Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Molecular Medicine Reports
Join Editorial Board Propose a Special Issue
Print ISSN: 1791-2997 Online ISSN: 1791-3004
Journal Cover
July-2019 Volume 20 Issue 1

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
July-2019 Volume 20 Issue 1

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Effect of copper nanoparticles on brain cytochrome P450 enzymes in rats

  • Authors:
    • Yanyan Wang
    • Huaqiao Tang
    • Min Xu
    • Jie Luo
    • Ling Zhao
    • Fei Shi
    • Gang Ye
    • Cheng Lv
    • Yinglun Li
  • View Affiliations / Copyright

    Affiliations: Department of Pharmacy, School of Animal Medicine, Sichuan Agricultural University, Chengdu, Sichuan 611130, P.R. China
  • Pages: 771-778
    |
    Published online on: May 27, 2019
       https://doi.org/10.3892/mmr.2019.10302
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

The aim of the present study was to evaluate the long‑term effect of copper nanoparticles (CuNPs) on cytochrome P450 (CYP450) enzymes in the rat brain. Rats were repeatedly gavaged with different forms of copper sources for 28 days, and the levels of oxidative stress and CYP450 mRNA and protein expression in the rat brain were subsequently analyzed. The results demonstrated that a high dose of CuNPs (200 mg/kg) induced severe oxidative stress in the rat brain along with a decrease in the levels of total superoxide dismutase and glutathione, and an increase in hydroxyl radicals and malondialdehyde. A medium dose of CuNPs reduced CYP450 2C11 and CYP450 3A1 protein expression in the rat brain, whereas high doses of CuNPs resulted in decreased expression of most CYP450 enzyme proteins, and inhibition of pregnane X receptor and constitutive androstane receptor expression. The results suggested that CuNPs may inhibit CYP450 enzyme expression by increasing the levels of oxidative stress and decreasing the expression of nuclear receptors in the rat brain, which affects the metabolism of drugs and endogenous hormones in the brain.

Introduction

With the rapid development and widespread application of nanomaterials, the health impact of nanomaterial exposure has attracted increasing attention. Copper nanoparticles (CuNPs) have a number of desirable properties, including a large surface area, ductility, and excellent optical, electrical, catalytic and antimicrobial properties. Therefore, they have been widely used in lithium ion batteries (1), lubricant oil, ceramics (2), polymers/plastics, inks, metallics, coatings, osteoporosis treatment drugs, drug delivery, intrauterine contraceptive devices, and additives to livestock and poultry feed (3–6). However, numerous studies have indicated that the gastrointestinal system, liver and kidney are sensitive targets of copper toxicity following oral exposure beyond the range of biological tolerance (7). The symptoms of copper poisoning are drowsiness and anorexia in the early stages, followed by disruption of the epithelial lining of the liver, gastrointestinal distress, hepatocellular necrosis, hemolysis, jaundice and kidney damage (8,9).

Cytochrome P450 (CYP450) enzymes metabolize a number of exogenous and endogenous compounds, such as antidepressants, opiates, steroids, arachidonic acid, dopamine and serotonin (10–12). These enzymes are abundant in the brain, liver and other organs (10–15). Brain CYP450 content is low compared with that in the liver (0.5–2%), which makes it unlikely to affect systemic drug and peripheral metabolite levels (12). However, local brain levels of centrally acting compounds and the resulting therapeutic effects may be regulated by brain CYP450-mediated metabolism independently of peripheral metabolism and systemic drug levels. Variable brain CYP450 activity has substantial potential impact; effects have been demonstrated on behavior, neurotoxicity and drug response (16,17). The expression of a specific CYP450 enzyme within an organ can increase or decrease substantially in response to certain inducers and inhibitors (18,19). A number of CYP450 enzymes have tissue- and cell type-specific expression levels and regulators, and brain tissue expresses a unique set of these enzymes (20). For instance, CYP450 2D (CYP2D) has been identified in the liver and brain, and is involved in the metabolism of numerous centrally acting drugs, but is essentially uninducible in the liver. Brain CYP2D, however, can be induced by nicotine and clozapine (21,22).

Most studies of CuNPs explore their hepatotoxicity and nephrotoxicity (23,24); whether CuNPs affect the expression of brain CYP450 enzymes remains unknown. The present study investigated the effect of CuNPs on CYP450 enzymes in the rat brain by measuring the protein and gene expression of CYP450 isoenzymes in brain tissue. To identify the changes of CYP450s in the neurotoxicity of CuNPs, the effects of CuNPs on the levels of oxidative stress and nuclear receptors in the rat brain were investigated.

Materials and methods

Materials

The tested CuNPs (cat. no. H1605061), copper microparticles (cat. no. A1711069) and copper ions (CuCl2·2H2O, cat. no. F1620012) were obtained from Aladdin Industrial Co., Ltd. The sizes of the CuNPs and copper microparticles were 80 nm and 1 µm, respectively. Western blotting and SDS-PAGE preparation kits were purchased from Chengdu Baihe Technology Co., Ltd. Other molecular biology reagents were purchased from Bio-Rad Laboratories, Inc. Antibodies were purchased from Abcam. All analytical commercial kits were purchased from Nanjing Jiancheng Bioengineering Institute.

Particle characterization

The sizes of the CuNPs and copper microparticles were confirmed using a Phenom ProX scanning electron microscope (Phenom Scientific Instruments Co., Ltd.). The CuNPs were dispersed in purified water, shaken and sonicated in an ice bath to avoid aggregation. The distribution of particle sizes in the suspension was characterized by dynamic light scattering studies performed using a Zetasizer Nano ZS (Malvern Panalytical, Ltd.) immediately following sonication.

Animals and treatments

A total of 60 specific pathogen-free (SPF) male rats (100–120 g, 6 weeks old) were purchased from Chengdu Dossy Biological Technology Co., Ltd. Male rats were chosen as the subjects of the study due to differences in the expression of CYP450 between female and male rats (25,26). Rats were housed in plastic cages under SPF conditions at 25±2°C and 70±10% relative humidity, under a 12-h light/dark cycle. Water and food were provided ad libitum. Copper particles were suspended in 1% hydroxypropyl methylcellulose (HPMC) solution (w/v) (Shanghai Ryon Biological Technology Co., Ltd.) every day prior to use. Following 7 days of acclimatization, rats were randomly divided into a control group, which was administered with 1% HPMC, and five test groups that were administered with different concentrations of copper by gavage for 28 days: i) 200 mg/kg 1 µm copper; ii) 200 mg/kg CuCl2·2H2O (Cu2+); iii) 50 mg/kg CuNPs (low dose); iv) 100 mg/kg CuNPs (medium dose); v) 200 mg/kg CuNPs (high dose) (n=10 per group). The study was approved by Sichuan Agricultural University (Chengdu, China), and the protocols for animal care and treatment were in accordance with their guidelines for animal experiments (approval no. 20170314). All possible efforts were made to relieve unnecessary suffering of the experimental animals.

Sample collection

On day 28 of the experiment, following an overnight fast, the rats were anesthetized by gas anesthesia with diethyl ether at the rate of 0.2 l/min. Anesthesia was confirmed by righting reflex, and the animals were rapidly taken out of the anesthesia machine and sacrificed by cervical dislocation. Brain tissues were snap-frozen and stored at −80°C for oxidative stress and reverse transcription-quantitative polymerase chain reaction (RT-qPCR) analyses.

Brain microsomes were used to analyze the protein expression of the nuclear receptors pregnane X receptor (PXR) and constitutive androstane receptor (CAR) and CYP450 enzymes, which were prepared by differential centrifugation as previously described (27). The tissue was homogenized in a 0.05 mM Tris/KCl buffer (pH 7.4; Boster Biological Technology), centrifuged at 10,000 × g at 4°C for 30 min, and the supernatant was centrifuged at 105,000 × g at 4°C for 60 min. Subsequently, the brain protein settlement was re-suspended with 0.05 mM Tris/KCl buffer (pH 7.4) and stored at −80°C until western blot analyses were performed. The protein content in the brain microsomes was determined using the Bicinchoninic Acid Protein Assay kit (Beyotime Biological Technology Co., Ltd.) with the Thermo Scientific™ Multiskan™ GO Microplate reader (Thermo Fisher Scientific, Inc.).

Oxidative stress

The levels of total superoxide dismutase (T-SOD), glutathione (GSH), hydroxyl radicals (·OH) and malondialdehyde (MDA) in the rat brain were determined to evaluate oxidative stress and damage. This was performed using commercial assay kits from Nanjing Jiancheng Bioengineering Institute, which were: Total Superoxide Dismutase (T-SOD) assay kit (Hydroxylamine method); Malondialdehyde (MDA) assay kit (TBA method); Reduced glutathione (GSH) assay kit (Spectrophotometric method); and Hydroxyl Free Radical assay kit. All assays were performed according to the manufacturer's instructions.

Gene expression

The expression levels of CYP450 1A2, 2D22, 2E1 and 3A11 in the brain were analyzed using RT-qPCR as previously described (28). Total RNA was extracted using an OMGA total RNA kit II (Omega Bio-Tek, Inc.) and cDNA was synthesized using PrimeScript™ RT reagent kit with gDNA Eraser (Takara Bio, Inc.). The qPCR was performed using iQ SYBR® Premix Ex Taq™ II (Tli RNaseH Plus; cat. no. RR820A; Takara Bio, Inc.). The qPCR was performed under the following conditions: 45 cycles, each involving 5 sec of denaturation at 95°C, and 40 sec of amplification at 60°C. The housekeeping gene GAPDH was used as an internal control. All primers were designed with Primer premier v 5.0 software (Premier Biosoft International) and commercially produced (BGI Tech Solutions Co., Ltd.; Table I) based on the target gene. Melting curves and PCR efficiency were used as standard quality criteria for each qPCR run. The target gene mRNA expression was normalized to GAPDH expression, and were analyzed using the 2−ΔΔCq method (29).

Table I.

Reverse transcription-quantitative polymerase chain reaction primers.

Table I.

Reverse transcription-quantitative polymerase chain reaction primers.

TargetPrimer sequence (5′-3′)
CYP450 1A1F: GGGAGGTTACTGGTTCTGG
R: ATGAGGCTGTCTGTGATGTC
CYP450 2C11F: AATCCGCAGTCTGAGTTTACCC
R: GGTTTCTGCCAATTACACGTTCT
CYP450 2D6F: AGCTTCAACACCGCTATGGT
R: CAGCAGTGTCCTCTCCATGA
CYP450 3A1F: TGCCATCACGGACACAGA
R: ATCTCTTCCACTCCTCATCCTTAG
CARF: CCACGGGCTATCATTTCCAT
R: CCCAGCAAACGGACAGATG
PXRF: TGGACAAACTCTCCGTTCTAAGG
R: GATTTTAATGCAACATCAAAGAA GCT
GAPDHF: GATGGTGAAGGTCGGTGTG
R: ATGAAGGGGTCGTTGATGG

[i] CYP450, cytochrome P450 enzyme; CAR, constitutive receptor; PXR, pregnane X receptor.

Western blot analysis

The protein levels of CYP450 1A1, CYP450 2C11, CYP450 2D6, CYP450 3A1, CAR and PXR in the brain microsome of rats were estimated using western blot analysis as previously described (30,31). Microsomal proteins (10 µg) were separated by 10% SDS-PAGE and transferred to PVDF membranes (Pall Corporation). The membranes were blocked with skimmed milk (Beijing Solarbio Science & Technology Co., Ltd.) and incubated for 12 h at 4°C with primary antibodies against CYP450 1A1 (cat. no. ab22717; 1:1,000; Abcam), CYP450 2C11 (cat. no. ab3571; 1:1,000; Abcam), CYP450 2D6 (cat. no. 73867S; 1:1,000; Cell Signaling Technology, Inc.), CYP450 3A1 (cat. no. ab22724; 1:1,500; Abcam), PXR (cat. no. ab118336; 1:500; Abcam), CAR (cat. no. ab62590; 1:1,500; Abcam), and β-actin (cat. no. bs-0061R; 1:10,000; Beijing Biosynthesis Biotechnology Co., Ltd.). Following incubation with primary antibody, the blots were incubated with a horseradish peroxidase-labeled secondary antibody for 1 h at room temperature (cat. no. bs-0295G; 1:10,000; Beijing Biosynthesis Biotechnology Co., Ltd.). β-actin was used as an internal loading control. The bands were visualized using enhanced chemiluminescence (ECL Western Blotting Substrate; Beijing Solarbio Science & Technology Co., Ltd.) and densitometric analysis was performed using ImageJ software version 1.48u (National Institutes of Health).

Statistical analysis

The assays were performed in triplicate. All data were expressed as the mean ± standard deviation. Statistical analysis was performed by one-way ANOVA in SPSS version 19.0 (IBM Corp.), and the least significant difference test was used following comparison of the mean values with the control group. P<0.05 was considered to indicate a statistically significant difference.

Results

Physiochemical characterization of CuNPs and copper microparticles

Physiochemical characteristics of CuNPs and copper microparticles were evaluated using scanning electron microscopy and a laser particle size analyzer (Fig. 1). CuNPs and copper microparticles exhibited spherical morphology (Fig. 1A and B), and the size distribution is presented in Fig. 1C and D. The most common sizes of the CuNPs and copper microparticles were 80 nm (average size: 82.5±33.4 nm) and 1 µm (average size: 987.4±436.7 nm), respectively.

Figure 1.

Physiochemical characterization of CuNPs and copper microparticles. (A and B) The scanning electron microscopy results demonstrated that the CuNPs were aggregated spherical particles (image magnification: A, ×100,000; B, ×30,000). Mean sizes of the particles were (C) 82.5±33.4 nm in the 80 nm group and (D) 987.4±436.7 in the 1 µm group, as determined by a laser particle size analyzer. CuNPs, copper nanoparticles.

Oxidative stress

The levels of oxidative stress markers in the rat brains were determined using commercial assay kits (Fig. 2). The levels of T-SOD were significantly decreased compared with those of the control following all treatments, with the exception of Cu2+. GSH content was decreased significantly in the 1 µm, Cu2+ and high-dose CuNPs groups compared with that in the control group. The levels of ·OH were increased in the 1 µm, Cu2+ and high-dose CuNPs groups compared with that in the control group. The level of MDA was increased in the Cu2+ and high-dose CuNPs groups compared with that in the control.

Figure 2.

Effects of CuNPs on brain T-SOD, GSH, ·OH and MDA levels in the brain. T-SOD levels were significantly decreased by CuNPs and 1 µm. GSH content was decreased significantly in the 1 µm, Cu2+ and high-dose CuNPs groups. The ·OH levels were increased in the 1 µm, Cu2+ and high-dose CuNPs groups. MDA was increased in the Cu2+ and high-dose CuNPs groups. *P<0.05 and **P<0.01 vs. control. CuNPs, copper nanoparticles; GSH, glutathione; MDA, malondialdehyde; ·OH, hydroxyl radicals; T-SOD, total superoxide dismutase.

mRNA expression of nuclear receptors and CYP450s

RT-qPCR was performed to determine the mRNA expression levels of different CYP450s (Fig. 3). CYP450 1A1 mRNA expression levels were significantly decreased in the 1 µm and Cu2+ groups and significantly increased in the low-dose CuNPs group compared with that in the control group. The mRNA expression levels of CYP 2C11 were significantly decreased in rats treated with high-dose CuNPs compared with that in the control. The mRNA expression levels of CYP450 2D6 were significantly decreased in the Cu2+ group, but significantly increased in the low- and medium-dose CuNPs groups compared with that in the control group. The mRNA expression levels of CYP450 3A1 were increased in the 1 µm, Cu2+ and low-dose groups, but significantly suppressed in the high-dose CuNPs group compared with that in the control. The mRNA expression levels of CAR were reduced in the low and medium CuNPs groups, and significantly reduced in the high CuNPs groups, whereas PXR mRNA expression levels of were reduced significantly in the medium and high dose CuNPs groups, and significantly increased in the 1 µm, Cu2+ and low-dose CuNPs groups compared with that in the control group.

Figure 3.

mRNA expression levels of CYP450 1A1, 2C11, 2D6, 3A1, CAR and PXR in the rat brain. Different sources of copper had a different impact on the mRNA expression of brain CYP450s. A high dose of CuNPs decreased the expression levels of CAR, PXR, CYP450 2C11 and CYP450 3A1. A low-dose of CuNPs increased the expression of CYP 450 enzymes (except for CYP450 2C11) and PXR. *P<0.05 and **P<0.01 vs. control. CYP450, cytochrome P450; CAR, constitutive receptor; PXR, pregnane X receptor; CuNPs, copper nanoparticles; Low, low-dose CuNPs; Medium, medium-dose CuNPs; High, high-dose CuNPs.

Protein expression of nuclear receptors and CYP450 enzymes

Western blot analysis was performed to determine the protein expression levels of CYP450 enzymes (Fig. 4). Protein expression levels of CYP450 1A1 were decreased significantly in the high-dose CuNPs group compared with that in the control. The levels of CYP450 2C11 were significantly decreased in the medium- and high-dose CuNPs groups, but increased in the 1 µm group compared with that in the control group. The protein expression levels of CYP450 2D6 were suppressed in the medium- and high-dose CuNPs groups compared with that in the control. The activity of CYP450 3A1 was suppressed in all treatment groups compared with that in the control group. The CAR protein expression levels did not change under any treatment, whereas the protein levels of PXR were decreased in the Cu2+, and the low-, medium- and high-dose CuNPs groups compared with that in the control.

Figure 4.

Protein expression levels of CYP450 1A1, 2C11, 2D6, 3A1, CAR and PXR in the rat brain. CYP450 3A1 was the most strongly affected of the tested CYP450s when analyzing all sources of copper. A high dose of CuNPs decreased the protein expression of all CYP450 enzymes and PXR. *P<0.05 and **P<0.01 vs. control. CYP450, cytochrome P450; CAR, constitutive receptor; PXR, pregnane X receptor; CuNPs, copper nanoparticles; Low, low-dose CuNPs; Medium, medium-dose CuNPs; High, high-dose CuNPs.

Discussion

Brain CYP450 is expressed in glial cells in the barrier regions and in neurons throughout the brain, and certain endogenous compounds, as well as central nervous system drugs, are metabolized by CYP450s in the brain (32). The function of brain CYP450 and the associated changes may be important for the development of drugs that act and are metabolized locally in the brain, as well as therapeutics that directly target brain CYPs (33). CuNPs not only cause lesions and blood-brain barrier breakdown where copper accumulates, but also affect neurotransmitter levels in the brain; it is not clear whether these changes depend on CYP450s (34).

The underlying molecular mechanism of brain CYP450 regulation remains poorly understood, but a large body of data has demonstrated that CYP450 expression can be regulated by oxidative stress via the activation of nuclear receptor signaling pathways (35–37). Oxidative stress is a state of redox disequilibrium, which occurs when reactive oxygen species (ROS) production exceeds the antioxidant defense capacity of a cell (38). Previous studies have suggested that exposure to CuNPs leads to oxidative stress, as indicated by elevated ROS levels and decreased antioxidant enzyme activity (39,40). ROS, including superoxide anions, hydrogen peroxide and hydroxyl radicals, exhibit higher reactivity than molecular oxygen (41). Exposure to CuNPs increases the production of ROS, which may result in damage to nuclear DNA and alterations of proteins, lipids and carbohydrates when present at a high level (42,43). In the present study, the levels of antioxidants (T-SOD and GSH) were decreased, whereas the levels of lipid peroxidation products (·OH and MDA) were increased upon exposure of the rat brain to CuNPs, when compared with results in untreated rats. Cu2+ and high-dose CuNPs induced severe oxidative stress. These results suggested that CuNPs may induce redox disequilibrium and exert negative effects on CYP450 in the rat brain.

Brian CYP450s regulate cellular mechanisms transcriptionally, post-transcriptionally and post-translationally (44–47). Brain CYP450s are sensitive to xenobiotic inducers, which may differ from the induction of liver CYPs. The regulation of brain CYP450s is highly dependent on the isoform and inducer of CYP (19). CuNPs are small (1- to 100-nm) particles that can cross the blood-brain barrier and damage the brain (48). The results of the present study demonstrated that the mRNA expression levels of CYP450s and nuclear receptors were increased or suppressed by different copper treatments compared with the control group, but CYP450 protein expression levels were decreased in the CuNP-treated groups compared with that in the control. The expression of CYP450 3A1 and PXR exhibited similarly trends following treatment with different levels of copper nano-particles, which is in line with a previous study that posited that PXR is a regulator of CYP450 3A enzymes (49). CAR and PXR are thought to be activated in response to exogenous stimuli, and are involved in CYP450 regulation (49–51). The results of the present study indicate that oxidative stress may suppress the expression of PXR expression through CuNPs. Therefore, the toxicity of CuNPs may decrease the expression of CYP450 in the brain, and their main target is CYP450 3A1. The mRNA expression level of CYP450s were either unchanged or reduced following a high dose of CuNPs, but overall higher doses were shown to reduce the protein level of CYP450s. Although an increase in mRNA expression was observed for both CYP450 2D6 and CYP450 3A1, the western blotting analyses showed a reduction in protein levels following CuNP treatment in a seemingly dose dependent manner. This demonstrated that CuNPs may affect CYP450 enzymes differently depending on whether they act at the post-transcriptional and/or post-translational levels.

CYP450 enzymes of the brain serve an important role in maintaining brain homeostasis, therefore it is of interest to continue researching the role of CYP450s in the metabolism of endogenous neurochemicals, some of which have already been described (52,53). The results of the present study provide evidence that CuNPs may have an impact on rat brain CYP450 enzymes, and unnecessary neurotoxicity and nervous system disorders should be avoided in practical applications.

In conclusion, the present study demonstrates that CuNPs may have an impact on brain CYP450 enzymes through ROS accumulation. The understanding of the roles of CuNPs in the regulation of brain CYP450s may be useful for better prediction, prevention and treatment of the toxicity of copper therapeutics in the brain.

Acknowledgements

The authors would like to thank Akram M. Salam (PhD, Emory University, Atlanta, GA, USA) for language editing.

Funding

No funding was received.

Availability of data and materials

The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.

Authors' contributions

YW, HT and YL made substantial contributions to conception, design, acquisition of data, analysis and interpretation of data, and were major contributors in writing the manuscript. MX and JL helped in experimental operation and data analysis. LZ, FS, GY, and CL contributed to the experimental design. All authors read and approved the final manuscript.

Ethics approval and consent to participate

The study was approved by Sichuan Agricultural University, and the protocols for animal care and treatment were in accordance with their guidelines for animal experiments (approval no. 20170314).

Patient consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

Glossary

Abbreviations

Abbreviations:

CYP450

cytochrome P450 enzyme

CAR

constitutive androstane receptor

PXR

pregnane X receptor

CuNPs

copper nanoparticles

GSH

glutathione

·OH

hydroxyl radicals

MDA

malondialdehyde

HPMC

hydroxypropyl methylcellulose

RT-qPCR

reverse-transcriptase polymerase chain reaction

References

1 

Guo K, Pan Q, Wang L and Fang S: Nano-scale copper-coated graphite as anode material for lithium-ion batteries. J Appl Electrochem. 32:679–685. 2002. View Article : Google Scholar

2 

Liu G, Li X, Qin B, Xing D, Guo Y and Fan R: Investigation of the mending effect and mechanism of copper nano-particles on a tribologically stressed surface. Tribol Lett. 17:961–966. 2004. View Article : Google Scholar

3 

Cioffi N, Ditaranto N, Torsi L, Picca RA, Sabbatini L, Valentini A, Novello L, Tantillo G, Bleve-Zacheo T and Zambonin PG: Analytical characterization of bioactive fluoropolymer ultra-thin coatings modified by copper nanoparticles. Anal Bioanal Chem. 381:607–616. 2005. View Article : Google Scholar : PubMed/NCBI

4 

Lei R, Wu C, Yang B, Ma H, Shi C, Wang Q, Wang Q, Yuan Y and Liao M: Integrated metabolomic analysis of the nano-sized copper particle-induced hepatotoxicity and nephrotoxicity in rats: A rapid in vivo screening method for nanotoxicity. Toxicol Appl Pharmacol. 232:292–301. 2008. View Article : Google Scholar : PubMed/NCBI

5 

Magdassi S, Grouchko M and Kamyshny A: Copper nanoparticles for printed electronics: Routes towards achieving oxidation stability. Materials (Basel). 3:4626–4638. 2010. View Article : Google Scholar : PubMed/NCBI

6 

Yoon KY, Hoon ByeonJ, Park JH and Hwang J: Susceptibility constants of Escherichia coli and Bacillus subtilis to silver and copper nanoparticles. Sci Total Environ. 373:572–575. 2007. View Article : Google Scholar : PubMed/NCBI

7 

Lee IC, Ko JW, Park SH, Lim JO, Shin IS, Moon C, Kim SH, Heo JD and Kim JC: Comparative toxicity and biodistribution of copper nanoparticles and cupric ions in rats. Int J Nanomedicine. 11:2883–2900. 2016.PubMed/NCBI

8 

Chen Z, Meng H, Xing G, Chen C, Zhao Y, Jia G, Wang T, Yuan H, Ye C, Zhao F, et al: Acute toxicological effects of copper nanoparticles in vivo. Toxicol Lett. 163:109–120. 2006. View Article : Google Scholar : PubMed/NCBI

9 

Sarkar A, Das J, Manna P and Sil PC: Nano-copper induces oxidative stress and apoptosis in kidney via both extrinsic and intrinsic pathways. Toxicology. 290:208–217. 2011. View Article : Google Scholar : PubMed/NCBI

10 

Guengerich FP: Human Cytochrome P450 Enzymes. Cytochrome P450: Structure, Mechanism, and Biochemistry. Ortiz de Montellano PR: Springer International Publishing; Cham: pp. 523–785. 2015

11 

Backman JT, Filppula AM, Niemi M and Neuvonen PJ: Role of cytochrome P450 2C8 in drug metabolism and interactions. Pharmacol Rev. 68:168–241. 2016. View Article : Google Scholar : PubMed/NCBI

12 

Hedlund E, Gustafsson JA and Warner M: Cytochrome P450 in the brain; a review. Curr Drug Metab. 2:245–263. 2001. View Article : Google Scholar : PubMed/NCBI

13 

Miksys S and Tyndale RF: Cytochrome P450-mediated drug metabolism in the brain. J Psychiatry Neurosci. 38:152–163. 2013. View Article : Google Scholar : PubMed/NCBI

14 

Toselli F, Dodd PR and Gillam EM: Emerging roles for brain drug-metabolizing cytochrome P450 enzymes in neuropsychiatric conditions and responses to drugs. Drug Metab Rev. 48:379–404. 2016. View Article : Google Scholar : PubMed/NCBI

15 

Wang X, Li J, Dong G and Yue J: The endogenous substrates of brain CYP2D. Eur J Pharmacol. 724:211–218. 2014. View Article : Google Scholar : PubMed/NCBI

16 

Schilter B, Andersen MR, Acharya C and Omiecinski CJ: Activation of cytochrome P450 gene expression in the rat brain by phenobarbital-like inducers. J Pharmacol Exp Ther. 294:916–922. 2000.PubMed/NCBI

17 

Huang P, Rannug A, Ahlbom E, Håkansson H and Ceccatelli S: Effect of 2,3,7,8-tetrachlorodibenzo-p-dioxin on the expression of cytochrome P450 1A1, the aryl hydrocarbon receptor, and the aryl hydrocarbon receptor nuclear translocator in rat brain and pituitary. Toxicol Appl Pharmacol. 169:159–167. 2000. View Article : Google Scholar : PubMed/NCBI

18 

Sánchez-Catalán MJ, Hipólito L, Guerri C, Granero L and Polache A: Distribution and differential induction of CYP2E1 by ethanol and acetone in the mesocorticolimbic system of rat. Alcohol Alcohol. 43:401–407. 2008. View Article : Google Scholar : PubMed/NCBI

19 

Miksys SL and Tyndale RF: Drug-metabolizing cytochrome P450s in the brain. J Psychiatry Neurosci. 27:406–415. 2002.PubMed/NCBI

20 

Hedlund E, Wyss A, Kainu T, Backlund M, Köhler C, Pelto-Huikko M, Gustafsson JA and Warner M: Cytochrome P4502D4 in the brain: Specific neuronal regulation by clozapine and toluene. Mol Pharmacol. 50:342–350. 1996.PubMed/NCBI

21 

Mann A, Miksys S, Lee A, Mash DC and Tyndale RF: Induction of the drug metabolizing enzyme CYP2D in monkey brain by chronic nicotine treatment. Neuropharmacology. 55:1147–1155. 2008. View Article : Google Scholar : PubMed/NCBI

22 

Strobel HW, Thompson CM and Antonovic L: Cytochromes P450 in brain: Function and significance. Curr Drug Metab. 2:199–214. 2001. View Article : Google Scholar : PubMed/NCBI

23 

Funae Y, Kishimoto W, Cho T, Niwa T and Hiroi T: CYP2D in the brain. Drug Metab Pharmacokinet. 18:337–349. 2003. View Article : Google Scholar : PubMed/NCBI

24 

Ferguson CS and Tyndale RF: Cytochrome P450 enzymes in the brain: Emerging evidence of biological significance. Trends Pharmacol Sci. 32:708–714. 2011. View Article : Google Scholar : PubMed/NCBI

25 

Bai R, Zhang L, Liu Y, Li B, Wang L, Wang P, Autrup H, Beer C and Chen C: Integrated analytical techniques with high sensitivity for studying brain translocation and potential impairment induced by intranasally instilled copper nanoparticles. Toxicol Lett. 226:70–80. 2014. View Article : Google Scholar : PubMed/NCBI

26 

Liao M and Liu H: Gene expression profiling of nephrotoxicity from copper nanoparticles in rats after repeated oral administration. Environ Toxicol Pharmacol. 34:67–80. 2012. View Article : Google Scholar : PubMed/NCBI

27 

Sarkar P, Narayanan J and Harder DR: Differential effect of amyloid β on the cytochrome P450 epoxygenase activity in rat brain. Neuroscience. 194:241–249. 2011. View Article : Google Scholar : PubMed/NCBI

28 

Auyeung DJ, Kessler FK and Ritter JK: An alternative promoter contributes to tissue-and inducer-specific expression of the rat UDP-glucuronosyltransferase 1A6 gene. Toxicol Appl Pharmacol. 174:60–68. 2001. View Article : Google Scholar : PubMed/NCBI

29 

Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods. 25:402–408. 2001. View Article : Google Scholar : PubMed/NCBI

30 

Daniel WA, Haduch A, Syrek M and Boksa J: Direct and indirect interactions between antidepressant drugs and CYP2C6 in the rat liver during long-term treatment. Eur Neuropsychopharmacol. 16:580–587. 2006. View Article : Google Scholar : PubMed/NCBI

31 

Haduch A, Wójcikowski J and Daniel WA: The effect of tricyclic antidepressants, selective serotonin reuptake inhibitors (SSRIs) and newer antidepressant drugs on the activity and level of rat CYP3A. Eur Neuropsychopharmacol. 16:178–186. 2006. View Article : Google Scholar : PubMed/NCBI

32 

Meyer RP, Gehlhaus M, Knoth R and Volk B: Expression and function of cytochrome p450 in brain drug metabolism. Curr Drug Metab. 8:297–306. 2007. View Article : Google Scholar : PubMed/NCBI

33 

Navarro-Mabarak C, Camacho-Carranza R and Espinosa-Aguirre JJ: Cytochrome P450 in the central nervous system as a therapeutic target in neurodegenerative diseases. Drug Metab Rev. 50:95–108. 2018. View Article : Google Scholar : PubMed/NCBI

34 

Zhang L, Bai R, Liu Y, Meng L, Li B, Wang L, Xu L, Le Guyader L and Chen C: The dose-dependent toxicological effects and potential perturbation on the neurotransmitter secretion in brain following intranasal instillation of copper nanoparticles. Nanotoxicology. 6:562–575. 2012. View Article : Google Scholar : PubMed/NCBI

35 

Kakehashi A, Hagiwara A, Imai N, Nagano K, Nishimaki F, Banton M, Wei M, Fukushima S and Wanibuchi H: Mode of action of ethyl tertiary-butyl ether hepatotumorigenicity in the rat: Evidence for a role of oxidative stress via activation of CAR, PXR and PPAR signaling pathways. Toxicol Appl Pharmacol. 273:390–400. 2013. View Article : Google Scholar : PubMed/NCBI

36 

Tolson AH and Wang H: Regulation of drug-metabolizing enzymes by xenobiotic receptors: PXR and CAR. Adv Drug Deliv Rev. 62:1238–1249. 2010. View Article : Google Scholar : PubMed/NCBI

37 

Waxman DJ: P450 gene induction by structurally diverse xenochemicals: Central role of nuclear receptors CAR, PXR, and PPAR. Arch Biochem Biophys. 369:11–23. 1999. View Article : Google Scholar : PubMed/NCBI

38 

Deres P, Halmosi R, Toth A, Kovacs K, Palfi A, Habon T, Czopf L, Kalai T, Hideg K, Sumegi B and Toth K: Prevention of doxorubicin-induced acute cardiotoxicity by an experimental antioxidant compound. J Cardiovasc Pharmacol. 45:36–43. 2005. View Article : Google Scholar : PubMed/NCBI

39 

Xu P, Xu J, Liu S, Ren G and Yang Z: In vitro toxicity of nanosized copper particles in PC12 cells induced by oxidative stress. J Nanopart Res. 14:9062012. View Article : Google Scholar

40 

Xu P, Xu J, Liu S and Yang Z: Nano copper induced apoptosis in podocytes via increasing oxidative stress. J Hazard Mater. 241-242:279–286. 2012. View Article : Google Scholar : PubMed/NCBI

41 

Thannickal VJ and Fanburg BL: Reactive oxygen species in cell signaling. Am J Physiol Lung Cell Mol Physiol. 279:L1005–L1028. 2000. View Article : Google Scholar : PubMed/NCBI

42 

Martindale JL and Holbrook NJ: Cellular response to oxidative stress: Signaling for suicide and survival. J Cell Physiol. 192:1–15. 2002. View Article : Google Scholar : PubMed/NCBI

43 

Yoshida Y, Itoh N, Saito Y, Hayakawa M and Niki E: Application of water-soluble radical initiator, 2,2′-azobis [2-(2-imidazolin-2-yl) propane] dihydrochloride, to a study of oxidative stress. Free Radic Res. 38:375–384. 2004. View Article : Google Scholar : PubMed/NCBI

44 

Yadav S, Dhawan A, Singh RL, Seth PK and Parmar D: Expression of constitutive and inducible cytochrome P450 2E1 in rat brain. Mol Cell Biochem. 286:171–180. 2006. View Article : Google Scholar : PubMed/NCBI

45 

Roberts BJ, Shoaf SE, Jeong KS and Song BJ: Induction of CYP2E1 in liver, kidney, brain and intestine during chronic ethanol administration and withdrawal: Evidence that CYP2E1 possesses a rapid phase half-life of 6 hours or less. Biochem Biophys Res Commun. 205:1064–1071. 1994. View Article : Google Scholar : PubMed/NCBI

46 

Joshi M and Tyndale RF: Induction and recovery time course of rat brain CYP2E1 after nicotine treatment. Drug Metab Dispos. 34:647–652. 2006. View Article : Google Scholar : PubMed/NCBI

47 

Miksys S, Wadji FB, Tolledo EC, Remington G, Nobrega JN and Tyndale RF: Rat brain CYP2D enzymatic metabolism alters acute and chronic haloperidol side-effects by different mechanisms. Prog Neuropsychopharmacol Biol Psychiatry. 78:140–148. 2017. View Article : Google Scholar : PubMed/NCBI

48 

Ramsden CS, Smith TJ, Shaw BJ and Handy RD: Dietary exposure to titanium dioxide nanoparticles in rainbow trout, (Oncorhynchus mykiss): No effect on growth, but subtle biochemical disturbances in the brain. Ecotoxicology. 18:939–951. 2009. View Article : Google Scholar : PubMed/NCBI

49 

Aleksunes LM and Klaassen CD: Coordinated regulation of hepatic phase I and II drug-metabolizing genes and transporters using AhR-, CAR-, PXR-, PPARα-, and Nrf2-null mice. Drug Metab Dispos. 40:1366–1379. 2012. View Article : Google Scholar : PubMed/NCBI

50 

Thompson EE, Kuttab-Boulos H, Krasowski MD and Di Rienzo A: Functional constraints on the constitutive androstane receptor inferred from human sequence variation and cross-species comparisons. Hum Genomics. 2:168–178. 2005. View Article : Google Scholar : PubMed/NCBI

51 

Tien ES and Negishi M: Nuclear receptors CAR and PXR in the regulation of hepatic metabolism. Xenobiotica. 36:1152–1163. 2006. View Article : Google Scholar : PubMed/NCBI

52 

Fradette C, Yamaguchi N and Du Souich P: 5-Hydroxytryptamine is biotransformed by CYP2C9, 2C19 and 2B6 to hydroxylamine, which is converted into nitric oxide. Br J Pharmacol. 141:407–414. 2004. View Article : Google Scholar : PubMed/NCBI

53 

Bromek E, Haduch A, Gołembiowska K and Daniel WA: Cytochrome P450 mediates dopamine formation in the brain in vivo. J Neurochem. 118:806–815. 2011. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Wang Y, Tang H, Xu M, Luo J, Zhao L, Shi F, Ye G, Lv C and Li Y: Effect of copper nanoparticles on brain cytochrome P450 enzymes in rats. Mol Med Rep 20: 771-778, 2019.
APA
Wang, Y., Tang, H., Xu, M., Luo, J., Zhao, L., Shi, F. ... Li, Y. (2019). Effect of copper nanoparticles on brain cytochrome P450 enzymes in rats. Molecular Medicine Reports, 20, 771-778. https://doi.org/10.3892/mmr.2019.10302
MLA
Wang, Y., Tang, H., Xu, M., Luo, J., Zhao, L., Shi, F., Ye, G., Lv, C., Li, Y."Effect of copper nanoparticles on brain cytochrome P450 enzymes in rats". Molecular Medicine Reports 20.1 (2019): 771-778.
Chicago
Wang, Y., Tang, H., Xu, M., Luo, J., Zhao, L., Shi, F., Ye, G., Lv, C., Li, Y."Effect of copper nanoparticles on brain cytochrome P450 enzymes in rats". Molecular Medicine Reports 20, no. 1 (2019): 771-778. https://doi.org/10.3892/mmr.2019.10302
Copy and paste a formatted citation
x
Spandidos Publications style
Wang Y, Tang H, Xu M, Luo J, Zhao L, Shi F, Ye G, Lv C and Li Y: Effect of copper nanoparticles on brain cytochrome P450 enzymes in rats. Mol Med Rep 20: 771-778, 2019.
APA
Wang, Y., Tang, H., Xu, M., Luo, J., Zhao, L., Shi, F. ... Li, Y. (2019). Effect of copper nanoparticles on brain cytochrome P450 enzymes in rats. Molecular Medicine Reports, 20, 771-778. https://doi.org/10.3892/mmr.2019.10302
MLA
Wang, Y., Tang, H., Xu, M., Luo, J., Zhao, L., Shi, F., Ye, G., Lv, C., Li, Y."Effect of copper nanoparticles on brain cytochrome P450 enzymes in rats". Molecular Medicine Reports 20.1 (2019): 771-778.
Chicago
Wang, Y., Tang, H., Xu, M., Luo, J., Zhao, L., Shi, F., Ye, G., Lv, C., Li, Y."Effect of copper nanoparticles on brain cytochrome P450 enzymes in rats". Molecular Medicine Reports 20, no. 1 (2019): 771-778. https://doi.org/10.3892/mmr.2019.10302
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team