Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Molecular Medicine Reports
Join Editorial Board Propose a Special Issue
Print ISSN: 1791-2997 Online ISSN: 1791-3004
Journal Cover
March-2019 Volume 19 Issue 3

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
March-2019 Volume 19 Issue 3

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article Open Access

Effects of storage culture media, temperature and duration on human adipose‑derived stem cell viability for clinical use

  • Authors:
    • Yin‑Di Wu
    • Meng Li
    • Xuan Liao
    • Sheng‑Hong Li
    • Jian‑Xin Yan
    • Lei Fan
    • Wen‑Li She
    • Jian‑Xin Song
    • Hong‑Wei Liu
  • View Affiliations / Copyright

    Affiliations: Department of Plastic Surgery, The First Affiliated Hospital of Jinan University, Key Laboratory of Regenerative Medicine, Ministry of Education, Guangzhou, Guangdong 510630, P.R. China, Department of Orthopedics, Third Affiliated Hospital of Sun Yat‑Sen University, Guangzhou, Guangdong 510630, P.R. China, Department of Plastic Surgery, Changhai Hospital, The Second Military Medical University, Shanghai 200433, P.R. China
    Copyright: © Wu et al. This is an open access article distributed under the terms of Creative Commons Attribution License.
  • Pages: 2189-2201
    |
    Published online on: January 10, 2019
       https://doi.org/10.3892/mmr.2019.9842
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

Adipose‑derived stem cells (ADSCs) are mesenchymal stem cells that are often used in regenerative medicine. Maintaining ADSC viability is important, as this optimizes the curative effects of cell therapy. However, the optimal conditions for cell viability preservation remain unknown. The present study aimed to acquire a better protocol for ADSC storage by comparing the effects of various solutions and temperatures for ADSC preservation, in order to suggest the most effective methods of short‑term ADSC preservation for clinical use. ADSCs from passage 2 were suspended in solutions comprising 0.9% NaCl, 10% human serum (HS) or 10% platelet‑rich plasma (PRP). Suspended cells were maintained at 4˚C or room temperature (~26˚C) for 2, 4 and 6 h. The differentiation capacity, apoptosis and proliferation of ADSCs were determined by oil red O/alizarin red S staining, flow cytometry, and a cell counting kit‑8 cell proliferation assay, respectively. In addition, reverse transcription‑quantitative polymerase chain reaction and western blot analysis was performed. The results revealed that proliferation of ADSCs decreased with time. The optimal time for ADSC use was ~2 h, and 4 h was determined to be the latest time that ADSCs should be used. The 10% HS group had the highest survival rate, followed by the 10% PRP group; these two groups had higher survival rates than the 0.9% NaCl group (P<0.05). HS and PRP at 4˚C enhanced the ADSC proliferation rate (P<0.05), although the difference between these two groups was insignificant (P>0.05). In conclusion, the optimal time to use ADSCs was <2 h, and should not exceed 4 h. It was recommended that, for the transportation and short‑term storage of ADSCs during clinical use, they should be stored with 10% HS at 4˚C to maintain ADSC viability. In addition, this was a cost‑effective and safe method.

Introduction

As a type of mesenchymal stromal cell, adipose-derived stem cells (ADSCs) are characterized by their ability to self-renew and differentiate into multiple cell lineages (1). ADSCs are obtained from white or brown adipose tissue (2). Advantages of ADSCs are that they are abundant, collection results in minimal morbidity, they may differentiate into multiple cell lineages, and can be transplanted safely and effectively (3). It is generally accepted that adipose tissue contains multipotent progenitor cells (4). In addition, it comprises a useful and clinically important cell population called the stromal vascular fraction (SVF). SVF may be used directly or cultured as ADSCs (2,5,6). ADSCs are abundantly sourced and readily attained. SVF/ADSCs may be collected for clinical use by harvesting adipose tissue, digesting type I collagen enzymes, and removing red blood cells. ADSCs have been extensively applied in various clinical fields, including treatment for immune disorders, tissue degeneration and ischemic conditions, as well as soft tissue, craniofacial tissue and cardiovascular tissue regeneration (2,7). Considering their clinical characteristics and high demand, maintaining ADSC viability during transit or prior to clinical application is a wide concern, and the present study focused on methods for preserving ADSCs.

The primary methods for in vitro storage include 4°C non-frozen preservation, −80°C cryopreservation and −196°C programmed cryopreservation in liquid nitrogen. Gonda et al (8) demonstrated that adipocytes may be optimally preserved for viability by cooling to sub-zero temperatures in liquid nitrogen for 6 months with a set preservation protocol. Following long-term cryopreservation, the proliferation and multiple differentiation capacities of human ADSCs are not lost (9). Matsumoto et al (10) determined oil volume ratio, glycerol-3-phosphate dehydrogenase activity and cell-surface marker expression via scanning electron microscopy to assess the viability of ADSCs at room temperature (RT) and at 4°C. Furthermore, it was reported that adipose tissue should be stored promptly, as storage overnight at 4°C results in no evident loss or alteration in the biological properties or yield of ADSCs (10). However, it has also been indicated that low temperatures may irreversibly damage the ADSC membrane (11,12). In this regard, an appropriate protection medium should be adopted when freezing cells, such as dimethyl sulfoxide (DMSO). To mitigate this damage, Bunnell et al (13) stored the cells in a specialized container. This allowed the temperature to be lowered at a rate of 1°C/min until −80°C was reached, and the cells were stored overnight. The following day, the cells were transferred to liquid nitrogen (13). Thus far, the majority of studies have been concerned with the long-term preservation of stem cells. For stem cells intended for clinical application, the current methods of preservation are inadequate, as human ADSC transplantation requires higher standards of security, survival and proliferation ability. In addition to the temperature, the preservation medium is also of critical significance. Several reports have concluded that an environment that mimics that of the native cell, containing 0.9% NaCl, 5% glucose and albumin or human serum (HS), is the most appropriate for cell survival (14). Other preservation media have also been studied, such as DMSO; however, the clinical use of DMSO causes diverse problems, including leukoencephalopathy, nausea, vomiting and potential renal function decrease (15). Liu et al (16) determined that 10–12.5% of human platelet-rich plasma (hPRP) resulted in the best outcome in bone formation tests, and involved injecting a mixture of ADSCs, hPRP and injectable tissue engineering bone into a nude mouse. As demonstrated by Shafaei et al (17), HS creates a better micro-environment for cell survival than fetal bovine serum (FBS).

For the clinical application of ADSCs, short-term preservation is more crucial than other time frames. Thus, identifying a safer temperature, more suitable medium and appropriate time frame is of crucial importance. In the present study, the effect of different temperatures [4°C and RT (~26°C)] and three types of preservation media (10% PRP, 10% HS and 0.9% normal saline) on ADSCs was tested to determine optimal time and storage conditions. Survival, proliferation and differentiation abilities of ADSCs were investigated under these various conditions.

Materials and methods

Ethics statement

The protocol of the present study was approved by the Ethics Committee of The First Affiliated Hospital of Jinan University (Guangzhou, China). Informed consent was obtained from all subjects prior to the current study. The fat tissue used in the present study came from a 65-year-old woman and the blood used in the present study came from a 26-year-old woman.

Preparation and activation of PRP

PRP was prepared following the method reported by Jalowiec et al (18). In brief, blood samples from a 26-year-old man were collected in anti-agglutination tubes and centrifuged twice at 200 × g for 10 min and 400 × g for 15 min at RT to collect adequate platelets. The supernatant platelet-poor plasma was transferred to another tube and used as a diluent when necessary. Factoring in the PRP platelet concentration, which was counted in a Malassez counting chamber (EMD Millipore, Billerica, MA, USA), a minimum value of 800×109/l, and a maximum value of 1,200×109/l, was expected for the final PRP platelet concentration (the platelet concentration of PRP is ~5 times that of whole blood) (19). A concentration of 862×109/l PRP was attained. The product was activated with 10% calcium gluconate and subsequently stored at 4°C overnight. Prior to application, the product was centrifuged at 3,000 × g for 15 min (RT).

Preparation of HS

HS was prepared following the method described by Freymann et al (20). Blood samples from the same person were collected in dry blood collecting tubes. Once the blood had coagulated, the serum was isolated from the entire blood clot by centrifugation at 2,000 × g for 10 min at RT. The PRP and HS were stored at −20°C and thawed prior to application.

Cell isolation and culture

Isolation and culture of ADSCs was partially performed using the standard protocols of Bura et al (21) and Guo et al (22). Permission and a signed consent to participate from the Institutional Review Board of Medical Science (Jinan University, Guangzhou, China) was obtained prior to the collection of 100 ml abdominal subcutaneous fat from a 65-year-old patient in November 2016. The adipose tissue was digested with 0.2% collagenase I (Biochrom GmbH, Berlin, Germany) for 30 min at 37°C, centrifuged for 10 min at 300 × g (RT) and filtered with a 100 µm mesh filter (neoLab Migge GmbH, Heidelberg, Germany). NaCl (0.3%) was used to remove the red blood cells prior to transfer of cells into culture medium including Dulbecco's Modified Eagle's Medium (DMEM; Gibco; Thermo Fisher Scientific, Inc., Waltham, MA, USA) containing 10% fetal calf serum (Gibco; Thermo Fisher Scientific, Inc.), 1% 100 U/ml penicillin and 100 µg/ml streptomycin, and culture in 5% CO2 at 37°C. The culture medium was changed at 3 day intervals. Primary cells were cultured for ~10 days and defined as ‘passage 0’. ADSCs of passage 2 which were cultured at culture medium and passaged twice, then prepared for subsequent experimentation.

Cell phenotype identification

To characterize the phenotype of ADSCs, the surface markers were determined, using flow cytometry as previously described (10). Briefly, ADSCs were incubated with Thy-1 cell surface antigen (CD90, catalog number: 561970), protein tyrosine phosphatase, receptor type C (CD45, catalog number: 555482), CD34 molecule (CD34, catalog number: 550761), integrin subunit β1 (CD29, catalog number: 557332), endoglin (CD105, catalog number: 561441), CD44 antigen (CD44, catalog number: 555478) and major histocompatibility complex, class II DR (HLA-DR, catalog number: 555812) antibodies (BD Biosciences, Franklin Lakes, NJ, USA) at 4°C for 30 min in the dark. Excess antibody was removed, cells were washed twice with PBS and 300 µl fixative solution was added. Flow cytometric analyses were performed with FlowJo version 7.6.1 (FlowJo LLC, Ashland, OR, USA).

In vitro osteogenic differentiation

ADSCs were seeded onto 24-well plates at a density of 1×104 cells/well. Following culture for 24 h in 10% FBS medium (Gibco; Thermo Fisher Scientific, Inc.) 37°C, cells were cultured in osteogenic differentiation medium at 37°C, composed of standard medium supplemented with FBS, penicillin-streptomycin, glutamine, ascorbate, β-glycerophosphate and dexamethasone (Cyagen Biosciences, Inc., Santa Clara, CA USA). During osteogenic induction, the medium was changed every three days. After 14 days of in vitro osteogenic induction, cells were washed twice with PBS and subsequently fixed with 10% neutral formaldehyde for 30 min at RT. Fixed cells were stained 4 min at 37°C with 0.1% alizarin red dye to visualize calcium deposition (23,24). The stained plates were air-dried for 2 min and observed under a light microscope (magnification, ×100).

In vitro adipogenic differentiation

ADSCs were seeded onto 24-well plates at a density of 1×104 cells/well following culture for 24 h at 37°C in DMEM with 10% FBS. Cells were subsequently placed in adipogenic differentiation medium (Cyagen Biosciences, Inc.). During adipogenic differentiation, the medium was changed every three days. Following culture for 14 days, cells were washed with PBS and fixed with 10% neutral formaldehyde for 30 min at RT. Fixed cells were stained with 0.5% oil red O dye for 30 min at 37°C (25,26). Cells were washed again in PBS and observed under a light microscope (magnification, ×100).

Experimental groups

ADSCs were placed in six 15 ml tubes at 5×105 cells/tube and were numbered 1–6. The following media were added to the tubes: i) 0.5 ml 0.9% NaCl, ii) 0.5 ml 10% HS, iii) 0.5 ml 10% PRP, iv) 0.5 ml 0.9% NaCl, v) 0.5 ml 10% HS and vi) 0.5 ml 10% PRP. Tubes 1–3 were stored at 4°C, while tubes 4–6 were stored at RT. Following a 2, 4 and 6 h culture, cell survival, apoptosis, proliferation and differentiation abilities were determined.

Cell proliferation assay

Cell proliferation was assessed with a Cell Counting Kit-8 (CCK8) assay (Dojindo Molecular Technologies, Inc., Kumamoto, Japan). The optical density (OD) values obtained indirectly report on cell proliferation. ADSCs from each group were seeded onto 96-well plates at a density of 3×103 cells/well (5 parallel wells were seeded for each group). The cells were cultured at 37°C for 24 h, rinsed with PBS and mixed with 10 µl CCK8 in 100 µl DMEM at 37°C until the medium turned orange. The absorbance of each well was detected by a microplate reader at a wavelength of 450 nm. The OD value was recorded, and the difference was analyzed using statistical methods (22).

Cell survival assay

Cell suspension (500 µl) from each group was placed into a flow tube. Propidium iodide (PI; 5 µl) was added to the flow tube with 5 µl Annexin V-FITC stain and mixed for 10 min in the dark at RT. The values of the side scatter, which represented the entire cell population, and the FL3 channel, which represented living cells, were recorded according to the detection of Annexin V-FITC/PI double staining cell apoptosis kit (KeyGEN) by flow cytometry. Data were analyzed with FlowJo version 7.6.1 (FlowJo LLC, Ashland, OR, USA).

Semi-quantification of in vitro osteogenic differentiation

ADSCs from each group were seeded onto 96-well plates at a density of 3×103 cells/well (5 parallel wells were seeded for each group) and maintained in osteogenic differentiation medium for 14 days. Cultivation procedures and alizarin red S dye staining was performed according to the protocol described above. In brief, the 96-well plates were decolored using 100 µl 10% hexadecylpyridinium chloride for 30 min at RT, and the OD value was detected with a microplate reader at a wavelength of 562 nm to perform a semi-quantitative analysis of osteogenic differentiation, as described previously (27,28).

Semi-quantification of in vitro adipogenic differentiation

ADSCs from each group were seeded onto 96-well plates at a density of 3×103 cells/well (5 parallel wells were seeded for each group) and cultured in adipogenic differentiation medium, as described above, prior to observation under a light microscope. Cells in the 96-well plates were subsequently decolored with 100 µl 100% isopropanol for 60 min, and the OD value was detected using a microplate reader at a wavelength of 510 nm to semi-quantitatively analyze adipogenic differentiation (26).

RNA isolation and reverse transcription-quantitative polymerase chain reaction (RT-qPCR)

Total RNA from each group was isolated using TRIzol reagent (Thermo Fisher Scientific, Inc.) according to the manufacturer's instructions. RNA concentration was determined using a spectrophotometer (Bio-Rad Laboratories, Inc., Hercules, CA, USA). RNAs with 260/280 ratios between 1.7 and 2.1 were used. cDNA was synthesized according to the protocol accompanying the PrimeScript® RT Master Mix kit (Takara Biotechnology Co., Ltd., Beijing, China) using 500 ng total RNA, and the reaction conditions were 25°C for start, 37°C for 15 mins, 85°C for 5 sec and then resting at 4°C. The primers for each gene were designed using the PrimerBank (29). RT-PCR was performed using 2 µl cDNA. PCR conditions were: 95°C for 30 sec for denaturation, 95°C for 5 sec (45 cycles) for amplification and at 60°C for 20 sec. The RNA analysis employed SYBR Green (Roche Diagnostics, Indianapolis, IN, USA). Data were quantified using the 2−∆∆Cq method (30) by normalizing the expression of the target genes to the housekeeping gene, GAPDH. The values were described as the expression of the target genes, including runt related transcription factor 2 (RUNX2), SRY-box 9 (SOX9) and sp7 transcription factor (osterix) for osteogenic differentiation, as well as fatty acid-binding protein 4 (FABP4), peroxisome-proliferator-activated receptor (PPAR)γ and CCAAT/enhancer-binding protein (CEBP)α for adipogenic differentiation. All primer sequences are listed in Table I.

Table I.

Primer sequences used for reverse transcription-quantitative polymerase chain reaction.

Table I.

Primer sequences used for reverse transcription-quantitative polymerase chain reaction.

GeneForward (5′→3′)Reverse (3′→5′)
RUNX2 TGGCAGTCACATGGCAGATT CTTGGGTGGGTGGAGGATTC
SOX9 GAGGAAGTCGGTGAAGAACGG CCCTCTCGCTTCAGGTCAG
Osterix GTAGGACTGTAGGACCGGA GCCATAGTGAACTTCCTCCTCA
FABP4 TGGGCCAGGAATTTGACGAA GCGAACTTCAGTCCAGGTCA
PPARγ GCAAACCCCTATTCCATGCT CCACGGAGCTGATCCCAAAG
CEBPα GACTAGGAGATTCCGGTGCC GCATTGGAGCGGTGAGTTTG
GAPDH GCTAAGGCTGTGGGGAAAGT TCAGCAGCAGCCTTCACTAC

[i] RUNX2, runt-related transcription factor 2; SOX9, SRY-box 9; osterix, sp7 transcription factor; FABP4, fatty acid-binding protein 4; PPARγ, peroxisome-proliferator-activated receptor γ; CEBPα, CCAAT/enhancer binding protein α.

Western blot analysis of osteocalcin and PPARγ

Following osteogenic and adipogenic differentiation, ADSCs from each group were lysed using radioimmunoprecipitation assay buffer (Dalian Meilun Biotechnology Co., Ltd., Dalian, China). Equal quantities of total protein (25 µg) from each group were separated by 12% SDS-PAGE (Beyotime Institute of Biotechnology, Shanghai, China). The proteins were subsequently transferred onto a polyvinylidene fluoride membrane. Membranes were blocked with 5% non-fat milk for 1 h at RT prior to incubation with mouse monoclonal anti-PPARγ (diluted with 5% BSA to 1:10,000, cat. no. 41928; Abcam, Cambridge, UK) and anti-osteocalcin antibodies (1:10,000, cat. no. 13421; Abcam), followed by incubation with goat-anti-mouse horseradish peroxidase-conjugated secondary antibody (Genetech Co., Ltd., Shanghai, China). The levels of osteocalcin and PPARγ were normalized to those of GAPDH (1:10,000, cat. no. 9482; Abcam). ImageJ version 2.0 software (National Institutes of Health, Bethesda, MD, USA) was used for densitometry.

Statistical analysis

All values were reported as the mean ± standard error of the mean (n=5/group). Data were analyzed using Student's t-test or one-way analysis of variance followed by the standard Tukey test for post-hoc analysis using SPSS version 13.0 (SPSS, Inc., Chicago, IL, USA). P<0.05 was considered to indicate a statistically significant difference.

Results

Cell identification

ADSCs from P2 were spindle-shaped (Fig. 1A), and the differentiation identification results are presented in Fig. 1B and C. Cells differentiated in osteogenic or adipogenic medium were stained with alizarin red (Fig. 1B) or oil red O (Fig. 1C), which detected calcium salt or lipid droplets, respectively. The phenotype identification results (Fig. 2A) revealed that ADSCs were positive for CD44 (Fig. 2B), CD105 (Fig. 2C), CD29 (Fig. 2D), and CD90 (Fig. 2E), expressed low levels of CD45 (Fig. 2F), and were negative for CD34 (Fig. 2G) and HLA-DR (Fig. 2H).

Figure 1.

ADSC differentiation identification. (A) Normal ADSCs from P2 were cultured in Dulbecco's modified Eagle's medium with 10% fetal bovine serum for 2 days. (B) ADSCs from P2 cultured in osteogenic differentiation medium for 14 days and observed by microscopy following alizarin red S staining. (C) ADSCs from P2 cultured in adipogenic differentiation medium for 14 days and observed by microscopy following oil red O staining. P2, passage 2; ADSC, adipose-derived stem cells.

Figure 2.

ADSC phenotype identification. (A) Phenotypes were identified by flow cytometry. (B) ADSCs were positive for CD44, (C) CD105, (D) CD29 and (E) CD90. (F) Low levels of CD45 were expressed, and ADSCs were negative for (G) CD34 and (H) HLA-DR. ADSC, adipose-derived stem cells; CD90, Thy-1 cell surface antigen; CD45, protein tyrosine phosphatase, receptor type C; CD34, CD34 molecule; CD29, integrin subunit β 1; CD105, endoglin; CD44, CD44 antigen; HLA-DR, major histocompatibility complex, class II DR.

Cell proliferation is dependent on preservation temperature, duration and medium

The results of the CCK8 cell proliferation assay revealed that the proliferative ability of each group declined with time (Fig. 3). Cells in the same media when stored at 4°C had increased proliferation compared with the RT group (Fig. 3A). In addition, the data demonstrated that the 10% PRP and 10% HS groups had higher OD values compared with the 0.9% NaCl group (Fig. 3B); however, the difference between 10% PRP and 10% HS was not statistically significant. In addition, the storage of cells at 4°C in 10% PRP or 10% HS facilitated cell proliferation for up to 4 h. There was an obvious decline between 4 and 6 h, whereas the difference between 2 and 4 h was relatively similar (Fig. 3C). Therefore, cells should be used earlier than 4 h and stored at 4°C to maintain proliferative ability.

Figure 3.

Comparison of ADSC proliferative ability when preserved in different conditions. ADSCs from different groups were observed following the addition of 10 µl cell counting kit 8 reagent, and the OD value was measured. (A) ADSC suspended in 0.9% NaCl were preserved at RT and 4°C for 2 h. (B) ADSCs suspended in three types of medium for 2 h at 4°C. (C) ADSCs suspended in 0.9% NaCl were preserved at 4°C for 2, 4 and 6 h. (D) Following the addition of 5 µl Annexin V-FITC/PI staining, ADSCs were analyzed and the SS and FL3 values were recorded, according to the detection of Annexin V-fluorescein isothiocyanate/PI. The survival rate of ADSCs suspended in 0.9% NaCl at 4°C for 2, 4 and 6 h is presented. (E) Survival rate ADSCs preserved at RT and 4°C in 0.9% NaCl for 6 h. (F) Survival rate of ADSCs suspended in three types of medium for 4 h at 4°C. *P<0.05. ADSCs, adipose-derived stem cells; OD, optical density; PI, propidium iodide; RT, temperature; HS, human serum; PRP, platelet-rich plasma.

Cell survival is dependent on preservation temperature, duration and medium

The survival rates of all groups declined with time (Fig. 3D). When comparing the two temperatures, 4°C improved ADSC preservation when stored in 0.9% NaCl, as evidenced by the higher survival rate (Fig. 3E). Furthermore, the data demonstrated that groups stored in 10% PRP and 10% HS had higher survival rates, compared with the 0.9% NaCl group (Fig. 3F). There was a common decline among ADSCs in different media at different times; however, ADSCs maintained a stable survival rate under 2 h. The survival rate of ADSCs stored at 4°C in 0.9% NaCl was 63.23% (Fig. 4A). ADSCs stored at 4°C in 10% HS had the best survival rate of 89.18% (Fig. 4B). ADSCs stored at 4°C in 10% PRP had the next highest survival rate of 80.81% (Fig. 4C), whereas the survival rate of ADSCs without treatment was 92.16% (Fig. 4D). In conclusion, to maintain a survival rate above 80%, ADSCs should be used within 2 h and stored for no longer than 4 h. These results demonstrated that 10% HS was the optimum medium.

Figure 4.

ADSC survival was determined by flow cytometry following preservation in 0.9% NaCl, 10% HS or 10% PRP for 2 h. (A) ADSCs preserved in 0.9% NaCl. (B) ADSCs preserved in 10% HS. (C) ADSCs preserved in 10% PRP. (D) Untreated ADSCs. *P<0.05. ADSCs, adipose-derived stem cells; HS, human serum; PRP, platelet-rich plasma; PI, propidium iodide.

ADSC differentiation capacity decreases when stored at RT

The experimental results revealed that the osteogenic (Fig. 5A) and adipogenic (Fig. 5B) differentiation of cells stored at 4°C was more successful compared with the cells stored at RT. Thus, compared with RT, 4°C is a more suitable environment for the preservation of ADSCs (P<0.05).

Figure 5.

ADSCs from passage 2 were preserved in 0.9% NaCl at RT or 4°C for 2 h to investigate the effects of temperature on the osteogenic and adipogenic differentiation capabilities. (A) The OD values of alizarin red S and (B) oil red O staining were determined in order to measure the degree of osteogenic and adipogenic differentiation, respectively. *P<0.05. ADSCs, adipose-derived stem cells; RT, room temperature; OD, optical density.

ADSC differentiation capacity decreases over time

It was demonstrated that the osteogenic (Fig. 6A) and adipogenic (Fig. 6B) differentiation capacity of ADSCs decreased over time, and there were statistically significant differences between each group. It was concluded that ADSCs should be utilized as soon as possible.

Figure 6.

ADSCs from passage 2 were preserved in 0.9% NaCl at 4°C for 2, 4 and 6 h to investigate the effect of time on the osteogenic and adipogenic differentiation capabilities. (A) The OD values of alizarin red S and (B) oil red O staining were determined in order to measure the degree of osteogenic and adipogenic differentiation, respectively. *P<0.05. ADSCs, adipose-derived stem cells; OD, optical density.

ADSC differentiation capacity decreases when stored in 0.9% NaCl

It was determined that 10% PRP and 10% HS were more optimal media for osteogenic and adipogenic differentiation, compared with 0.9% NaCl medium (P<0.05; Fig. 7A). However, there was no statistically significant difference between the 10% PRP and 10% HS groups for adipogenic differentiation (Fig. 7B). To maintain a higher differentiation rate, 10% HS or 10% PRP should be used as the suspension media for the short-term preservation of ADSCs.

Figure 7.

ADSCs from passage 2 were preserved in 0.9% NaCl, 10% HS and 10% PRP at 4°C for 2 h to investigate the effects of these media on the osteogenic and adipogenic differentiation capabilities. (A) The OD values of alizarin red S and (B) oil red O staining were determined in order to measure the degree of osteogenic and adipogenic differentiation, respectively. *P<0.05. ADSCs, adipose-derived stem cells; OD, optical density; HS, human serum; PRP, platelet-rich plasma.

Expression of osteogenic and adipogenic-associated genes is altered by ADSC preservation temperature, medium and duration

The differential expression of RUNX2, SOX9, osterix, FABP4, PPARγ, and CEBPα for different temperatures and over time are presented in Fig. 8. Similar trends were observed; the expression of genes associated with osteogenic and adipogenic differentiation was lower for cells stored at RT than for those stored at 4°C. Furthermore, the longer the cells were stored, the lower the osteogenic differentiation capacity. In terms of the preservation media, excluding osterix, there were no significant differences between the 10% PRP group and the 0.9% NaCl group. The expression of other genes was higher in the 10% PRP and 10% HS groups compared with the 0.9% NaCl group (Fig. 8).

Figure 8.

Expression of osteogenic and adipogenic-associated genes under different preservation conditions. Reverse transcription-quantitative polymerase chain reaction was performed to determine the gene expression levels of (A) osterix, (B) RUNX2, (C) SOX9, (D) FABP4, (E) PPARγ, and (F) CEBPα among the different groups. *P<0.05. HS, human serum; PRP, platelet-rich plasma; RT, room temperature; osterix, sp7 transcription factor; RUNX2, runt-related transcription factor 2; SOX9, SRY-box 9; FABP4, fatty acid-binding protein 4; PPARγ, peroxisome-proliferator-activated receptor γ; CEBPα, CCAAT/enhancer binding protein α.

Osteocalcin and PPARγ protein expression is altered by ADSC preservation temperature, medium and duration

The protein expression of osteocalcin, which is involved in osteogenic differentiation, and PPARγ, which is involved in adipogenic differentiation, was detected by western blotting. ADSCs stored at 4°C exhibited an increased expression of osteocalcin and PPARγ compared with those stored at RT (Fig. 9A and B). With increasing time, the expression of osteocalcin and PPARγ decreased (Fig. 9C and D). It was also observed that the secretion of osteocalcin and PPARγ was higher in the 10% PRP and 10% HS groups, compared with the 0.9% NaCl group (Fig. 9E and F).

Figure 9.

Expression of osteogenic and adipogenic-associated proteins under different preservation conditions. Western blot analysis of (A) osteocalcin and (B) PPARγ expression. (C) Densitometric analysis of osteocalcin and (D) protein expression in each condition. *P<0.05, **P<0.01. HS, human serum; PRP, platelet-rich plasma; RT, room temperature; PPARγ, peroxisome proliferator activated receptor γ.

Discussion

ADSCs are characterized by low immunogenicity and the adaptation of ADSCs to their environment provides a promising direction for future clinical applications (31). Martinez-Gonzalez et al (32), demonstrated that ADSCs protect the alveoli structure in patients with asthma by reducing the inflammation generated by neutrophil granulocytes, reducing IgE secretion and inhibiting lymphocyte infiltration. Additionally, Won et al (33) revealed that local injection of ADSCs promoted hair growth.

Several procedures are involved in the clinical preparation of ADSCs, including isolation, cultivation, passage and preservation. Especially in the preservation period, if, for instance, a patient has an accident, such as a sudden increased blood pressure or other cases that might affect the success of the surgery, a viable environment should be found to preserve the ADSCs.

PPARγ directly activates genes involved in lipid synthesis (34), and osteocalcin is a marker of osteogenic differentiation (35). The expression of RUNX2, SOX9 and osterix was detected to determine the osteogenic differentiation capacity of ADSCs stored under various conditions. FABP4, PPARγ, and CEBPα expression was also detected to determine adipogenic differentiation capacity (34,36–39).

According to the results of the present study, it was concluded that, compared with RT, 4°C was suitable as an appropriate temperature for ADSC storage. ADSCs preserved at 4°C do not require cryoprotectant or a procedure for cell thawing, which avoids cryoprotectant toxicity and/or irreversible damage to the cell membrane (11). The results of the present study suggest that, in addition to temperature, the preservation medium also served an important role in the cell microenvironment. PRP and HS are both derived from patients here, and NaCl is also present in the body, which makes it a safer choice.

PRP is obtained from the patient's whole blood by concentrating the blood to a high platelet concentration (40,41). PRP contains numerous growth factors, including platelet-derived growth factor, transforming growth factor-β, vascular endothelial growth factor and epidermal growth factor, which are delivered when PRP is activated (42–44). The results of the present study demonstrated that PRP improved osteogenic and adipogenic differentiation, which can be used to the fullest advantage, if necessary. PRP has been safely used in numerous fields, including oral and maxillofacial surgery, soft tissue ulcers, as well as stubborn acne and scar treatment (41,43,45,46). The appropriate concentration of PRP for optimum cell proliferation and osteogenic differentiation was determined to be 10 and 12.5% by Liu et al (16).

HS is also obtained from the whole blood of patients, is safe for autologous use, and is abundantly available. Josh et al (47) used HS instead of FBS in the DMEM to demonstrate that HS is a viable alternative to FBS. As with adipose tissue, HS can be easily collected. As with PRP, HS also contains numerous growth factors, nutritive substances and other active factors, such as immunoglobulins, which may have a comprehensive effect on stem cell culture (48). For example, serum could provide nutrients needed for cell metabolism (49). Kobayashi et al (49) revealed that HS may be more optimal than FBS for human bone marrow growth.

In summary, 10% HS and 10% PRP improved ADSC preservation. Compared with 10% PRP, 10% HS may be more optimal. This may be since HS has characteristics that approximate more closely to the normal ADSC environment, and therefore is more suitable for ADSC activity. Activated PRP releases growth factors that rapidly stimulate ADSC growth, and this may be perceived as a potential cause of the results obtained in the cell proliferation assay where PRP appears to have a higher OD value (Fig. 4B). Over time, ADSCs in the 10% PRP group appeared to be too undernourished to maintain normal growth. Based on these results, 10% HS may be the best choice for the preservation of ADSCs. In addition, from the same quantity of whole blood, a larger quantity of HS is obtained compared with PRP, and the process of retrieving HS is more convenient than that of PRP, which reduces the risk of infection (20). In conclusion, the storage of ADSCs at 4°C in 10% HS was recommended. Furthermore, ADSCs should be used in ≤4 h.

The survival rate and stability of ADSCs declined over time. Optimal preservation of ADSCs allows their function to be fully exerted upon their clinical use. ADSCs should be used in <2 h, and no later than 4 h. If storage is required, 10% HS at 4°C should be used. No differences were obtained between individuals in each experiment (data not shown).

Several problems remain when extensively using ADSCs. Standardization is required in order to apply ADSCs more safely and rationally, and equipment involving the separation and culture of ADSCs in clinical use should be optimized.

Acknowledgements

Not applicable

Funding

The present study was supported by the National Nature and Science Foundation, P.R. China (grant nos. 81272100, 81372065 and 81871563), the major project of Guangzhou Municipal Science and Technology Bureau (grant nos. 201300000091 and 201508020253), and the Natural Science Foundation of Guangdong, P.R. China (grant no. S2013010015264).

Availability of data and materials

The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.

Authors' contributions

HL designed the study; YW and ML performed the experiments and wrote the manuscript; XL, SL, JY, LF, WS and JS analyzed the data.

Ethics approval and consent to participate

The protocol of the present study was approved by the Ethics Committee of The First Affiliated Hospital of Jinan University (Guangzhou, China). Informed consent was obtained from all subjects prior to study.

Patient consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

References

1 

Gimble JM, Katz AJ and Bunnell BA: Adipose-derived stem cell for regenerative medicine. Circ Res. 100:1249–1260. 2007. View Article : Google Scholar : PubMed/NCBI

2 

Bora P and Majumdar AS: Adipose tissue-derived stromal vascular fraction in regenerative medicine: A brief review on biology and translation. Stem Cell Res Ther. 8:1452017. View Article : Google Scholar : PubMed/NCBI

3 

Gimble JM: Adipose tissue-derived therapeutics. Expert Opin Biol Ther. 3:705–713. 2003. View Article : Google Scholar : PubMed/NCBI

4 

Baer PC and Geiger H: Adipose-derived mesenchymal stromal/stem cell: Tissue localization, characterization, and heterogeneity. Stem Cells Int 2012. 8126932012.

5 

Qiu X, Fandel TM, Ferretti L, Albersen M, Orabi H, Zhang H, Lin G, Lin CS, Schroeder T and Lue TF: Both immediate and delayed intracavernous injection of autologous adipose-derived stromal vascular fraction enhances recovery of erectile function in a rat model of cavernous nerve injury. Eur Urol. 62:720–727. 2012. View Article : Google Scholar : PubMed/NCBI

6 

Lin G, Garcia M, Ning H, Banie L, Guo YL, Lue TF and Lin CS: Defining stem and progenitor cell within adipose tissue. Stem Cells Dev. 17:1053–1063. 2008. View Article : Google Scholar : PubMed/NCBI

7 

Tobita M, Orbay H and Mizuno H: Adipose-derived stem cell: Current findings and future perspectives. Discov Med. 11:160–170. 2011.PubMed/NCBI

8 

Gonda K, Shigeura T, Sato T, Matsumoto D, Suga H, Inoue K, Aoi N, Kato H, Sato K, Murase S, et al: Preserved proliferative capacity and multipotency of human adipose-derived stem cell after long-term cryopreservation. Plast Reconstr Surg. 121:401–410. 2008. View Article : Google Scholar : PubMed/NCBI

9 

Gonzalez-Fernandez ML, Perez-Castrillo S, Ordas-Fernandez P, Lopez-Gonzalez ME, Colaco B and Villar-Suarez V: Study on viability and chondrogenic differentiation of cryopreserved adipose tissue-derived mesenchymal stromal cell for future use in regenerative medicine. Cryobiology. 71:256–263. 2015. View Article : Google Scholar : PubMed/NCBI

10 

Matsumoto D, Shigeura T, Sato K, Inoue K, Suga H, Kato H, Aoi N, Murase S, Gonda K and Yoshimura K: Influences of preservation at various temperatures on liposuction aspirates. Plast Reconstr Surg. 120:1510–1517. 2007. View Article : Google Scholar : PubMed/NCBI

11 

Saragusty J and Arav A: Current progress in oocyte and embryo cryopreservation by slow freezing and vitrification. Reproduction. 141:1–19. 2011. View Article : Google Scholar : PubMed/NCBI

12 

Saragusty J, Gacitua H, Rozenboim I and Arav A: Protective effects of iodixanol during bovine sperm cryopreservation. Theriogenology. 71:1425–1432. 2009. View Article : Google Scholar : PubMed/NCBI

13 

Bunnell BA, Flaat M, Gagliardi C, Patel B and Ripoll C: Adipose-derived stem cell: Isolation, expansion and differentiation. Methods. 45:115–120. 2008. View Article : Google Scholar : PubMed/NCBI

14 

Zhang F, Ren H, Shao X, Zhuang C, Chen Y and Qi N: Preservation media, durations and cell concentrations of short-term storage affect key features of human adipose-derived mesenchymal stem cells for therapeutic application. PeerJ. 5:e33012017. View Article : Google Scholar : PubMed/NCBI

15 

Higman MA, Port JD, Beauchamp NJ Jr and Chen AR: Reversible leukoencephalopathy associated with re-infusion of DMSO preserved stem cell. Bone Marrow Transplant. 26:797–800. 2000. View Article : Google Scholar : PubMed/NCBI

16 

Liu Y, Zhou Y, Feng H, Ma GE and Ni Y: Injectable tissue-engineered bone composed of human adipose-derived stromal cell and platelet-rich plasma. Biomaterials. 29:3338–3345. 2008. View Article : Google Scholar : PubMed/NCBI

17 

Shafaei H, Esmaeili A, Mardani M, Razavi S, Hashemibeni B, Nasr-Esfahani MH, Shiran MB and Esfandiari E: Effects of human placental serum on proliferation and morphology of human adipose tissue-derived stem cell. Bone Marrow Transplant. 46:1464–1471. 2011. View Article : Google Scholar : PubMed/NCBI

18 

Jalowiec JM, D'Este M, Bara JJ, Denom J, Menzel U, Alini M, Verrier S and Herrmann M: An in vitro investigation of platelet-rich plasma-gel as a cell and growth factor delivery vehicle for tissue engineering. Tissue Eng Part C Methods. 22:49–58. 2016. View Article : Google Scholar : PubMed/NCBI

19 

Weibrich G, Kleis WK, Hafner G and Hitzler WE: Growth factor levels in platelet-rich plasma and correlations with donor age, sex, and platelet count. J Craniomaxillofac Surg. 30:97–102. 2002. View Article : Google Scholar : PubMed/NCBI

20 

Freymann U, Degrassi L, Kruger JP, Metzlaff S, Endres M and Petersen W: Effect of serum and platelet-rich plasma on human early or advanced degenerative meniscus cells. Connect Tissue Res. 58:509–519. 2017. View Article : Google Scholar : PubMed/NCBI

21 

Bura A, Planat-Benard V, Bourin P, Silvestre JS, Gross F, Grolleau JL, Saint-Lebese B, Peyrafitte JA, Fleury S, Gadelorge M, et al: Phase I trial: The use of autologous cultured adipose-derived stroma/stem cell to treat patients with non-revascularizable critical limb ischemia. Cytotherapy. 16:245–257. 2014. View Article : Google Scholar : PubMed/NCBI

22 

Guo X, Li S, Ji Q, Lian R and Chen J: Enhanced viability and neural differential potential in poor post-thaw hADSCs by agarose multi-well dishes and spheroid culture. Hum Cell. 28:175–189. 2015. View Article : Google Scholar : PubMed/NCBI

23 

Gu H, Guo F, Zhou X, Gong L, Zhang Y, Zhai W, Chen L, Cen L, Yin S, Chang J and Cui L: The stimulation of osteogenic differentiation of human adipose-derived stem cell by ionic products from akermanite dissolution via activation of the ERK pathway. Biomaterials. 32:7023–7033. 2011. View Article : Google Scholar : PubMed/NCBI

24 

Wang J, Ye Y, Tian H, Yang S, Jin X, Tong W and Zhang Y: In vitro osteogenesis of human adipose-derived stem cell by coculture with human umbilical vein endothelial cell. Biochem Biophys Res Commun. 412:143–149. 2011. View Article : Google Scholar : PubMed/NCBI

25 

Visweswaran M, Schiefer L, Arfuso F, Dilley RJ, Newsholme P and Dharmarajan A: Wnt antagonist secreted frizzled-related protein 4 upregulates adipogenic differentiation in human adipose tissue-derived mesenchymal stem cell. PLoS One. 10:e1180052015. View Article : Google Scholar

26 

Li HX, Luo X, Liu RX, Yang YJ and Yang GS: Roles of Wnt/beta-catenin signaling in adipogenic differentiation potential of adipose-derived mesenchymal stem cell. Mol Cell Endocrinol. 291:116–124. 2008. View Article : Google Scholar : PubMed/NCBI

27 

Samuel S, Ahmad RE, Ramasamy TS, Karunanithi P, Naveen SV, Murali MR, Abbas AA and Kamarul T: Platelet-rich concentrate in serum free medium enhances osteogenic differentiation of bone marrow-derived human mesenchymal stromal cell. PeerJ. 4:e23472016. View Article : Google Scholar : PubMed/NCBI

28 

Bunnell BA, Estes BT, Guilak F and Gimble JM: Differentiation of adipose stem cell. Methods Mol Biol. 456:155–171. 2008. View Article : Google Scholar : PubMed/NCBI

29 

Wang X, Spandidos A, Wang H and Seed B: PrimerBank: A PCR primer database for quantitative gene expression analysis, 2012 update. Nucleic Acids Res. 40:D1144–D1149. 2012. View Article : Google Scholar : PubMed/NCBI

30 

Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods. 25:402–408. 2001. View Article : Google Scholar : PubMed/NCBI

31 

Frese L, Dijkman PE and Hoerstrup SP: Adipose tissue-derived stem cells in regenerative medicine. Transfus Med Hemother. 43:268–274. 2016. View Article : Google Scholar : PubMed/NCBI

32 

Martínez-González I, Cruz MJ, Moreno R, Morell F, Muñoz X and Aran JM: Human mesenchymal stem cell resolve airway inflammation, hyperreactivity, and histopathology in a mouse model of occupational asthma. Stem Cells Dev. 23:2352–2363. 2014. View Article : Google Scholar : PubMed/NCBI

33 

Won CH, Yoo HG, Kwon OS, Sung MY, Kang YJ, Chung JH, Park BS, Sung JH, Kim WS and Kim KH: Hair growth promoting effects of adipose tissue-derived stem cell. J Dermatol Sci. 57:134–137. 2010. View Article : Google Scholar : PubMed/NCBI

34 

Hernández-Bule ML, Martínez-Botas J, Trillo MÁ, Paíno CL and Úbeda A: Antiadipogenic effects of subthermal electric stimulation at 448 kHz on differentiating human mesenchymal stem cells. Mol Med Rep. 13:3895–3903. 2016. View Article : Google Scholar : PubMed/NCBI

35 

Rumiński S, Ostrowska B, Jaroszewicz J, Skirecki T, Włodarski K, Święszkowski W and Lewandowska-Szumieł M: Three-dimensional printed polycaprolactone-based scaffolds provide an advantageous environment for osteogenic differentiation of human adipose-derived stem cells. J Tissue Eng Regen Med. 12:e473–e485. 2018. View Article : Google Scholar : PubMed/NCBI

36 

Benazzo F, Botta L, Scaffino MF, Caliogna L, Marullo M, Fusi S and Gastaldi G: Trabecular titanium can induce in vitro osteogenic differentiation of human adipose derived stem cells without osteogenic factors. J Biomed Mater Res A. 102:2061–2071. 2014. View Article : Google Scholar : PubMed/NCBI

37 

Rada T, Reis RL and Gomes ME: Distinct stem cells subpopulations isolated from human adipose tissue exhibit different chondrogenic and osteogenic differentiation potential. Stem Cell Rev. 7:64–76. 2011. View Article : Google Scholar : PubMed/NCBI

38 

Smyth DC, Takenaka S, Yeung C and Richards CD: Oncostatin M regulates osteogenic differentiation of murine adipose-derived mesenchymal progenitor cells through a PKCdelta-dependent mechanism. Cell Tissue Res. 360:309–319. 2015. View Article : Google Scholar : PubMed/NCBI

39 

Regassa A, Suh M, Datar J, Chen C and Kim WK: Fatty acids have different adipogenic differentiation potentials in stromal vascular cells isolated from abdominal fat in laying hens. Lipids. 52:513–522. 2017. View Article : Google Scholar : PubMed/NCBI

40 

Nurden AT, Nurden P, Sanchez M, Andia I and Anitua E: Platelets and wound healing. Front Biosci. 13:3532–3548. 2008.PubMed/NCBI

41 

Whitman DH, Berry RL and Green DM: Platelet gel: An autologous alternative to fibrin glue with applications in oral and maxillofacial surgery. J Oral Maxillofac Surg. 55:1294–1299. 1997. View Article : Google Scholar : PubMed/NCBI

42 

Alsousou J, Thompson M, Hulley P, Noble A and Willett K: The biology of platelet-rich plasma and its application in trauma and orthopaedic surgery: A review of the literature. J Bone Joint Surg Br. 91:987–996. 2009. View Article : Google Scholar : PubMed/NCBI

43 

Nikolidakis D and Jansen JA: The biology of platelet-rich plasma and its application in oral surgery: Literature review. Tissue Eng Part B Rev. 14:249–258. 2008. View Article : Google Scholar : PubMed/NCBI

44 

Anitua E: Plasma rich in growth factors: Preliminary results of use in the preparation of future sites for implants. Int J Oral Maxillofac Implants. 14:529–535. 1999.PubMed/NCBI

45 

Drago L, Bortolin M, Vassena C, Romanò CL, Taschieri S and Del Fabbro M: Plasma components and platelet activation are essential for the antimicrobial properties of autologous platelet-rich plasma: An in vitro study. PLoS One. 9:e1078132014. View Article : Google Scholar : PubMed/NCBI

46 

Margolis DJ, Kantor J, Santanna J, Strom BL and Berlin JA: Effectiveness of platelet releasate for the treatment of diabetic neuropathic foot ulcers. Diabetes Care. 24:483–488. 2001. View Article : Google Scholar : PubMed/NCBI

47 

Josh F, Kobe K, Tobita M, Tanaka R, Suzuki K, Ono K, Hyakusoku H and Mizuno H: Accelerated and safe proliferation of human adipose-derived stem cell in medium supplemented with human serum. J Nippon Med Sch. 79:444–452. 2012. View Article : Google Scholar : PubMed/NCBI

48 

Adkins JN, Varnum SM, Auberry KJ, Moore RJ, Angell NH, Smith RD, Springer DL and Pounds JG: Toward a human blood serum proteome: Analysis by multidimensional separation coupled with mass spectrometry. Mol Cell Proteomics. 1:947–955. 2002. View Article : Google Scholar : PubMed/NCBI

49 

Kobayashi T, Watanabe H, Yanagawa T, Tsutsumi S, Kayakabe M, Shinozaki T, Higuchi H and Takagishi K: Motility and growth of human bone-marrow mesenchymal stem cell during ex vivo expansion in autologous serum. J Bone Joint Surg Br. 87:1426–1433. 2005. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Wu YD, Li M, Liao X, Li SH, Yan JX, Fan L, She WL, Song JX and Liu HW: Effects of storage culture media, temperature and duration on human adipose‑derived stem cell viability for clinical use. Mol Med Rep 19: 2189-2201, 2019.
APA
Wu, Y., Li, M., Liao, X., Li, S., Yan, J., Fan, L. ... Liu, H. (2019). Effects of storage culture media, temperature and duration on human adipose‑derived stem cell viability for clinical use. Molecular Medicine Reports, 19, 2189-2201. https://doi.org/10.3892/mmr.2019.9842
MLA
Wu, Y., Li, M., Liao, X., Li, S., Yan, J., Fan, L., She, W., Song, J., Liu, H."Effects of storage culture media, temperature and duration on human adipose‑derived stem cell viability for clinical use". Molecular Medicine Reports 19.3 (2019): 2189-2201.
Chicago
Wu, Y., Li, M., Liao, X., Li, S., Yan, J., Fan, L., She, W., Song, J., Liu, H."Effects of storage culture media, temperature and duration on human adipose‑derived stem cell viability for clinical use". Molecular Medicine Reports 19, no. 3 (2019): 2189-2201. https://doi.org/10.3892/mmr.2019.9842
Copy and paste a formatted citation
x
Spandidos Publications style
Wu YD, Li M, Liao X, Li SH, Yan JX, Fan L, She WL, Song JX and Liu HW: Effects of storage culture media, temperature and duration on human adipose‑derived stem cell viability for clinical use. Mol Med Rep 19: 2189-2201, 2019.
APA
Wu, Y., Li, M., Liao, X., Li, S., Yan, J., Fan, L. ... Liu, H. (2019). Effects of storage culture media, temperature and duration on human adipose‑derived stem cell viability for clinical use. Molecular Medicine Reports, 19, 2189-2201. https://doi.org/10.3892/mmr.2019.9842
MLA
Wu, Y., Li, M., Liao, X., Li, S., Yan, J., Fan, L., She, W., Song, J., Liu, H."Effects of storage culture media, temperature and duration on human adipose‑derived stem cell viability for clinical use". Molecular Medicine Reports 19.3 (2019): 2189-2201.
Chicago
Wu, Y., Li, M., Liao, X., Li, S., Yan, J., Fan, L., She, W., Song, J., Liu, H."Effects of storage culture media, temperature and duration on human adipose‑derived stem cell viability for clinical use". Molecular Medicine Reports 19, no. 3 (2019): 2189-2201. https://doi.org/10.3892/mmr.2019.9842
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team