Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Molecular Medicine Reports
Join Editorial Board Propose a Special Issue
Print ISSN: 1791-2997 Online ISSN: 1791-3004
Journal Cover
June-2020 Volume 21 Issue 6

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
June-2020 Volume 21 Issue 6

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Wnt2 overexpression protects against PINK1 mutant‑induced mitochondrial dysfunction and oxidative stress

  • Authors:
    • Sui‑Rui Xia
    • Xue‑Yi Wen
    • Xiao‑Li Fan
    • Xiao‑Rong Chen
    • Zai‑Wa Wei
    • Qing‑Hua Li
    • Li Sun
  • View Affiliations / Copyright

    Affiliations: Department of Hospital Infection‑Control, Nanxishan Hospital of Guangxi Zhuang Autonomous Region, Guilin, Guangxi 541002, P.R. China, Guangxi Key Laboratory of Brain and Cognitive Neuroscience, Guilin Medical University, Guilin, Guangxi 541004, P.R. China, Faculty of Basic Medical Sciences, Guilin Medical University, Guilin, Guangxi 541004, P.R. China
  • Pages: 2633-2641
    |
    Published online on: April 8, 2020
       https://doi.org/10.3892/mmr.2020.11066
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

The PTEN induced putative kinase 1 (PINK1) mutation is the second most common cause of autosomal recessive adolescent Parkinson's disease (PD). Furthermore, mitochondrial disorders and oxidative stress are important mechanisms in the pathogenesis of PD. Numerous members of the Wnt family have been found to be associated with neurodegenerative diseases. Therefore, the present study investigated the role of the Wnt2 gene in PINK1B9 transgenic flies, which is a PD model, and its underlying mechanism. It was identified that overexpression of Wnt2 reduced the abnormality rate of PD transgenic Drosophila and improved their flight ability, while other intervention groups had no significant effect. Furthermore, an increase in ATP concentration normalized mitochondrial morphology, and increased the mRNA expression levels of NADH‑ubiquinone oxidoreductase chain 1 (ND1), ND42, ND75, succinate dehydrogenase complex subunits B, Cytochrome b and Cyclooxygenase 1, which are associated with Wnt2 overexpression. Moreover, overexpression of Wnt2 in PD transgenic Drosophila resulted in the downregulation of reactive oxygen species and malondialdehyde production, and increased manganese superoxide dismutase (MnSOD), while glutathione was not significantly affected. It was found that overexpression of Wnt2 did not alter the protein expression of β‑catenin in PINK1B9 transgenic Drosophila, but did increase the expression levels of PPARG coactivator 1α (PGC‑1α) and forkhead box sub‑group O (FOXO). Collectively, the present results indicated that the Wnt2 gene may have a protective effect on PD PINK1B9 transgenic Drosophila. Thus, it was speculated that the reduction of oxidative stress and the restoration of mitochondrial function via Wnt2 overexpression may be related to the PGC‑1α/FOXO/MnSOD signaling pathway in PINK1 mutant transgenic Drosophila.

Introduction

PTEN-induced kinase 1 (PINK1) is located in the mitochondrial membrane, and helps to regulate mitochondrial morphology and autophagy (1). Mutations in PINK1 have been recognized to be the second most common cause of autosomal recessive adolescent Parkinson's disease (PD) (2). Loss of Drosophila PINK1 leads to mitochondrial morphological disorders and mitochondrial complex function damage (3). Furthermore, neurons are dependent on mitochondria, which act as the major energy producers (4). Therefore, when PINK1 is mutated, neurotoxicity is increased and this may be associated with mitochondrial defects, thus contributing to the loss of dopaminergic (DA) neurons (5). Oxidative stress is a prominent and common feature of all forms of PD, and may have a toxic effect that causes neuronal cell death (6). Moreover, oxidative stress in PD is closely associated with a series of pathogenic factors, including mitochondrial dysfunction, DA metabolism and metal ion dysregulation (7).

The human Wnt gene family, known as the wingless-type MMTV integration site family, consists of 19 members, and the interaction between Wnt1 and Wnt5a promotes the development of DA neurons in the midbrain (8). Moreover, the Wnt2 gene is one of the 19 Wnt family members that is highly expressed in the human thalamus, and plays an important role in the late development of human genes and the brain (9,10). A previous functional study has shown that Wnt2 promotes the migration of primitive neurons and increases the number of DA neurons (11), thus enhancing DA function in the midbrain, and affecting mRNA and protein expression levels. The Wnt signaling pathway can be cross-linked with a number of signaling pathways (12). The interaction of β-catenin with the forkhead box sub-group O (FOXO) signaling pathway can inhibit Huntington protein toxicity (13). Furthermore, the Wnt signaling pathway also regulates mitochondrial energy, metabolism and oxidative stress (14,15).

The present study selected Drosophila as the experiment model, as Drosophila genes have been fully sequenced and annotated, and are highly homologous to human genes (16,17). Compared with other models, the Drosophila life cycle is very short; therefore, it is easier to observe the whole process of disease development (18). Mature genetic systems, abundant strain resources and powerful genome editing techniques also make Drosophila one of the primary choices for genetic research in neurodegenerative diseases (19).

The present study identified that overexpression of Wnt2 gene had a significant effect on PINK1B9 transgenic Drosophila. While the Wnt pathway may have neuroprotective effects, the role of Wnt2 in neurodegenerative diseases remains unknown. Therefore, the aims of the present study were to investigate the function of Wnt2 in PINK1 mutant transgenic Drosophila, and to identify its association with the Wnt/β-catenin and PPARG coactivator 1α (PGC-1α)/FOXO/manganese superoxide dismutase (MnSOD) signaling pathways.

Materials and methods

Drosophila stocks

A total of five fly stocks were used: two stocks of Drosophila melanogaster (UAS-Wnt2OE and UAS-Wnt2RNAi) were purchased from the Bloomington Drosophila Stock Center. In total, three stocks (UAS-PINK1B9/FM7; MHC-Gal4, W1118 and MHC-GAL4) were provided by Institute of Life Sciences of Fuzhou University. W1118 is a wild-type genotype. UAS-Wnt2OE is a stock that overexpresses the Wnt2 gene. UAS-Wnt2RNAi is a Drosophila that has lost the function of the Wnt2 gene by using RNA interference technology. MHC-GAL4 is a Drosophila with an indirect flying muscle promoter. UAS-PINK1B9/FM7; MHC-Gal4 is a PD Drosophila model, in which the PINK1 mutation gene can be specifically expressed in indirect flying muscles. The classic GAL4/UAS system is divided into two parts: GAL4 and UAS. The GAL4 stock and UAS stock are two independent stocks (20). The fusion of GAL4 and tissue-specific promoter can regulate the expression of GAL4 protein in different tissues of Drosophila (21). Furthermore, UAS and target genes are fused to construct a transgenic line with a UAS-target gene (22). Only when the two hybridize, can GAL4 recognize the UAS promoter and induce expression of UAS downstream genes in specific tissues (23). Drosophila were placed in Drosophila culture tubes containing corn medium and cultured at a constant temperature of 25°C and 60% relative humidity.

Drosophila construction

The flies were driven via the muscular driver MHC-GAL4. MHC-GAL4 virgin flies were crossed with W1118 male flies, and the F1 generation genes were W1118/+; MHC-GAL4/+, which served as the control group. In the PINK1B9 disease group, UAS-PINK1B9/FM7; MHC-GAL4 virgin flies were crossed with W1118 male flies, which produced the F1 generation with a genotype of UAS-PINK1B9/+; MHC-GAL4/+. In the overexpression (OE) intervention group, UAS-PINK1B9/FM7; MHC-GAL4 virgin flies were hybridized with male flies of UAS-Wnt2OE, and the F1 generation genotype was UAS-PINK1B9/y; MHC-GAL4/Wnt2 OE, UAS-PINK1B9/y. In the RNA interference (RNAi) intervention group, UAS-PINK1B9/ FM7; MHC-GAL4 virgin flies were crossed with males of UAS-Wnt2 RNAi Drosophila, and the F1 generation obtained had the genotype UAS-PINK1B9/y; MHC-GAL4/Wnt2RNAi.

Morphological observation of Drosophila (24)

Flies carrying the MHC-GAL4/UAS systems were grouped as follows: Normal control group (W1118), disease control group (PINK1B9), Wnt2OE intervention group (PINK1B9; Wnt2OE) and Wnt2 knockdown intervention group (PINK1B9; Wnt2 RNAi). On day 5, ~100 male flies were selected from each group. After being anesthetized by CO2, the 100 flies were divided into transparent glass tubes with five flies per tube. After the flies completely woke up (after ~1 h), the shape of their wings and whether they could fly were observed. The number and the ratio of abnormal wings and flying were calculated. All assays were performed in triplicate and independently repeated three times.

Drosophila mRNA expression detection

The experimental groups were the same as aforementioned. On day 5, the head and abdomen were removed, and the chest was kept from 30 male flies from each group. TRIzol® reagent (Invitrogen; Thermo Fisher Scientific, Inc.) was used to extract the total RNA from the chest, according to the manufacturer's protocol. The primers were synthesized by Sangon Biotech Co., Ltd. and are presented in Table I. Subsequently, RNA samples were reverse transcribed into cDNA using PrimeScript™ reverse transcription (RT) reagent kit with gDNA Eraser (Takara Bio, Inc.). Following the manufacturer's instructions, this reaction was a two-step process. The first step was to remove the genomic DNA, adding 1 µl gDNA eraser and 2 µl gDNA eraser buffer to the RNA sample, which was then incubated at 42°C for 2 min. The second step was to synthesize cDNA by adding the 1 µl enzyme, 1 µl primer, 4 µl buffer and 4 µl RNase-free H2O to the 10 µl gDNA eraser-treated sample. The reaction temperature was 37°C for 15 min and 85°C for 5 sec. Quantitative PCR (qPCR) was conducted using an Applied Biosystems ABI 7500 system (Thermo Fisher Scientific, Inc.) using Power SYBR® Green PCR Master mix (Thermo Fisher Scientific, Inc.). The RT PCR conditions were as follows: Initial denaturation at 50°C for 20 sec and 95°C for 10 min, followed by 40 cycles of 95°C for 15 sec; annealing at 60°C for 1 min and extension at 72°C for 1 min. Moreover, 18S served as an endogenous control for data normalization. The 2−ΔΔCq method (25) was used to analyze the relative expression.

Table I.

Primer sequences used in the reverse transcription-quantitative PCR assay.

Table I.

Primer sequences used in the reverse transcription-quantitative PCR assay.

GenePrimer sequence (5′à3′)
18SForward: TCTAGCAATATGAGATTGAGCAATAAG
Reverse: AATACACGTTGATACTTTCATTGTAGC
ND1Forward: GTTATAGTAGCTGGTTGGTCGTC
Reverse: AAGGAGTCCGATTAGTTTCAGC
ND42Forward: CAAGAAGATGCTCGACTGGC
Reverse: TGTCTGCATTGTAGCCAGGA
ND75Forward: AAGCTCTTCCTTACCGAACTG
Reverse: ATCGATGCTGCTCACCTTAC
sdhBForward: CCATCGCCGAGATCAAGAAG
Reverse: GGGACGAACTGGGAGTAGA
cytbForward: GGATACGTATTACCTTGAGGACAAA
Reverse: CAACAGCAAATCCACCTCATAATC
COX1Forward: TGGTGGATTTGGAAATTGATTAGTG
Reverse: GTAAAGAAAGAGCAGGAGGTAGAA
PGC-1αForward: AAGACGTGCCTTCTGTCGTTCATC
Reverse: ATTCGGTGCTGGTGCTTCCTTG
FOXOForward: CTCATCCAATGCCAGTTCCT
Reverse: TCATCGTTGTGTTCTGGTAGTC

[i] ND, NADH-ubiquinone oxidoreductase chain 1; sdhB, succinate dehydrogenase complex subunits B; cytb, Cytochrome b; COX1, Cyclooxygenase 1; PGC-1α, PPARG coactivator 1α; FOXO, forkhead box sub-group O.

Western blotting for detection of protein expression

Drosophila grouping was the same as aforementioned. The the chest tissue of 20 Drosophila was cut on ice. Fresh tissues were lysed with 200 µl ice-cold RIPA buffer (Solarbio Science & Technology Co., Ltd.) containing 1 mM phenylmethylsulfonyl fluoride (Beijing Solarbio Science & Technology Co., Ltd.). Subsequently, tissues were ground to a homogenate, followed by centrifugation at 14,000 × g for 15 min at 4°C. Then, 120 µl supernatant liquid was collected and added to 40 µl 4Xloading buffer (Beijing Solarbio Science & Technology Co., Ltd.), mixed and boiled at 100°C for 10 min. The samples were stored at −20°C prior to further experiments.

For analytical SDS-PAGE, 10 µl protein was loaded per lane to 5% concentrated gel (30% acrylamide, 10% SDS; 10% APS; 1 M Tris-HCl pH 6.8; TEMED) and dissociated in 10% separation gel (30% acrylamide; 10% SDS; 10% APS; 1.5 M Tris-HCl pH 8.8; TEMED). The proteins were then transferred to 0.2-µm PVDF membranes (Beijing Solarbio Science and Technology Co., Ltd.), blocked in 5% milk for 2 h at room temperature and washed in TBS-T (TBS, 3 M NaCl, 200M Tris; pH 7.5, containing 0.1% Tween-20). Subsequently, overnight incubation at 4°C was performed with the following primary antibodies: Rabbit anti-MnSOD (1:1,000; cat. no. ab13534; Abcam; polyclonal), rabbit anti-α tubulin (1:1,000; cat. no. ab52866; Abcam; monoclonal) and mouse anti-β-catenin (1:1,000; cat. no. AB_528089; Developmental Studies Hybridoma Bank; monoclonal). All the primary antibodies were Drosophila-specific. Following washing with TBS-T, the membrane was incubated with the corresponding secondary antibody, horseradish peroxidase-AffiniPure Goat Anti-Rabbit/Mouse IgG (H+L; 1:5,000; cat. nos. EM35111–01 and EM35110-01; Emarbio Science and Technology Co., Ltd.), for 1 h at room temperature. All the resulting immune complexes were visualized with chemiluminescence reagent (Thermo Fisher Scientific, Inc.,), followed by imaging using Image Lab 5.1 (National Institutes of Health). The target protein bands were quantified by scanning densitometry using ImageJ software (v.1.49v; National Institutes of Health).

ATP, malondialdehyde (MDA) and reactive oxygen species (ROS)

In total, ten Drosophila thoraxes were cut on ice from each group, and 1,000 µl lysate was added to homogenize the chest tissue on ice. Samples were then heated at 100°C for 2 min and centrifuged at 12,000 × g for 5 min at 4°C. The thoracic ATP level was measured using a luciferase-based bioluminescence assay (cat. no. S0027; Beyotime Institute of Biotechnology). Then, 40 fly chests from each group were ground by adding 500 µl 1X PBS and centrifuge at 1,425 × g for 10 min at 4°C. The supernatant was collected and the MDA content was measured by the thiobarbituric acid method (26). Analyses were performed according to the instructions of the reagent kit for MDA (cat. no. A003-1-2; Nanjing Jiancheng Bioengineering Institute). ROS were measured using the CellROX Orange reagent (cat. no. BB-470512; Shanghai Bio-Tech Co., Ltd.). The thoraxes of 30 Drosophila were obtained, homogenized, centrifuged at 1,000 × g for 10 min at 4°C and the supernatant was collected. The supernatant and 20 µM CellROX Orange Reagent were mixed and incubated at 37°C in the dark for 30 min, and the fluorescence intensity at 510 and 610 nm (maximum excitation light and maximum emission wavelength) was measured using a multi-function microplate reader.

Transmission electron microscopy analysis

Drosophila was grouped as aforementioned, and 10 male flies from each group F1 generation were randomly selected on day 5. Flies were anesthetized by CO2, and the chest was cut carefully so as not to damage the muscle tissue. Thoraxes were fixed overnight at 4°C in 2.5% glutaraldehyde, washed several times with 0.1 mol/l phosphate buffer and post-fixed in 1% osmiumtetroxide in distilled water for 2 h at room temperature. The samples were dehydrated in a 50, 70 and 90% graded ethanol series, and embedded in Epoxy resin for 48 h at room temperature. The polymerization conditions in the polymerization tank were 36°C for 24 h, 45°C for 12 h and 65°C for 48 h.

The embedded polymer samples were cut into 1 µm sections using a Leica UC7 ultrathin slicer, stained with 1% toluidine blue for 30 sec at room temperature and observed under an optical microscope (magnification, ×100). The samples were then cut into ultra-thin sheets (70 nm), stained with 3% uranyl acetate for 15 min at room temperature and 3% lead citrate for 15 min at room temperature. Sections were observed with a Hitachi H-7650 transmission electron microscope (magnification, ×30,000).

Statistical analysis

Statistical analysis of data was performed using SPSS 16.0 (IBM Corp.). Normally distribution continuous variable data were compared by one-way ANOVA followed by Bonferroni's post hoc test. Data are presented as the mean ± SD. P<0.05 was considered to indicate a statistically significant difference.

Results

Wnt2 overexpression rescues the abnormal phenotype caused by PINK1B9 mutation

The Wnt2 gene was specifically expressed in Drosophila flight muscles using the MHC-GAL4 promoter. The phenotypic changes of Drosophila were demonstrated by changes in wing morphology and flight ability. In the normal control group, most of the wings completely overlapped and were parallel to the body (Fig. 1A). However, in the transgenic disease model of PINK1B9 the wings had bifurcations, erections and sagged. Furthermore, compared with the low rate of abnormal wings in the control group, the disease group had a significantly higher rate of abnormal wings (Fig. 1B) and a significant decrease in flight ability (Fig. 1C). In the Wnt2OE intervention group, the incidence of wing anomalies was significantly reduced and the flight capabilities were improved, compared with the disease group. Moreover, there were no significant differences between the Wnt2 RNAi intervention group and the PD disease model group. Therefore, the present results suggested that Wnt2OE may have a protective effect on the phenotype of PINK1B9 transgenic Drosophila.

Figure 1.

Wnt2 overexpression suppresses PINK1B9 mutant phenotypes. (A) Side view of Drosophila wings. (Aa) Control flies, (Ab) PINK1B9 flies, (Ac) Wnt2OE flies and (Ad) Wnt2RNAi flies. Both (B) wing phenotype and (C) flying ability were abnormal in PINK1B9 flies. Abnormal wing phenotype and flying rate was restored in Wnt2OE flies compared with in PINK1B9 flies. n=20, 5-day-old males. *P<0.05 vs. the control flies. #P<0.05 vs. the PINK1B9 flies. ns vs. the PINK1B9 flies. PINK1, PTEN induced putative kinase 1; Wnt2OE, Wnt2 overexpression; Wnt2RNAi, Wnt2 RNA interference; ns, not significant.

Wnt2 gene overexpression enhances mitochondrial function in PINK1B9 transgenic Drosophila

RT-qPCR results demonstrated that in PINK1B9 disease model group, the mRNA expression levels of the mitochondrial complex subunit-related genes, Complex I [NADH-ubiquinone oxidoreductase chain 1 (ND1), ND42 and ND75], Complex II (succinate dehydrogenase complex subunits B), Complex III (Cytochrome b) and Complex IV (Cyclooxygenase 1), decreased significantly. While Wnt2OE intervention in PINK1B9 transgenic Drosophila increased the mRNA expression levels of these related genes (P<0.05), in the Wnt2 RNAi intervention group there was no significant difference compared with the disease model group (Fig. 2A). The results of the ATP assay demonstrated that ATP production in the PD model group was decreased. Furthermore, the amount of ATP produced by mitochondria in the Wnt2OE intervention group was ~1.5 times higher compared with the disease model group (Fig. 2B). Ultrastructural transmission electron microscopy analysis identified that mitochondria were disrupted in PINK1B9 transgenic Drosophila, and mitochondrial morphology was not recognizable. Moreover, Wnt2OE could rescue mitochondrial defects in PINK1B9 flies (Fig. 2C). Therefore, the present results suggested that overexpression of Wnt2 can improve the mitochondrial function of PINK1B9 transgenic Drosophila.

Figure 2.

Overexpression of Wnt2 rescues mitochondrial function. (A) Overexpression of Wnt2 increased mitochondrial complex subunit-related genes. (Aa) mRNA level of mitochondrial complex subunit ND1, ND42 and ND75, (Ab) mRNA level of mitochondrial complex subunit sdhB, cytb and COX-1. (B) ATP levels in flies. (C) Abnormal mitochondrial morphology of PINK1B9 flies was restored by Wnt2 overexpression. (Ca) Control flies, (Cb) PINK1B9 flies, (Cc) Wnt2OE flies and (Cd) Wnt2RNAi flies. Magnification, ×30,000. Scale bar, 1 µm. n=30, 5-day-old males. *P<0.05 vs. the control flies. #P<0.05 vs. the PINK1B9 flies. ns vs. the PINK1B9 flies. PINK1, PTEN induced putative kinase 1; Wnt2OE, Wnt2 overexpression; Wnt2RNAi, Wnt2 RNA interference; ns, not significant; ND, NADH-ubiquinone oxidoreductase chain 1; sdhB, succinate dehydrogenase complex subunits B; cytb, Cytochrome b; COX1, Cyclooxygenase 1.

Wnt2OE reduces oxidative stress damage in PINK1B9 transgenic Drosophila

ROS production in the PINK1B9 disease model group was significantly higher compared with the normal control group (P<0.05; Fig. 3A). Furthermore, following Wnt2OE intervention in PINKB9 transgenic Drosophila, ROS production was significantly reduced (P<0.05) and almost returned to normal levels. MDA, a commonly used indicator of lipid peroxidation injury (27), was significantly increased in the PINK1B9 disease model group compared with the normal control (P<0.05; Fig. 3B). Moreover, after Wnt2OE intervention, MDA production was reduced (P<0.05). It was demonstrated that the content of ROS and MDA were not significantly different between the Wnt2RNAi intervention groups and the disease model group (Fig. 3A and B).

Figure 3.

Wnt2 overexpression alleviates oxidative stress in PINK1B9 flies. (A) ROS levels. (B) MDA levels. (C) Protein expression levels of MnSOD were quantified by western blotting. (Ca) Western blot analysis of MnSOD protein, (Cb) Relative quantitative analysis of MnSOD protein. n=40, 5-day-old males. *P<0.05 vs. the control flies. #P<0.05 vs. the PINK1B9 flies. ns vs. the PINK1B9 flies. ROS, reactive oxygen species; MDA, malondialdehyde; MnSOD, manganese superoxide dismutase; PINK1, PTEN induced putative kinase 1; Wnt2OE, Wnt2 overexpression; Wnt2RNAi, Wnt2 RNA interference; ns, not significant.

Western blot analysis results revealed that the protein expression of MnSOD in the PINK1B9 disease model group was significantly lower compared with the normal control group (P<0.05; Fig. 3C). However, the expression of MnSOD was significantly increased (P<0.05) following Wnt2OE intervention in the PINK1B9 disease model. Collectively, the present results indicated that Wnt2 overexpression reduced oxidative damage in PINK1B9 transgenic Drosophila.

Possible mechanism of Wnt2 overexpression-mediated protection

Western blot analysis results revealed that there was no significant difference in the protein expression of β-catenin, a key molecule of the classic Wnt/β-catenin signaling pathway (28), between each group (Fig. 4A). Moreover, RT-qPCR showed that the mRNA expression levels of FOXO and PGC-1α were decreased in the PINK1B9 disease model group, and were increased following Wnt2OE intervention in the PINK1B9 disease model (Fig. 4B). Therefore, it can be speculated that Wnt2 may activate the FOXO/PGC-1α signaling pathway to regulate mitochondrial function and inhibit anti-oxidative stress-induced damage.

Figure 4.

Wnt2 overexpression activates the FOXO/PGC-1α pathway to protect PINK1B9 flies. (A) Protein expression of β-catenin was quantified by western blotting. (Aa) Western blot analysis of β-catenin protein, (Ab) Relative quantitative analysis of β-catenin protein. (B) mRNA expression levels of PGC-1α and FOXO were detected by reverse transcription-quantitative PCR. n=30, 5-day-old males. *P<0.05 vs. the control flies. #P<0.05 vs. the PINK1B9 flies. ns vs. the PINK1B9 flies. PINK1, PTEN induced putative kinase 1; Wnt2OE, Wnt2 overexpression; Wnt2RNAi, Wnt2 RNA interference; PGC-1α, PPARG coactivator 1α; FOXO, forkhead box sub-group O; ns, not significant.

Discussion

In Drosophila melanogaster, mutations in PINK1 causes phenotypic abnormalities and decrease exercise capacity, resulting in dysfunction of mitochondria and decreased ATP levels, which leads to selective degeneration of DA neurons and sensitivity to stress (16,17). In the present study, the disease model demonstrated a pathological phenotype that was consistent with previous experimental results (24,29), including a high abnormal wing rate, low flight rate, lower mRNA expression of mitochondrial complex subunits and lower ATP level, which suggested that PINK1 mutations could cause serious damage in mitochondria. Furthermore, overexpression of Wnt2 gene rescued the phenotype of PINK1B9 transgenic Drosophila, increased ATP production level and enhanced the expression of the mitochondrial biosynthesis-related gene PGC-1α. PGC-1α is a transcriptional cofactor for numerous mitochondrial proteins, which can regulate mitochondrial function to meet cellular needs and protect from oxidative damage (30). Therefore, it is speculated that Wnt2OE inhibited mitochondrial dysfunction caused by the PINK1 mutation and eventually protects PINK1B9 transgenic fruit flies.

When mitochondria are damaged, particularly damage to the mitochondrial respiratory chain complex, electron chain leakage may occur and cause the production of superoxide and hydrogen peroxide (31). These products, not only participate in the damage of DNA, proteins and lipids, but also pose a serious threat to cells and tissues (31). Mitochondrial dysfunction and oxidative stress play key roles in the development of PD, as both lead to excessive ROS production (32). This in turn leads to damage and death of DA neurons (33). A small level of ROS is essential for normal physiological functions; however, the accumulation of large amounts of ROS further destroys mitochondria and exacerbates oxidative stress (34). It has been shown that maintenance of ATP and inhibition of ROS production protects DA neurons (35). Reactive oxygen damages polyunsaturated lipids and forms MDA, which is a marker of lipid damage in oxidative stress (36). Furthermore, the present results indicated that the PINK1 mutation increased ROS and MDA levels, but reduced MnSOD protein expression.

MnSOD, which is mainly distributed in the mitochondrial matrix, is an important scavenger for the superoxide anion that is produced during mitochondrial oxidative phosphorylation (37). Previous findings have shown that overexpression of MnSOD serves an important role in the protection of PINK1-mutant PD Drosophila (38). In the PINK1 mutants, the present study identified increased ROS and MDA production, and a reduced MnSOD, thus suggesting that the PINK1 mutation leads to oxidative stress damage. Moreover, overexpression of Wnt2 improved mitochondrial function, which also partially reduced ROS production. However, Wnt2 overexpression also appeared to directly participate in the regulation of oxidative stress levels in PINK1B9 transgenic Drosophila, as it not only reduced ROS and MDA production levels, but also increased the protein expression levels of MnSOD.

The Drosophila gene Wnt2, homologous to the human gene Wnt7a, is involved in the Wnt/β-catenin signaling pathway (39). However, it remains unknown whether the protective effect of Wnt2 overexpression on PINK1B9 transgenic Drosophila is related to the Wnt/β-catenin signaling pathway. The present results indicated that Wnt2 overexpression did not increase the protein expression of β-catenin, a key protein of the Wnt/β-catenin signaling pathway (28), which suggested that it did not protect PINK1B9 transgenic flies via the Wnt/β-catenin signaling pathway. Furthermore, a previous study found that Wnt2 does not act via the Wnt/β-catenin pathway, but activates the non-canonical pathway (40). Thus, this raises the question of how Wnt2 improves mitochondrial function, reduces oxidative damage and enhances antioxidant capacity. The present study evaluated the expression of FOXO, a gene associated with mitochondrial oxidative stress, which regulates the expression levels of PGC-1α and MnSOD (38,41). Under conditions of mitochondrial dysfunction and oxidative stress caused by PINK1 mutation, the present study hypothesized that the overexpression of Wnt2 directly regulates the expression of PGC-1α/FOXO/MnSOD, improves mitochondrial function and improves antioxidant capacity to rescue PINK1B9 transgenic fruit flies.

The FOXO family members are key regulators of neuronal processes, such as dendritic structural function and memory consolidation (42,43). FOXO is also an important regulator of cellular stress response, which enhances cellular antioxidant defenses (44). A previous study revealed that the expression of genes, such as MnSOD, could be controlled by the forkhead transcription factor FOXO3a (44). Moreover, PGC-1α has been shown to regulate FOXO activity in different systems. For example, it has been reported that PGC-1α is a positive regulator of fasting-induced hepatic gluconeogenesis, which is mediated by its interaction with FOXO1a (45). Similarly, overexpression of PGC-1α enhances the stimulatory effect of FOXO1a on selenoprotein P promoter activity and insulin attenuation (46). PGC-1α has also been shown to interact with FOXO3a, which regulates antioxidant gene expression in endothelial cells and skeletal muscle (47). In addition, upregulation of PGC-1α and FOXO3a protects against oxidative stress injury induced by a high-fat diet and inhibits adipocyte apoptosis (47,48). The Wnt signaling pathway is also involved in the regulation of mitochondrial energy metabolism and oxidative stress (49). When ROS levels exceed the body's ability to scavenge, Wnt and β-catenin interact with FOXO under stimuli of oxidative stress (13,50). Furthermore, FOXO1 interacts with PGC-1α in different systems (45,46). PGC-1α is a mitochondrial energy-metabolizing enzyme. When ROS are in excess, the human body can enhance the detoxification ability of mitochondrial ROS by increasing the expression levels of FOXO1 and PGC-1α to promote the expression of downstream antioxidant systems, such as MnSOD (49).

To the best of our knowledge, the condition of mitochondrial dysfunction caused by PINK1 mutation and oxidative stress remains to be determined. Although the Wnt signaling pathway is linked to the FOXO signaling pathway via β-catenin (50), the present results suggested that Wnt2 did not change the β-catenin protein expression level, but did affect the mRNA expression levels of PGC-1α and FOXO, and the expression levels of their target protein MnSOD. Based on these results, it can be speculated that Wnt2 may be directly involved in the PGC-1α/FOXO/MnSOD signaling pathway; however, the specific mechanism remains to be investigated. Moreover, the regulation of signaling pathways is complex and there will be cross-effects between the pathways (47–48), with both upregulation and inhibition of the expression of related factors leading to cascade reactions. Therefore, it will be beneficial to examine how the Wnt2 pathway interacts with or influences the PGC-1α/FOXO/MnSOD pathway in future experiments.

The present study demonstrated that Wnt2 overexpression protected PINK1B9 transgenic flies by improving flight muscle and mitochondrial morphology, and enhancing mitochondrial complex I and II function. Furthermore, it was found that Wnt2 overexpression exhibited a protective effect on early mitochondria and oxidative stress-related PD by improving mitochondrial function and reducing oxidative stress damage. However, the present study does have some limitations. First, the model is monotonous and limited to fruit flies, and thus requires further examination in higher animal models such as mice. Secondly, further research into the underlying pathways and mechanisms is required, such as whether it is the experimental effects that are related to the non-classical Wnt signaling pathway. Furthermore, how Wnt2 cross-links with the PGC-1α/FOXO/MnSOD signaling pathway is not fully understood. In the PINK1 mutant PD Drosophila model of mutation constructed by Park et al (24), mitochondrial dysfunction and oxidative stress injury are primarily exhibited in the early stage, while DA neuronal loss predominantly occurs in the middle and late stages of the Drosophila, which is after 25 days (24,50). This is consistent with the progressive DA neuronal loss observed in clinical patients with PD. Thus, this may indicate that damage to DA neurons in PD is the result of further neurological damage caused by these pathogenic factors.

To the best of our knowledge, there are currently no treatments that mitigate disease progression or prevent neurodegeneration in all neurodegenerative disease. Therefore, it is necessary to develop interventions that are effective prior to severe damage of the neuronal in the early stages of PD. The present results indicated that Wnt2 overexpression had a protective effect on early mitochondrial damage and oxidative stress in PD, improving mitochondrial function and reducing oxidative stress damage. Due to the limitations of the present study, the specific mechanism of action of Wnt2 is not fully understood. However, the improvement of mitochondrial function and the reduction of oxidative stress damage can support the experimental results of the Drosophila model, providing a strong basis for future experiments.

In conclusion, the present results suggested that the Wnt2 gene may have a protective effect on PINK1B9 transgenic Drosophila. Therefore, it can be hypothesized that the reduction of oxidative stress and the restoration of mitochondrial function via Wnt2 gene overexpression in the PINK1 mutant transgenic Drosophila may be related to the PGC-1α/FOXO/MnSOD signaling pathway.

Acknowledgements

The authors would like to thank Dr Yu-Feng Yang, from Institute of life Sciences of Fuzhou University, for donating the PINK1B9 Drosophila model; Dr Ru-Jia Liao, Dr Jing-Xin Mo and Dr Qing-Tuan Meng, from Guangxi Clinical Research Center for Neurological Disease of Affliated Hospital of Guilin Medical University, for sharing their expertise; Miss Liang-Xian Li, intermediate research assistant, from Guangxi Key Laboratory of Brain and Cognitive Neuroscience of Guilin Medical University; Miss Ying Cui and Miss Xiao-Jun Diao, PhD candidate, Department of Neurology from Xiangya School of Medicine of Central South University; Miss Wen-Jing Wang, postgraduate student, Department of Neurology from Guilin Medical University; Miss Fang Shi (intermediate research assistant), Miss Ning Tian (inter- mediate research assistant) and Miss Mei-Rong Chen (intermediate research assistant), from Guangxi Clinical Research Center for Neurological Disease of Affliated Hospital of Guilin Medical University, for their help.

Funding

The present study was supported by the National Natural Science Foundation of China (grant nos. 81460180 and 31460256), 2017 Youth and Middle School Teachers' Basic Ability Improvement Project of the Education Department of Guangxi Zhuang Autonomous Region (grant no. 30606017018) and the Innovation Project of Guangxi Graduate Education (grant no. YCSW2018206).

Availability of data and materials

The datasets used and/or analyzed during the present study are available from the corresponding author on reasonable request.

Authors' contributions

SRX was responsible for construction of the Drosophila models, western blotting, MDA and ROS level determination, and data analysis. XYW was responsible for construction of the Drosophila models, morphological observation of Drosophila, O2K detection and data statistics. SRX and XYW wrote the first draft of this article. XLF was responsible for electron microscopy analysis. XRC performed the ATP determination experiment. ZWW was responsible for mRNA expression level detection. QHL and LS undertook project funding, project design, manuscript revision and quality control. All authors read and approved the final manuscript.

Ethics approval and consent to participate

Not applicable.

Patient consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

References

1 

Zhou C, Huang Y, Shao Y, May J, Prou D, Perier C, Dauer W, Schon EA and Przedborski S: The kinase domain of mitochondrial PINK1 faces the cytoplasm. Proc Natl Acad Sci USA. 105:12022–12027. 2008. View Article : Google Scholar : PubMed/NCBI

2 

Hatano Y, Li Y, Sato K, Asakawa S, Yamamura Y, Tomiyama H, Yoshino H, Asahina M, Kobayashi S, Hassin-Baer S, et al: Novel PINK1 mutations in early-onset parkinsonism. Ann Neurol. 56:424–427. 2004. View Article : Google Scholar : PubMed/NCBI

3 

Liu S, Sawada T, Lee S, Yu W, Silverio G, Alapatt P, Millan I, Shen A, Saxton W, Kanao T, et al: Parkinson's disease-associated kinase PINK1 regulates Miro protein level and axonal transport of mitochondria. PLoS Genet. 8:e10025372012. View Article : Google Scholar : PubMed/NCBI

4 

Wang W, Wang X, Fujioka H, Hoppel C, Whone AL, Caldwell MA, Cullen PJ, Liu J and Zhu X: Parkinson's disease-associated mutant VPS35 causes mitochondrial dysfunction by recycling DLP1 complexes. Nat Med. 22:54–63. 2016. View Article : Google Scholar : PubMed/NCBI

5 

Wu Z, Wang Y, Lim J, Liu B, Li Y, Vartak R, Stankiewicz T, Montgomery S and Lu B: Ubiquitination of ABCE1 by NOT4 in response to mitochondrial damage links co-translational quality control to PINK1-directed mitophagy. Cell Metab. 28:130–144.e7. 2018. View Article : Google Scholar : PubMed/NCBI

6 

Oh SE, Park HJ, He L, Skibiel C, Junn E and Mouradian MM: The Parkinson's disease gene product DJ-1 modulates miR-221 to promote neuronal survival against oxidative stress. Redox Biol. 19:62–73. 2018. View Article : Google Scholar : PubMed/NCBI

7 

Burbulla LF, Song P, Mazzulli JR, Zampese E, Wong YC, Jeon S, Santos DP, Blanz J, Obermaier CD, Strojny C, et al: Dopamine oxidation mediates mitochondrial and lysosomal dysfunction in Parkinson's disease. Science. 357:1255–1261. 2017. View Article : Google Scholar : PubMed/NCBI

8 

Andersson ER, Saltó C, Villaescusa JC, Cajanek L, Yang S, Bryjova L, Nagy II, Vainio SJ, Ramirez C, Bryja V, et al: Wnt5a cooperates with canonical Wnts to generate midbrain dopaminergic neurons in vivo and in stem cells. Proc Natl Acad Sci USA. 110:E602–E610. 2013. View Article : Google Scholar : PubMed/NCBI

9 

Sousa KM, Villaescusa JC, Cajanek L, Ondr JK, Castelo-Branco G, Hofstra W, Bryja V, Palmberg C, Bergman T, Wainwright B, et al: Wnt2 regulates progenitor proliferation in the developing ventral midbrain. J Biol Chem. 285:7246–7253. 2010. View Article : Google Scholar : PubMed/NCBI

10 

Marui T, Funatogawa I, Koishi S, Yamamoto K, Matsumoto H, Hashimoto O, Jinde S, Nishida H, Sugiyama T, Kasai K, et al: Association between autism and variants in the wingless-type MMTV integration site family member 2 (WNT2) gene. Int J Neuropsychopharmacol. 13:443–449. 2010. View Article : Google Scholar : PubMed/NCBI

11 

Zhang X, Abreu JG, Yokota C, MacDonald BT, Singh S, Coburn KL, Cheong SM, Zhang MM, Ye QZ, Hang HC, et al: Tiki1 is required for head formation via Wnt cleavage-oxidation and inactivation. Cell. 149:1565–1577. 2012. View Article : Google Scholar : PubMed/NCBI

12 

Kahn M: Can we safely target the WNT pathway? Nat Rev Drug Discov. 13:513–532. 2014. View Article : Google Scholar : PubMed/NCBI

13 

Parker JA, Vazquez-Manrique RP, Tourette C, Farina F, Offner N, Mukhopadhyay A, Orfila AM, Darbois A, Menet S, Tissenbaum HA, et al: Integration of β-catenin, sirtuin, and FOXO signaling protects from mutant huntingtin toxicity. J Neurosci. 32:12630–12640. 2012. View Article : Google Scholar : PubMed/NCBI

14 

Arrázola MS, Ramos-Fernández E, Cisternas P, Ordenes D and Inestrosa NC: Wnt signaling prevents the Aβ oligomer-induced mitochondrial permeability transition pore opening preserving mitochondrial Structure in hippocampal neurons. PLoS One. 12:e01688402017. View Article : Google Scholar : PubMed/NCBI

15 

Wei L, Ding L, Mo MS, Lei M, Zhang L, Chen K and Xu P: Wnt3a protects SH-SY5Y cells against 6-hydroxydopamine toxicity by restoration of mitochondria function. Transl Neurodegener. 4:112015. View Article : Google Scholar : PubMed/NCBI

16 

Yang Y, Gehrke S, Imai Y, Huang Z, Ouyang Y, Wang JW, Yang L, Beal MF, Vogel H and Lu B: Mitochondrial pathology and muscle and dopaminergic neuron degeneration caused by inactivation of Drosophila Pink1 is rescued by Parkin. Proc Natl Acad Sci USA. 103:10793–10798. 2006. View Article : Google Scholar : PubMed/NCBI

17 

Liu W, Acín-Peréz R, Geghman KD, Manfredi G, Lu B and Li C: Pink1 regulates the oxidative phosphorylation machinery via mitochondrial fission. Proc Natl Acad Sci USA. 108:12920–12924. 2011. View Article : Google Scholar : PubMed/NCBI

18 

Dung VM and Thao DTP: Parkinson's Disease Model. Adv Exp Med Biol. 1076:41–61. 2018. View Article : Google Scholar : PubMed/NCBI

19 

Bilder D and Irvine KD: Taking stock of the Drosophila research ecosystem. Genetics. 206:1227–1236. 2017. View Article : Google Scholar : PubMed/NCBI

20 

Barwell T, DeVeale B, Poirier L, Zheng J, Seroude F and Seroude L: Regulating the UAS/GAL4 system in adult Drosophila with Tet-off GAL80 transgenes. PeerJ. 5:e41672017. View Article : Google Scholar : PubMed/NCBI

21 

Southall TD, Elliott DA and Brand AH: The GAL4 system: A versatile toolkit for gene expression in Drosophila. CSH Protoc. doi:10.1101/pdb.top49.

22 

Tu H and Casadaban MJ: The upstream activating sequence for L-leucine gene regulation in Saccharomyces cerevisiae. Nucleic Acids Res. 18:3923–3931. 1990. View Article : Google Scholar : PubMed/NCBI

23 

Robertson LK, Dey BK, Campos AR and Mahaffey JW: Expression of the drosophila gene disconnected using the UAS/GAL4 system. Genesis. 34:103–106. 2002. View Article : Google Scholar : PubMed/NCBI

24 

Park J, Lee SB, Lee S, Kim Y, Song S, Kim S, Bae E, Kim J, Shong M and Kim JM: Mitochondrial dysfunction in Drosophila PINK1 mutants is complemented by parkin. Nature. 441:1157–1161. 2006. View Article : Google Scholar : PubMed/NCBI

25 

Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods. 25:402–408. 2001. View Article : Google Scholar : PubMed/NCBI

26 

Rogério M, Cardoso C and Pestana C: Measurement of malondialdehyde in fish: A comparison study between HPLC methods and the traditional spectrophotometric test. Food Chem. 112:1038–1045. 2009. View Article : Google Scholar

27 

Dragun Z, Filipović Marijić V, Krasnići N, Ramani S, Valić D, Rebok K, Kostov V, Jordanova M and Erk M: Malondialdehyde concentrations in the intestine and gills of Vardar chub (Squalius vardarensis Karaman) as indicator of lipid peroxidation. Environ Sci Pollut Res Int. 24:16917–16926. 2017. View Article : Google Scholar : PubMed/NCBI

28 

Boonchai W, Walsh M, Cummings M and Chenevix-Trench G: Expression of beta-catenin, a key mediator of the WNT signaling pathway, in basal cell carcinoma. Arch Dermatol. 136:937–938. 2000. View Article : Google Scholar : PubMed/NCBI

29 

Gehrke S, Wu Z, Klinkenberg M, Sun Y, Auburger G, Guo S and Lu B: PINK1 and Parkin control localized translation of respiratory chain component mRNAs on mitochondria outer membrane. Cell Metabolism. 21:95–108. 2015. View Article : Google Scholar : PubMed/NCBI

30 

Tsunemi T and La Spada AR: PGC-1α at the intersection of bioenergetics regulation and neuron function: From Huntington's disease to Parkinson's disease and beyond. Prog Neurobiol. 97:142–151. 2012. View Article : Google Scholar : PubMed/NCBI

31 

Zorov DB, Juhaszova M and Sollott SJ: Mitochondrial reactive oxygen species (ROS) and ROS-induced ROS release. Physiol Rev. 94:909–950. 2014. View Article : Google Scholar : PubMed/NCBI

32 

Ray A, Martinez BA, Berkowitz LA, Caldwell GA and Caldwell KA: Mitochondrial dysfunction, oxidative stress, and neurodegeneration elicited by a bacterial metabolite in a C. elegans Parkinson's model. Cell Death Dis. 5:e9842014. View Article : Google Scholar : PubMed/NCBI

33 

Subramaniam SR and Chesselet MF: Mitochondrial dysfunction and oxidative stress in Parkinson's disease. Prog Neurobiol 106–107. 17–32. 2013. View Article : Google Scholar

34 

Kudryavtseva AV, Krasnov GS, Dmitriev AA, Alekseev BY, Kardymon OL, Sadritdinova AF, Fedorova MS, Pokrovsky AV, Melnikova NV, Kaprin AD, et al: Mitochondrial dysfunction and oxidative stress in aging and cancer. Oncotarget. 7:44879–44905. 2016. View Article : Google Scholar : PubMed/NCBI

35 

Zuo L and Motherwell MS: The impact of reactive oxygen species and genetic mitochondrial mutations in Parkinson's disease. Gene. 532:18–23. 2013. View Article : Google Scholar : PubMed/NCBI

36 

Weismann D, Hartvigsen K, Lauer N, Bennett KL, Scholl HP, Charbel Issa P, Cano M, Brandstätter H, Tsimikas S and Skerka C: Complement factor H binds malondialdehyde epitopes and protects from oxidative stress. Nature. 478:76–81. 2011. View Article : Google Scholar : PubMed/NCBI

37 

Sheshadri P and Kumar A: Managing odds in stem cells: Insights into the role of mitochondrial antioxidant enzyme MnSOD. Free Radic Res. 50:570–584. 2016. View Article : Google Scholar : PubMed/NCBI

38 

Koh H, Kim H, Kim MJ, Park J, Lee HJ and Chung J: Silent information regulator 2 (Sir2) and Forkhead box O (FOXO) complement mitochondrial dysfunction and dopaminergic neuron loss in Drosophila PTEN-induced kinase 1 (PINK1) null mutant. J Biol Chem. 287:12750–12758. 2012. View Article : Google Scholar : PubMed/NCBI

39 

Swarup S and Verheyen EM: Wnt/Wingless signaling in Drosophila. Cold Spring Harb Perspect Biol. 4:a0079302012. View Article : Google Scholar : PubMed/NCBI

40 

Yu M, Ting DT, Stott SL, Wittner BS, Ozsolak F, Paul S, Ciciliano JC, Smas ME, Winokur D and Gilman AJ: RNA sequencing of pancreatic circulating tumour cells implicates WNT signalling in metastasis. Nature. 487:510–513. 2012. View Article : Google Scholar : PubMed/NCBI

41 

Mukherjee S and Duttaroy A: Spargel/dPGC-1 is a new downstream effector in the insulin-TOR signaling pathway in Drosophila. Genetics. 195:433–441. 2013. View Article : Google Scholar : PubMed/NCBI

42 

Salih DA, Rashid AJ, Colas D, de la Torre-Ubieta L, Zhu RP, Morgan AA, Santo EE, Ucar D, Devarajan K, Cole CJ, et al: FoxO6 regulates memory consolidation and synaptic function. Genes Dev. 26:2780–2801. 2012. View Article : Google Scholar : PubMed/NCBI

43 

Sears JC and Broihier HT: FoxO regulates microtubule dynamics and polarity to promote dendrite branching in Drosophila sensory neurons. Dev Biol. 418:40–54. 2016. View Article : Google Scholar : PubMed/NCBI

44 

Kops GJ, Dansen TB, Polderman PE, Saarloos I, Wirtz KW, Coffer PJ, Huang TT, Bos JL, Medema RH and Burgering BM: Forkhead transcription factor FOXO3a protects quiescent cells from oxidative stress. Nature. 419:316–321. 2002. View Article : Google Scholar : PubMed/NCBI

45 

Puigserver P, Rhee J, Donovan J, Walkey CJ, Yoon JC, Oriente F, Kitamura Y, Altomonte J, Dong H, Accili D, et al: Insulin-regulated hepatic gluconeogenesis through FOXO1-PGC-1alpha interaction. Nature. 423:550–555. 2003. View Article : Google Scholar : PubMed/NCBI

46 

Speckmann B, Walter PL, Alili L, Reinehr R, Sies H, Klotz LO and Steinbrenner H: Selenoprotein P expression is controlled through interaction of the coactivator PGC-1alpha with FoxO1a and hepatocyte nuclear factor 4alpha transcription factors. Hepatology. 48:1998–2006. 2008. View Article : Google Scholar : PubMed/NCBI

47 

Chung HW, Lim JH, Kim MY, Shin SJ, Chung S, Choi BS, Kim HW, Kim YS, Park CW and Chang YS: High-fat diet-induced renal cell apoptosis and oxidative stress in spontaneously hypertensive rat are ameliorated by fenofibrate through the PPARα-FoxO3a-PGC-1α pathway. Nephrol Dial Transplant. 27:2213–2225. 2012. View Article : Google Scholar : PubMed/NCBI

48 

Geng T, Li P, Yin X and Yan Z: PGC-1α promotes nitric oxide antioxidant defenses and inhibits FOXO signaling against cardiac cachexia in mice. Am J Pathol. 178:1738–1748. 2011. View Article : Google Scholar : PubMed/NCBI

49 

Essers MA, de Vries-Smits LM, Barker N, Polderman PE, Burgering BM and Korswagen HC: Functional interaction between beta-catenin and FOXO in oxidative stress signaling. Science. 308:1181–1184. 2005. View Article : Google Scholar : PubMed/NCBI

50 

Yang Y, Cehrke S, Imai Y, Huang Z, Ouyang Y, Wang JW, Yang L, Beal MF, Vogel H and Lu B: Mitochondrial pathology and muscle and dopaminergic neuron degeneration caused by inactivitation of Drosophila Pink1 is rescued by Parkin. Proc Natl Acad Sci USA. 103:10793–10798. 2006. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Xia SR, Wen XY, Fan XL, Chen XR, Wei ZW, Li QH and Sun L: Wnt2 overexpression protects against PINK1 mutant‑induced mitochondrial dysfunction and oxidative stress. Mol Med Rep 21: 2633-2641, 2020.
APA
Xia, S., Wen, X., Fan, X., Chen, X., Wei, Z., Li, Q., & Sun, L. (2020). Wnt2 overexpression protects against PINK1 mutant‑induced mitochondrial dysfunction and oxidative stress. Molecular Medicine Reports, 21, 2633-2641. https://doi.org/10.3892/mmr.2020.11066
MLA
Xia, S., Wen, X., Fan, X., Chen, X., Wei, Z., Li, Q., Sun, L."Wnt2 overexpression protects against PINK1 mutant‑induced mitochondrial dysfunction and oxidative stress". Molecular Medicine Reports 21.6 (2020): 2633-2641.
Chicago
Xia, S., Wen, X., Fan, X., Chen, X., Wei, Z., Li, Q., Sun, L."Wnt2 overexpression protects against PINK1 mutant‑induced mitochondrial dysfunction and oxidative stress". Molecular Medicine Reports 21, no. 6 (2020): 2633-2641. https://doi.org/10.3892/mmr.2020.11066
Copy and paste a formatted citation
x
Spandidos Publications style
Xia SR, Wen XY, Fan XL, Chen XR, Wei ZW, Li QH and Sun L: Wnt2 overexpression protects against PINK1 mutant‑induced mitochondrial dysfunction and oxidative stress. Mol Med Rep 21: 2633-2641, 2020.
APA
Xia, S., Wen, X., Fan, X., Chen, X., Wei, Z., Li, Q., & Sun, L. (2020). Wnt2 overexpression protects against PINK1 mutant‑induced mitochondrial dysfunction and oxidative stress. Molecular Medicine Reports, 21, 2633-2641. https://doi.org/10.3892/mmr.2020.11066
MLA
Xia, S., Wen, X., Fan, X., Chen, X., Wei, Z., Li, Q., Sun, L."Wnt2 overexpression protects against PINK1 mutant‑induced mitochondrial dysfunction and oxidative stress". Molecular Medicine Reports 21.6 (2020): 2633-2641.
Chicago
Xia, S., Wen, X., Fan, X., Chen, X., Wei, Z., Li, Q., Sun, L."Wnt2 overexpression protects against PINK1 mutant‑induced mitochondrial dysfunction and oxidative stress". Molecular Medicine Reports 21, no. 6 (2020): 2633-2641. https://doi.org/10.3892/mmr.2020.11066
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team