROS) accumulation and cell apoptosis have been identified in many cell types with FANCC depletion. These cell types include hematopoietic progenitor cells, hepatocytes, and murine embryonic fibroblasts isolated from FA model mice (13–16). It was suggested that FANCC counteraction of oxidative stress is mediated through glutathione S-transferase P1 (GSTP1) and nicotinamide adenine dinucleotide phosphate-cytochrome P450 reductase (17,18). FANCC significantly increased the catalytic activity of GSTP1, which is an inducible antioxidant enzyme that has a major role in the intracellular defense of toxin and ROS (19). Fancc-/- cells were hypersensitive to oxidant stimuli and underwent enhanced oxidant-mediated apoptosis compared with the wild type controls as a result of oxidative stress activating the redox-dependent apoptosis signal-regulating kinase 1 pathway (15). Wang et al (20) reported that overexpression of FANCC protected hematopoietic progenitors from death induced by Fas-mediated apoptosis. A previous study demonstrated that FANCC associated with uncoordinated-5A protein, a pro-apoptotic dependent receptor, and delayed apoptosis in neuroblastoma SH-SY5Y cell line (21). These findings indicate that oxidative stress is a contributor to FA pathogenesis, and that FANCC is a key contributor to oxidative stress response mechanisms in various cell types.

Oxidative stress has also been implicated as an important factor in the progression of DM via interference with insulin signal transduction, insulin production and induction of β-cell apoptosis (22,23). Oxidative stress and DM are commonly observed in patients with FA, and high levels of ROS were detected in insulin-sensitive tissues of Fancc-/- mice (24). Furthermore, insulin receptor and insulin receptor substrate 1 tyrosine phosphorylation were impaired in Fancc knockout mice treated with tumor necrosis factor (TNF)-α compared with their wild-type littermates (24). It was concluded that defects in Fancc led to ROS accumulation in insulin target cells, thus interfering with the insulin signaling pathway, leading to insulin resistance (24).

While most studies in the literature focused on the actions of FANCC on signal transduction in insulin-responsive cells, none has explored the role of FANCC in β-cells with limited expression of antioxidant enzymes [reviewed by Robertson and Harmon (25)]. In the present study, it was hypothesized that depletion of FANCC causes pancreatic β-cell hypersensitivity to oxidative stress-induced apoptosis. Accordingly, the aim of the present study was to investigate the role of FANCC in pancreatic β-cell response to oxidative stress.

Materials and methods

Study approval

The present study was conducted at the Faculty of Medicine Siriraj Hospital, Mahidol University (Bangkok, Thailand). Siriraj Hospital is Thailand's largest university-based national tertiary referral center. The protocol for the present study was approved by the Siriraj Institutional Review Board (COA no. Si491/2014).

Cell culture

Human 1.1B4 pancreatic β-cell line (American Type Culture Collection, Manassas, VA, USA) was maintained in RPMI-1640 medium (Invitrogen; Thermo Fisher Scientific, Inc., Waltham, MA, USA) containing 10% fetal bovine serum (Gibco; Thermo Fisher Scientific, Inc.), 100 IU/ml penicillin, and 100 mg/ml streptomycin at 37°C in a 95% humidified atmosphere containing 5% CO2.

Small interfering RNA (siRNA) transfection

Human FANCC SMARTpool ON-TARGETplus siRNA (siRNA-FANCC; cat. no. L-011033-00-0005) and siRNA ON-TARGETplus Non-targeting Pool (siRNA-control; cat. no. D-001810-10-20) were purchased from Dharmacon (GE Healthcare; Dharmacon, Inc., Lafayette, CO, USA). The day prior to transfection, 1.6×105 cells/well were seeded into 6-well plates. Knockdown was performed at 24 and 48 h after seeding. siRNA-FANCC and siRNA-control were transfected at a concentration of 100 pmol using Lipofectamine® 2000 Transfection Reagent (Invitrogen; Thermo Fisher Scientific, Inc.) according to the manufacturer's protocol. At 48 h after transfection, the cells were harvested and FANCC expression levels were determined by western blot analysis.

Plasmid construct and transfection

To generate FANCC recombinant plasmids, FANCC coding sequence NM_000136.2 and FLAG-tag sequence DYKDDDDK were amplified with the following primer sequences: Forward, 5′-CGGGATCCATGGCTCAAGATTCAGTAG-3′ and reverse, 5′-GCTCTAGACTACTTATCGTCGTCATCCTTGTAATCGACTTGAGTTCGCAGCTCTTTAAGG-3′. The product was cloned into pcDNA3.1 plasmids (Invitrogen; Thermo Fisher Scientific, Inc.). All plasmids were amplified in Escherichia coli (DH5α) and purified using QIAamp DNA Mini Kit (Qiagen GmbH, Hilden, Germany). The day prior to transfection, 2×105 cells/well were seeded into 6-well plates. After 24 h, the cells were transfected with 500 ng FANCC-constructed plasmid or pcDNA3.1 empty plasmid using the same conditions as the ones described for siRNA transfection. At 48 h after transfection, the cells were harvested and FANCC protein expression levels were determined by western blot analysis.

RNA isolation and RT-qPCR

Total RNA from 1.1B4 cells (5×105) was isolated using TRIzol Reagent (Invitrogen; Thermo Fisher Scientific, Inc.). Subsequently, RNA was reverse transcribed into cDNA using a RevertAid First Strand cDNA Synthesis Kit (Thermo Fisher Scientific, Inc.) Gene-specific primer pairs were designed using Primer3Plus program (www.bioinformatics.nl/cgi-bin/primer3plus/primer3plus.cgi) or derived from previous studies (26–28). All primers (Table I) were checked against National Center for Biotechnology Information Primer-BLAST. RT-qPCR was performed in a LightCycler 480 Instrument (Roche Diagnostics GmbH, Mannheim, Germany) using LightCycler® 480 SYBR Green I Master (Roche Diagnostics GmbH). Initial enzyme activation proceeded at 95°C for 10 min, followed by 45 cycles at 95°C for 30 sec, 60–62°C for 20 sec, and 72°C for 20 sec. β-actin was used as an internal control to normalize input cDNA. Relative mRNA expression levels were calculated using the 2-ΔΔCq method (29). All assays were performed in triplicate.

Table I.

Primers and conditions for reverse transcription-quantitative polymerase chain reaction.

Table I.

Primers and conditions for reverse transcription-quantitative polymerase chain reaction.

First author, yearGenePrimer (5′-3′)Annealing temperature (°C)Product size (bp)(Refs.)
Present studyFANCC (NM_000136)F: TCATCGCTGCCTCAAGC62352–
R: GGAACCAGCTCTAAAGGG
Robertson, 2007GCK (NM_033508)F: TGGACCAAGGGCTTCAAGGCC60207(25)
R: CATGTAGCAGGCATTGCAGCC
Robertson, 2007INS (NM_000207)F: TACCAGCATCTGCTCCCTCT60120(25)
R: TGCTGGTTCAAGGGCTTTAT
Vasu, 2013BCL-2 (NM_000657)F: TTTGAGTTCGGTGGGGTCAT62275(26)
R: TGACTTCACTTGTGGCCCAG
Vasu, 2013BAX (NM_138763)F: TGGCAGCTGACATGTTTTCTGAC62195(26)
R: TCACCCAACCACCCTGGTCTT
Floros, 2006DKK1 (NM_012242)F: TCACGCTATGTGCTGCCCCG62223(27)
R: TGAGGCACAGTCTGATGACCGGA
Present studyβ-actin (NM_001101)F: AGAAAATCTGGCACCACACC62395–
R: CTCCTTAATGTCACGCACGA

[i] FANCC, Fanconi anemia complementation group C; F, forward; R, reverse; GCK, glucokinase; INS, insulin; BCL2, BCL2 apoptosis regulator; BAX, BCL2 associated X, apoptosis regulator; DKK1, dickkopf WNT signaling pathway inhibitor 1.

Western blot analysis

Total protein was extracted by lysing cells in radioimmunoprecipitation assay lysis buffer (Thermo Fisher Scientific Inc.). Protein concentrations were quantified by Bradford protein assay (Bio-Rad Laboratories, Inc., Hercules, CA, USA) using a NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific, Inc.). Proteins (50–100 µg) were separated onto 10% SDS polyacrylamide gel, and then electroblotted onto nitrocellulose membrane (Bio-Rad Laboratories, Inc.) using a semi-dry electrophoretic transfer cell (Bio-Rad Laboratories, Inc.). Primary goat polyclonal antibody against human FANCC (C-14; cat. no. sc-18110; 1:500; Santa Cruz Biotechnology Inc., Dallas, TX, USA), mouse monoclonal antibody against FLAG-tag (1:2,000; cat. no. F3165; Sigma-Aldrich; Merck KGaA, Darmstadt, Germany), and mouse monoclonal antibody against β-actin (1:1,000; cat. no. s-47778; Santa Cruz Biotechnology, Inc.) were incubated with the membranes for 2 h at room temperature. Following this, membranes were incubated with horseradish peroxidase-linked rabbit anti-goat or goat anti-mouse secondary antibody (1:1,000; cat. no. P044701-2; Dako; Agilent Technologies, Inc., Santa Clara, CA, USA) for 1 h at room temperature. Binding antibodies were visualized using an enhanced chemiluminescence detection kit (SuperSignal West Pico PLUS Chemiluminescent Substrate; Roche Diagnostics GmbH), and bands were detected by biomolecular imager (ImageQuant LAS 4010; GE Healthcare Life Sciences, Little Chalfont, UK). β-actin staining was used as an internal control in all experiments. Expressed bands were quantified by computer-assisted scanning densitometry using ImageJ version 1.4.3.x (National Institutes of Health, Bethesda, MD, USA).

Flow cytometry

Following knockdown or overexpression of FANCC in 1.1B4 β-cells for 48 h, 1.4×106 cells were treated with 0.5 mM H2O2 for 4 h. Subsequently, Annexin V-fluorescein isothiocyanate (FITC) and propidium iodide (PI) staining was performed using Annexin V-FITC/PI Apoptosis Detection Kit (ImmunoTools GmbH, Friesoythe, Germany) according to the manufacturer's protocol. Apoptosis was analyzed using a BD FACSVerse flow cytometer (BD Biosciences, San Jose, CA, USA) and FlowJo software version 10.4 (FlowJo LLC, Ashland, OR, USA). Each experiment was independently performed three times.

Caspase activity

Luminescent type Caspase-Glo 3/7 Assay (Promega Corporation, Madison, WI, USA) was used to measure caspase 3/7 activity. Cells were seeded in a Corning 96-well white flat bottom plate (Corning Life Sciences, Tewksbury, MA, USA) at 8×103 and 1×104 cells per well for knockdown and overexpression, respectively. Following 24 h, the cells were transfected with 500 ng plasmids (FANCC-pcDNA3.1 or empty vector) or 100 pmol siRNA (siRNA-FANCC or siRNA-control). In order to increase the population of cells successfully transfected with either FANCC-pcDNA3.1, empty vector, siRNA-FANCC or siRNA-control, the transfected cells were transfected twice with the same type and amount of plasmid 24 h after initial transfection. At 24 h after the second transfection, cells were treated with 0.5 mM H2O2 for 4 h. Following this, 100 µl Caspase-Glo 3/7 Reagent (Promega Corporation) was added into each well. The plate was then shaken at 300 to 500 rpm in a dark room for 30 min at room temperature (~25°C). Luminescence was measured using a multi-detection microplate reader (Synergy H1; BioTek Instruments, Inc., Winooski, VT, USA).

Statistical analysis

Data analysis was performed using SPSS Statistics version 18.0 (SPSS, Inc., Chicago, IL, USA). Student's t-test was used to evaluate differences of the mean ± standard error of the mean. P<0.05 was considered to indicate a statistically significant difference.

Results

Increased apoptosis of FANCC-deficient β-cells

In order to investigate the role of FANCC in β-cell response to oxidative stress, FANCC-depleted 1.1b4 cells were generated via siRNA-mediated transient silencing. Knockdown efficiency is demonstrated in Fig. 1A. The results demonstrated that FANCC knockdown cells exhibited increased apoptosis compared with si-control cells, in non-induced and H2O2-induced oxidative stress conditions (Fig. 1B-D). In non-induced condition, Annexin V-FITC/PI staining revealed 12.6 and 1.6% of control cells to be in late and early apoptotic states, respectively; while, 13.6 and 5.3% of FANCC knockdown cells were in late and early apoptotic states, respectively (Fig. 1B, left). Under H2O2-induced oxidative stress induction, 19.9 and 2.7% of control cells were in late and early apoptotic states, respectively, while 24.9 and 6.7% of FANCC knockdown cells were in late and early apoptotic states, respectively (Fig. 1B, right). Overall, in non-induced condition, ~14.2 and ~18.9% of control cells and FANCC knockdown cells, respectively, were apoptotic (P<0.05). Under oxidative stress induction, the percentage of apoptotic cells in control cells and FANCC knockdown cells increased to 22.6 and 31.3%, respectively (P<0.01; Fig. 1C). Caspase 3/7 activities of FANCC knockdown cells were 1.33-fold and 1.43-fold higher than control cells under non-induced and H2O2-induced oxidative stress conditions, respectively (P<0.01 and P<0.001, respectively; Fig. 1D).

Figure 1.

Knockdown of FANCC increases β-cell apoptosis. (A) Representative western blot images demonstrating the successful knockdown of FANCC in 1.1B4 β-cells. (B) Annexin V-FITC/propidium iodide staining was used to analyze apoptotic cells by flow cytometry and (C) quantify the percentage of apoptotic cells. (D) Caspase 3/7 activity in FANCC knockdown cells normalized to the corresponding si-control group. Data are presented as the mean ± standard error. *P<0.05, **P<0.01, ***P<0.001 vs. si-control. FANCC, Fanconi anemia complementation group C; si, small interfering RNA; FITC, fluorescein isothiocyanate.

Overexpression of FANCC protects β-cells from oxidative stress-induced apoptosis

To further elucidate the effect of FANCC in attenuating β-cell apoptosis, plasmid construct for FANCC overexpression was transfected into 1.1B4 β-cells, and the percentage of apoptosis in cells overexpressing FANCC was investigated. Annexin V-FITC/PI staining (Fig. 2A and B) demonstrated that 1.1B4 β-cells overexpressing FANCC had lower total percentage of apoptotic cells than control cells transfected with empty vector (22.5 vs. 25.1%, respectively; P=0.067). Additionally, under oxidative stress induction, the percentage of apoptotic cells in 1.1B4 β-cells overexpressing FANCC was significantly lower than that of control cells transfected with empty vector (25.7 vs. 32.2%, respectively; P<0.05; Fig. 2C). In addition, 1.1B4 β-cells overexpressing FANCC had lower caspase 3/7 activity compared to control cells (0.75-fold; P<0.05) under H2O2-induced oxidative stress conditions (Fig. 2D). However, the significant protective effect of FANCC against apoptosis was not observed in non-induced condition.

Figure 2.

Overexpression of FANCC protects 1.1b4 β-cells from apoptosis following treatment with H2O2. (A) Representative western blot images illustrating the successful transfection with FLAG-tagged FANCC plasmid. (B) Annexin V-FITC/PI staining was used to analyze apoptotic cells by flow cytometry and (C) quantify the percentage of apoptotic cells. (D) Caspase 3/7 activity following transfection with FANCC plasmid normalized to the corresponding empty vector group. Data are presented as the mean ± standard error. *P<0.05 vs. empty vector. FANCC, Fanconi anemia complementation group C; si, small interfering RNA; FITC, fluorescein isothiocyanate.

Depletion of FANCC alters expression of genes involved in insulin expression, secretion and apoptosis pathways

To confirm the anti-apoptotic effect of FANCC in the human β-cell line, the expression of anti-apoptotic [BCL2 apoptosis regulator (BCL-2)] and pro-apoptotic genes [BCL2 associated X, apoptosis regulator (BAX)] were investigated. The results demonstrated that in FANCC-deficient 1.1b4 β-cells, BCL-2 mRNA expression decreased by 2.59 fold (P<0.001), while BAX mRNA level increased by 1.93 fold (P<0.01), compared to the expressions of control cells (Fig. 3). Depletion of FANCC also led to a 3.15-fold increase in dickkopf WNT signaling pathway inhibitor 1 (DKK1) expression (P<0.01). As DKK1 encodes a negative regulator of Wnt signaling, a pathway implicated in β-cell apoptotic defenders (30), increased DKK1 expression level in FANCC-deficient cells thereby reaffirms the crucial role of FANCC in protection against β-cell apoptosis. Notably, the expression levels of insulin (INS) and glucokinase (GCK) genes, which are critical for insulin synthesis and secretion, were decreased [0.77-fold (P<0.01) and 0.82-fold (P<0.05), respectively] compared to cells transfected with siRNA-control.

Figure 3.

Up and downregulation of genes involved in insulin (GCK, INS) and apoptosis pathways (DKK1, BAX, BCL2) investigated in FANCC-depleted 1.1B4 β-cells, as measured by reverse transcription-quantitative polymerase chain reaction experiments. Data are presented as mRNA expression fold change (mean ± standard error) in FANCC-depleted cells relative to cells expressing siRNA-control. *P<0.05, **P<0.01, ***P<0.001 vs. si-RNA control. FANCC, Fanconi anemia complementation group C; siRNA, small interfering RNA; GCK, glucokinase; INS, insulin; DKK1, dickkopf WNT signaling pathway inhibitor 1; BAX, BCL2 associated X, apoptosis regulator; BCL2, BCL2 apoptosis regulator.

Discussion

DM and abnormalities of glucose and insulin metabolism are common among patients with FA (7–9). However, little is known regarding the role of FA proteins in maintenance of glucose homeostasis. While previous studies focused on the link between ROS accumulation and insulin resistance in FANCC-deficient state (24), the results of the current study provide evidence linking FANCC insufficiency to DM via deterioration of β-cell ability to defend against oxidative stress-induced apoptosis.

Pancreatic β-cells have inherently low levels of antioxidants (31), which may be due to the need to maintain a low level of ROS to facilitate insulin production. Accordingly, this specialized cell type is extremely susceptible to oxidative stress. Previous studies addressed the deleterious effects of oxidative stress on β-cell function and survival (24,32), and a link between inability of β-cells to adequately secrete insulin and the development of type 2 DM was demonstrated (33,34). Furthermore, hypersensitivity to oxidative agents and enhancement of oxidant-mediated apoptosis were evident in FANCC-deficient cells isolated from mice (35). In addition, Zhang et al (36) demonstrated that TNF-α-induced senescence was associated with the accumulation of ROS and oxidative DNA damage in Fancc−/− mice compared with wild-type littermates. In the present study, the role of FANCC in antioxidant defense mechanisms of the human 1.1b4 β-cell line was investigated. It was also demonstrated that without H2O2-induced oxidative stress, siRNA-mediated FANCC suppression led to a significant increase in β-cell apoptosis, while transient overexpression of FANCC decreased β-cell apoptosis. However, the significant protective effect of FANCC overexpression and empty vector against apoptosis was not observed in non-induced conditions. This may be due to the presence of endogenous FANCC expression in 1.1b4 cells, which may have been sufficient enough to prevent apoptosis in physiological conditions. These results suggest the necessity of a physiological level of FANCC as a requirement for β-cell survival. Under oxidative stress-induced conditions, apoptosis was more pronounced in FANCC-depleted cells, while FANCC-overexpressed cells were resistant to H2O2-induced oxidative stress. These data reaffirm the critical role of FANCC in protection against oxidative stress-induced β-cell apoptosis. However, the data indicated a minor increase of apoptosis level in FANCC knockdown cells as compared with control cells. Potentially, other pathways besides FANCC are involved in cell apoptosis or there may be compensatory mechanisms that counteract the apoptosis. Additionally, the increased or decrease in caspase 3/7 activities were marginal, although statistically significant. BCL2 expression was decreased and BAX expression was increased >2-fold in FANCC knockdown cells compared with controls. The difference in apoptotic indicator expression is not surprising, as BCL2 and BAX were detected at the mRNA level while caspase 3/7 activity was determined at the protein level; furthermore, numerous molecules and signaling pathways are involved. However, it can be concluded that lack of FANCC increases caspase 3/7 activity, increases BAX and decreases BCL-2 RNA level.

Although a comprehensive and conclusive mechanism that explains how FANCC facilitates β-cell survival was not elucidated in the present study, the finding that DKK1 expression level was increased in FANCC-depleted β-cells suggests the possibility of Wnt signal transduction involvement, which required further investigation. DKK1 is known to be a Wnt signaling antagonist that sequesters Wnt receptors (30,37). Upregulation of DKK1 inhibits Wnt signal transduction, thus promoting apoptosis (38), and DKK1 upregulation was observed in FANCC-depleted cells (39). FANCC forms a complex with C-terminal-binding protein-1 and β-catenin, and acts as a transcriptional repressor that directly inhibits DKK1 expression (40). It is, therefore, possible that FANCC modulates DKK1 expression via nuclear activity. The exact mechanism by which FANCC regulates DKK1 requires further investigation.

In addition to loss of protection against oxidative stress-induced apoptosis in FANCC-depleted 1.1B4 β-cells, the expression of genes involved in insulin synthesis (such as, INS), a key hormone for regulating glucose uptake into peripheral cells, and secretion (such as, GCK), a rate-limiting enzyme in glycolysis that is a sensor of glucose-stimulated insulin secretion (41), was decreased. Reduction in INS and GCK expression is common in pancreatic β-cells exposed to oxidative stress, and in islets isolated from DM subjects (42–44). Taken together, the data from the present study reveal an association between FANCC depletion and loss of oxidative defense in pancreatic β-cells and reduction in insulin production (Fig. 4). Furthermore, the mechanism underpinning the association of FANCC knockdown with upregulation of DKK1 in human β-cells will be explored in future studies. These findings may explain the development of DM and abnormal glucose metabolism in patients with FA (7). Finally, the finding that FANCC overexpression reduced β-cell apoptosis advances the possibility of an alternative approach to the treatment of DM caused by FANCC defects.

Figure 4.

Schematic diagram illustrating the mechanistic link between FANCC-depleted cells and diabetes mellitus in 1.1B4 human pancreatic β-cells. FANCC, Fanconi anemia complementation group C; DKK1, dickkopf WNT signaling pathway inhibitor 1; INS, insulin; GCK, glucokinase; BCL2, BCL2 apoptosis regulator; BAX, BCL2 associated X, apoptosis regulator.

Acknowledgements

We thank the members of Siriraj Center of Research Excellence for Diabetes and Obesity (SiCORE-DO) for their assistance.

Funding

The present study was supported by Mahidol University Grant, Siriraj Research Grant for Research and Development, Faculty of Medicine, Siriraj Hospital R015810001 (to NP), Thailand Research Fund IRG5980006 (to PY), Mahidol University Postdoctoral Fellowship Grant (to SK) and Chalermprakiat Grants and Research Fund (R016034011) from the Faculty of Medicine Siriraj Hospital (to PJ and PY).

Availability of data and materials

The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.

Authors' contributions

SK, PTY and NP conceived and designed the study. SK performed the cell experiments and molecular biology analysis. PJ and WT analyzed and interpreted the data. SK was a major contributor in writing the manuscript. All authors read and approved the final manuscript.

Ethics approval and consent to participate

Not applicable.

Patient consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

References

1 

Pagano G and Youssoufian H: Fanconi anaemia proteins: Major roles in cell protection against oxidative damage. Bioessays. 25:589–595. 2003. View Article : Google Scholar : PubMed/NCBI

2 

Pace P, Johnson M, Tan WM, Mosedale G, Sng C, Hoatlin M, de Winter J, Joenje H, Gergely F and Patel KJ: FANCE: The link between Fanconi anaemia complex assembly and activity. EMBO J. 21:3414–3423. 2002. View Article : Google Scholar : PubMed/NCBI

3 

Kalb R, Neveling K, Nanda I, Schindler D and Hoehn H: Fanconi anemia: Causes and consequences of genetic instability. Genome Dyn. 1:218–242. 2006. View Article : Google Scholar : PubMed/NCBI

4 

Bagby GC Jr: Genetic basis of Fanconi anemia. Curr Opin Hemato. 10:68–76. 2003. View Article : Google Scholar

5 

de Winter JP and Joenje H: The genetic and molecular basis of Fanconi anemia. Mutat Res. 668:11–19. 2009. View Article : Google Scholar : PubMed/NCBI

6 

Mathew CG: Fanconi anaemia genes and susceptibility to cancer. Oncogene. 25:5875–5884. 2006. View Article : Google Scholar : PubMed/NCBI

7 

Elder DA, D'Alessio DA, Eyal O, Mueller R, Smith FO, Kansra AR and Rose SR: Abnormalities in glucose tolerance are common in children with fanconi anemia and associated with impaired insulin secretion. Pediatr Blood Cancer. 51:256–260. 2008. View Article : Google Scholar : PubMed/NCBI

8 

Swift M, Sholman L and Gilmour D: Diabetes mellitus and the gene for Fanconi's anemia. Science. 178:308–310. 1972. View Article : Google Scholar : PubMed/NCBI

9 

Giri N, Batista DL, Alter BP and Stratakis CA: Endocrine abnormalities in patients with Fanconi anemia. J Clin Endocrinol Metab. 92:2624–2631. 2007. View Article : Google Scholar : PubMed/NCBI

10 

Youssoufian H: Localization of Fanconi anemia C protein to the cytoplasm of mammalian cells. Proc Natl Acad Sci USA. 91:7975–7979. 1994. View Article : Google Scholar : PubMed/NCBI

11 

Lackinger D, Ruppitsch W, Ramirez MH, Hirsch-Kauffmann M and Schweiger M: Involvement of the Fanconi anemia protein FA-C in repair processes of oxidative DNA damages. FEBS Lett. 440:103–106. 1998. View Article : Google Scholar : PubMed/NCBI

12 

Youssoufian H: Cytoplasmic localization of FAC is essential for the correction of a prerepair defect in Fanconi anemia group C cells. J Clin Inves. 97:2003–2010. 1996. View Article : Google Scholar

13 

Cumming RC, Liu JM, Youssoufian H and Buchwald M: Suppression of apoptosis in hematopoietic factor-dependent progenitor cell lines by expression of the FAC gene. Blood. 88:4558–4567. 1996.PubMed/NCBI

14 

Hadjur S, Ung K, Wadsworth L, Dimmick J, Rajcan-Separovic E, Scott RW, Buchwald M and Jirik FR: Defective hematopoiesis and hepatic steatosis in mice with combined deficiencies of the genes encoding Fancc and Cu/Zn superoxide dismutase. Blood. 98:1003–1011. 2001. View Article : Google Scholar : PubMed/NCBI

15 

Saadatzadeh MR, Bijangi-Vishehsaraei K, Hong P, Bergmann H and Haneline LS: Oxidant hypersensitivity of Fanconi anemia type C-deficient cells is dependent on a redox-regulated apoptotic pathway. J Biol Chem. 279:16805–16812. 2004. View Article : Google Scholar : PubMed/NCBI

16 

Rathbun RK, Faulkner GR, Ostroski MH, Christianson TA, Hughes G, Jones G, Cahn R, Maziarz R, Royle G, Keeble W, et al: Inactivation of the Fanconi anemia group C gene augments interferon-gamma-induced apoptotic responses in hematopoietic cells. Blood. 90:974–985. 1997.PubMed/NCBI

17 

Cumming RC, Lightfoot J, Beard K, Youssoufian H, O'Brien PJ and Buchwald M: Fanconi anemia group C protein prevents apoptosis in hematopoietic cells through redox regulation of GSTP1. Nat Med. 7:814–820. 2001. View Article : Google Scholar : PubMed/NCBI

18 

Kruyt FA, Hoshino T, Liu JM, Joseph P, Jaiswal AK and Youssoufian H: Abnormal microsomal detoxification implicated in Fanconi anemia group C by interaction of the FAC protein with NADPH cytochrome P450 reductase. Blood. 92:3050–3056. 1998.PubMed/NCBI

19 

Pinkus R, Weiner LM and Daniel V: Role of quinone-mediated generation of hydroxyl radicals in the induction of glutathione S-transferase gene expression. Biochemistry. 34:81–88. 1995. View Article : Google Scholar : PubMed/NCBI

20 

Wang J, Otsuki T, Youssoufian H, Foe JL, Kim S, Devetten M, Yu J, Li Y, Dunn D and Liu JM: Overexpression of the fanconi anemia group C gene (FAC) protects hematopoietic progenitors from death induced by Fas-mediated apoptosis. Cancer Res. 58:3538–3541. 1998.PubMed/NCBI

21 

Huang F, Ben Aissa M, Magron A, Huard CC, Godin C, Lévesque G and Carreau M: The Fanconi anemia group C protein interacts with uncoordinated 5A and delays apoptosis. PLoS One. 9:e928112014. View Article : Google Scholar : PubMed/NCBI

22 

Rains JL and Jain SK: Oxidative stress, insulin signaling, and diabetes. Free Radic Biol Med. 50:567–575. 2011. View Article : Google Scholar : PubMed/NCBI

23 

Bloch-Damti A and Bashan N: Proposed mechanisms for the induction of insulin resistance by oxidative stress. Antioxid Redox Signal. 7:1553–1567. 2005. View Article : Google Scholar : PubMed/NCBI

24 

Li J, Sipple J, Maynard S, Mehta PA, Rose SR, Davies SM and Pang Q: Fanconi anemia links reactive oxygen species to insulin resistance and obesity. Antioxid Redox Signal. 17:1083–1098. 2012. View Article : Google Scholar : PubMed/NCBI

25 

Robertson RP and Harmon JS: Pancreatic islet beta-cell and oxidative stress: The importance of glutathione peroxidase. FEBS Lett. 581:3743–3748. 2007. View Article : Google Scholar : PubMed/NCBI

26 

Vasu S, McClenaghan NH, McCluskey JT and Flatt PR: Cellular responses of novel human pancreatic β-cell line, 1.1B4 to hyperglycemia. Islets. 5:170–177. 2013. View Article : Google Scholar : PubMed/NCBI

27 

Floros KV, Thomadaki H, Florou D, Talieri M and Scorilas A: Alterations in mRNA expression of apoptosis-related genes BCL2, BAX, FAS, caspase-3, and the novel member BCL2L12 after treatment of human leukemic cell line HL60 with the antineoplastic agent etoposide. Ann N Y Acad Sci. 1090:89–97. 2006. View Article : Google Scholar : PubMed/NCBI

28 

Zhou Y, Li W, Xu Q and Huang Y: Elevated expression of Dickkopf-1 increases the sensitivity of human glioma cell line SHG44 to BCNU. J Exp Clin Cancer Res. 29:1312010. View Article : Google Scholar : PubMed/NCBI

29 

Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods. 25:402–408. 2001. View Article : Google Scholar : PubMed/NCBI

30 

Niida A, Hiroko T, Kasai M, Furukawa Y, Nakamura Y, Suzuki Y, Sugano S and Akiyama T: DKK1, a negative regulator of Wnt signaling, is a target of the beta-catenin/TCF pathway. Oncogene. 23:8520–8526. 2004. View Article : Google Scholar : PubMed/NCBI

31 

Tiedge M, Lortz S, Drinkgern J and Lenzen S: Relation between antioxidant enzyme gene expression and antioxidative defense status of insulin-producing cells. Diabetes. 46:1733–1742. 1997. View Article : Google Scholar : PubMed/NCBI

32 

Keane KN, Cruzat VF, Carlessi R, de Bittencourt PI Jr and Newsholme P: Molecular events linking oxidative stress and inflammation to insulin resistance and β-cell dysfunction. Oxid Med Cell Longev. 2015:1816432015. View Article : Google Scholar : PubMed/NCBI

33 

Maechler P, Jornot L and Wollheim CB: Hydrogen peroxide alters mitochondrial activation and insulin secretion in pancreatic beta cells. J Biol Chem. 274:27905–27913. 1999. View Article : Google Scholar : PubMed/NCBI

34 

Zraika S, Aston-Mourney K, Laybutt DR, Kebede M, Dunlop ME, Proietto J and Andrikopoulos S: The influence of genetic background on the induction of oxidative stress and impaired insulin secretion in mouse islets. Diabetologia. 49:1254–1263. 2006. View Article : Google Scholar : PubMed/NCBI

35 

Bijangi-Vishehsaraei K, Saadatzadeh MR, Werne A, McKenzie KA, Kapur R, Ichijo H and Haneline LS: Enhanced TNF-alpha-induced apoptosis in Fanconi anemia type C-deficient cells is dependent on apoptosis signal-regulating kinase 1. Blood. 106:4124–4130. 2005. View Article : Google Scholar : PubMed/NCBI

36 

Zhang X, Sejas DP, Qiu Y, Williams DA and Pang Q: Inflammatory ROS promote and cooperate with the Fanconi anemia mutation for hematopoietic senescence. J Cell Sci. 120:1572–1583. 2007. View Article : Google Scholar : PubMed/NCBI

37 

Zhang QG, Wang R, Khan M, Mahesh V and Brann DW: Role of Dickkopf-1, an antagonist of the Wnt/beta-catenin signaling pathway, in estrogen-induced neuroprotection and attenuation of tau phosphorylation. J Neurosci. 28:8430–8441. 2008. View Article : Google Scholar : PubMed/NCBI

38 

Gui S, Yuan G, Wang L, Zhou L, Xue Y, Yu Y, Zhang J, Zhang M, Yang Y and Wang DW: Wnt3a regulates proliferation, apoptosis and function of pancreatic NIT-1 beta cells via activation of IRS2/PI3K signaling. J Cell Biochem. 114:1488–1497. 2013. View Article : Google Scholar : PubMed/NCBI

39 

Huard CC, Tremblay CS, Helsper K, Delisle MC, Schindler D, Lévesque G and Carreau M: Fanconi anemia proteins interact with CtBP1 and modulate the expression of the Wnt antagonist Dickkopf-1. Blood. 121:1729–1739. 2013. View Article : Google Scholar : PubMed/NCBI

40 

Huard CC, Tremblay CS, Magron A, Lévesque G and Carreau M: The Fanconi anemia pathway has a dual function in Dickkopf-1 transcriptional repression. Proc Natl Acad Sci USA. 111:2152–2157. 2014. View Article : Google Scholar : PubMed/NCBI

41 

Gloyn AL, Odili S, Buettger C, Njolstad PR, Shiota C, Matschinsky FM and Magnuson MA: Glucokinase and Glycemic Disease: From Basics to Novel Therapeutics. 16. Karger; Basel: pp. 92–109. 2004

42 

Vasu S, McClenaghan NH and Flatt PR: Molecular mechanisms of toxicity and cell damage by chemicals in a human pancreatic beta cell line, 1.1B4. Pancreas. 45:1320–1329. 2016. View Article : Google Scholar : PubMed/NCBI

43 

Iype T, Francis J, Garmey JC, Schisler JC, Nesher R, Weir GC, Becker TC, Newgard CB, Griffen SC and Mirmira RG: Mechanism of insulin gene regulation by the pancreatic transcription factor Pdx-1: Application of pre-mRNA analysis and chromatin immunoprecipitation to assess formation of functional transcriptional complexes. J Biol Chem. 280:16798–16807. 2005. View Article : Google Scholar : PubMed/NCBI

44 

Zhang C, Moriguchi T, Kajihara M, Esaki R, Harada A, Shimohata H, Oishi H, Hamada M, Morito N, Hasegawa K, et al: MafA is a key regulator of glucose-stimulated insulin secretion. Mol Cell Biol. 25:4969–4976. 2005. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Kulanuwat S, Jungtrakoon P, Tangjittipokin W, Yenchitsomanus PT and Plengvidhya N: Fanconi anemia complementation group C protection against oxidative stress‑induced β‑cell apoptosis. Mol Med Rep 18: 2485-2491, 2018.
APA
Kulanuwat, S., Jungtrakoon, P., Tangjittipokin, W., Yenchitsomanus, P., & Plengvidhya, N. (2018). Fanconi anemia complementation group C protection against oxidative stress‑induced β‑cell apoptosis. Molecular Medicine Reports, 18, 2485-2491. https://doi.org/10.3892/mmr.2018.9163
MLA
Kulanuwat, S., Jungtrakoon, P., Tangjittipokin, W., Yenchitsomanus, P., Plengvidhya, N."Fanconi anemia complementation group C protection against oxidative stress‑induced β‑cell apoptosis". Molecular Medicine Reports 18.2 (2018): 2485-2491.
Chicago
Kulanuwat, S., Jungtrakoon, P., Tangjittipokin, W., Yenchitsomanus, P., Plengvidhya, N."Fanconi anemia complementation group C protection against oxidative stress‑induced β‑cell apoptosis". Molecular Medicine Reports 18, no. 2 (2018): 2485-2491. https://doi.org/10.3892/mmr.2018.9163
Copy and paste a formatted citation
x
Spandidos Publications style
Kulanuwat S, Jungtrakoon P, Tangjittipokin W, Yenchitsomanus PT and Plengvidhya N: Fanconi anemia complementation group C protection against oxidative stress‑induced β‑cell apoptosis. Mol Med Rep 18: 2485-2491, 2018.
APA
Kulanuwat, S., Jungtrakoon, P., Tangjittipokin, W., Yenchitsomanus, P., & Plengvidhya, N. (2018). Fanconi anemia complementation group C protection against oxidative stress‑induced β‑cell apoptosis. Molecular Medicine Reports, 18, 2485-2491. https://doi.org/10.3892/mmr.2018.9163
MLA
Kulanuwat, S., Jungtrakoon, P., Tangjittipokin, W., Yenchitsomanus, P., Plengvidhya, N."Fanconi anemia complementation group C protection against oxidative stress‑induced β‑cell apoptosis". Molecular Medicine Reports 18.2 (2018): 2485-2491.
Chicago
Kulanuwat, S., Jungtrakoon, P., Tangjittipokin, W., Yenchitsomanus, P., Plengvidhya, N."Fanconi anemia complementation group C protection against oxidative stress‑induced β‑cell apoptosis". Molecular Medicine Reports 18, no. 2 (2018): 2485-2491. https://doi.org/10.3892/mmr.2018.9163
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team