This article is mentioned in:

Introduction

Chronic rhinosinusitis with nasal polyps (CRSwNP) is a multifaceted and heterogeneous inflammatory condition affecting the nasal mucosa. The formation of nasal polyps is characterized by notable edema of the nasal mucosa, with histopathological features revealing basal cell hyperproliferation (1). Moreover, basal cells in the nasal epithelium demonstrate imbalanced differentiation, with goblet cell hyperplasia and decreased levels of ciliated cells, accompanied by the infiltration of inflammatory cells (2). CRS is further classified into eosinophilic CRSwNP (ECRSwNP) and non-ECRSwNP (nECRSwNP), based on the histological quantification of eosinophilia (3). The recommended treatment approach, as per European Position Paper on Rhinosinusitis and Nasal Polyps guidelines (EPOS2020) (3), involves a comprehensive strategy comprising appropriate medical therapy and functional endoscopic sinus surgery. However, patients with CRSwNP often face challenges with poor compliance to long-term medication, and relapse is common following surgical intervention, with rates ranging from 35% at 6 months to >40% at 18 months post-endoscopic sinus surgery (4). Notably, a subset of patients with CRSwNP experience insufficient control of the condition despite extended and standardized treatment (5). Therefore, understanding of the fundamental mechanisms underlying CRSwNP is key for exploring alternative therapeutic strategies in managing this intricate and diverse inflammatory disorder.

Emerging data have indicated an association between pyroptosis and CRSwNP, as evidenced by positive staining of the NLRP3, a primary signal to induce pyroptosis, in patient samples (6,7). Pyroptosis is a form of gasdermin D (GSDMD)-mediated programmed cell death, primarily involving Caspase-1 activation. When NLRP3 inflammatory bodies are activated by pathogens, they activate and cleave pro-Caspase-1 to active Caspase-1. Caspase-1 cleaves GSDMD, leading to the activation of N-terminal and C-terminal fragments. N-terminal fragments assemble to create pores in the cell membrane, leading to cell enlargement, lysis and death. Simultaneously, inflammatory cytokines are released from the cell, attracting additional inflammatory cells and intensifying the inflammatory response (8,9). Previous studies have demonstrated NLRP3 activation and pyroptosis markers in CRSwNP samples (6,7,10–12), however, the role of pyroptosis in epithelial dysfunction, including basal cell hyperproliferation and goblet cell differentiation, remains poorly understood.

Previous studies (10,13–18) have highlighted the involvement of cytokines IL-5 and IL-17A in CRSwNP pathogenesis. IL-5 is a key regulator of eosinophil differentiation, migration, activation and survival. Elevated IL-5 levels and increased eosinophil counts are associated with severe NPs and higher postoperative recurrence rates, positioning IL-5 as a potential biomarker for disease diagnosis, severity assessment and recurrence prediction in CRSwNP (13,14). By contrast, IL-17A serves a key role in neutrophilic inflammation (15). It drives neutrophil recruitment, activation and infiltration by inducing chemokines such as CXCL1, CXCL2 and CXCL8 (16) via the PI3K/Akt/hypoxia inducible factor (HIF)-1α signaling pathway (17). Elevated IL-17A levels in nasal tissue are positively associated with increased NP burden, tissue remodeling and disease severity (18). Furthermore, heightened IL-17A expression is associated with enhanced neutrophil migration and pyroptosis-like inflammatory responses (10,16).

The present study aimed to elucidate the contribution of pyroptosis to the pathophysiology of CRSwNP and to examine how differential cytokine environments may influence epithelial cell behavior through this inflammasome-mediated pathways.

Materials and methods

Patients

The present study was approved by the Ethical Committee of the Affiliated Hospital of Qingdao University, Qingdao, China (approval no. QYFY WZLL28477). The present study included 103 patients (68 males, 35 females; aged 27–73 years) diagnosed with CRSwNP who underwent surgical treatment at the Department of Otolaryngology-Head and Neck Surgery, Affiliated Hospital of Qingdao University, Qingdao, China between January 2019 and June 2020. For the control group, the middle turbinate mucosal tissue was collected during procedures such as septoplasty, middle turbinate reduction, optic nerve decompression, orbital wall fracture repair or cerebrospinal fluid leak repair. The inclusion criteria required patients to meet the EPOS2020 guidelines (3) and have postoperative histopathological confirmation of NP tissue. Patients with the following conditions were excluded: Use of antibiotics or oral corticosteroids within 3 months prior to surgery and coexisting parasitic infection, cystic fibrosis, aspirin-exacerbated respiratory disease, hematological disorder or psychiatric conditions. All patients were followed up for a duration of 26–41 months to assess clinical outcomes and disease progression. Follow-up included in-person hospital visits once monthly for the first 3 months, every 2 months from months 3 to 9, every 3 months from months 9 to 12 and annually thereafter via telephone or in-person visits when disease progression was suspected.

All patients were examined by paranasal sinus computed tomography (PNCT) using Discovery CT750 HD (GE Healthcare), endoscopic nasal examination and symptoms such as nasal obstruction, purulent nasal discharge, headache and olfactory dysfunction by physical examination. For endoscopic nasal examination, Lund-Kennedy was used as the endoscopic scoring system (19). For PNCT examination, the Lund-Mackay scoring system was applied (20,21). To quantify the symptoms of patients, the visual analogue scale (VAS) was applied (22).

Human specimen collection

Control and CRSwNP samples were removed during endoscopic sinus surgery and fixed in 10% formalin at room temperature for 24 h for embedding, sectioned at 5 µm and stained with hematoxylin (10 min) and eosin (3 min) at room temperature. An additional segment from each sample was stored at −80°C for reverse transcription-quantitative (RT-q)PCR and western blotting analyses.

Reagents

Antibodies against IL-1β (ab283818) were purchased from Abcam. Antibodies against GAPDH (60004-1-1g), NLRP3 (19771-1-AP) and GSDMD (20770-1-AP) were purchased from Proteintech Group, Inc. Antibodies against Caspase-1 (cat. no. 2225T) and cleaved Caspase-1 (4199T) were purchased from Cell Signaling Technology, Inc. The secondary antibodies Donkey anti-Rabbit IgG (H+L) Cross-Adsorbed Secondary Antibody, DyLight™ 488 (SA5-10038), Donkey anti-Mouse IgG (H+L) Cross-Adsorbed Secondary Antibody, DyLight™ 650 (SA5-10169) and DAPI (D1306) were purchased from Invitrogen. The secondary antibodies Goat Anti-Rabbit IgG(H+L) (peroxidase/HRP conjugated) (E-AB-1003) and Goat Anti-Mouse IgG(H+L)(peroxidase/HRP conjugated) (E-AB-1001) were purchased from Elabscience. Recombinant human IL-5 protein (90106ES10) was purchased from Shanghai Yeasen Biotechnology Co., Ltd. Recombinant human IL-17A (200-17) protein was purchased from PeproTech, Inc. ECL substrate kit (MA0186-2) was purchased from Dalian Meilun Biology Technology Co., Ltd.

Cell culture

Primary human nasal epithelial cells (HNEpCs) were derived as previously described (23). In brief, nasal tissue samples were cut into small pieces, washed with PBS, centrifuged at 300 g at room temperature for 5 mins, incubated with dispase II (2.4 U/ml, Stem Cell Technology) overnight at 4°C, centrifuged, incubated with trypsin (Invitrogen; Thermo Fisher Scientific, Inc.) at 37°C for 15 min, and passed through a 100-µm filter. To recapitulate airway epithelial architecture, HNEpCs were seeded in the upper chamber of Transwell inserts (Corning) pre-coated with collagen I (Sigma). The upper chamber contained DMEM supplemented with 10% fetal bovine serum (FBS; Invitrogen), while the lower chamber was filled with a 1:1 mixture of bronchial epithelial growth medium and DMEM/F12 (Sigma). Cells were allowed to differentiate under this air-liquid interface conditions.

Basal RPMI-2650 cells were obtained from the Cell Bank of the Chinese Academy of Sciences, and maintained in RPMI-1640, 10% FBS (both Gibco; Thermo Fisher Scientific, Inc.) and penicillin-streptomycin at 37°C and 5% CO2. Cells were passaged every 3–4 days by adding 2.5% trypsin (Gibco; Thermo Fisher Scientific, Inc.) for 3–5 min at 37°C and re-plating at a 1:4 ratio.

For stimulation assays, confluent HNEpCs or RPMI-2650 cells were treated with either human serum collected preoperatively from whole blood (5 ml) obtained from patients clinically diagnosed with ECRSwNP or non-ECRSwNP, or IL-5, 100 ng/ml; PeproTech) or interleukin-17A (IL-17A, 100 ng/mL; PeproTech) for 72 h at 37°C. Control cells were exposed to the same cytokine concentrations for 72 h or co-treated with dimethyl fumarate (DMF, 50 µM; Sigma).

Immunohistochemical and immunofluorescent (IF) staining

For immunohistochemistry (IHC), paraffin-embedded sections (5-µm thick) were deparaffinized in fresh xylene for 10 min, rehydrated through a graded ethanol series (100%, 95% and 70% ethanol), washed with water, blocked with 5% BSA (Yeasen) in PBS at room temperature for 1 h, incubated with primary antibodies (all 1:500) against NLRP3, IL-1β, cleaved Caspase 1, cleaved GSDMD, IL-5 and IL-17A overnight at 4°C, followed by a 60 min incubation with goat anti-rabbit IgG(H+L) secondary antibody (1:1,000). The sections were stained with 3,3′diaminobenzidine tetrahydrochloride for 5 mins and counterstained with hematoxylin for 2 mins at room temperature. Images of the immunostained samples were captured using a light microscope.

For the IF experiment, NP sections or fixed nasal epithelial cells treated with serum from human patients were blocked with 5% BSA (Yeasen) in PBS at room temperature for 1 h, treated with primary antibodies against Cleaved GSDMD or Cleaved Caspase-1 overnight at 4°C, followed by a 60 min incubation with secondary antibodies conjugated to fluorescein. The nuclei were counterstained with DAPI for 5 min at room temperature. High-resolution images were obtained using a Nikon ECLIPSE Ti confocal microscope (Nikon Corporation).

Western blotting

Total protein from tissue or cell samples was extracted using RIPA (Yeasen) buffer. The protein concentrations were assessed using a BCA Protein Assay kit (Beyotime Institute of Biotechnology). A total of 40 µg of total protein were loaded onto SDS-PAGE gels (4–20%) for separation and transferred to a PVDF membrane. After blocking in 5% skimmed milk for 1 h at room temperature, dissolved in Tris-buffered saline with 0.1% Tween-20 (TBST), the PVDF membrane was incubated with the primary antibodies overnight at 4C° as follows: GAPDH (1:4,000), IL-1β (1:5,000), NLRP3 (1:1,000), GSDMD (1:2,000), Caspase-1 (1:1,000) and cleaved Caspase-1 (1:2,000). After washing the PVDF membranes three times with TBST for 5 min each, they were incubated with secondary antibodies (1:5,000) at room temperature for 60 min. Signal detection was performed using the ChemiDoc XRS+ Imaging System (Bio-Rad Laboratories, Inc). Band density was quantified using Image Lab Software 6.0 (Bio-Rad Laboratories, Inc.). All expression values were normalized to GAPDH.

RT-qPCR

Total RNA was extracted from RPMI-2650 cells (1×106) using Total RNA Extraction Reagent (Vazyme Biotech Co., Ltd.). A total of 1 µg total RNA was reverse-transcribed with HiScript III RT SuperMix for qPCR according to the manufacturer's protocol (Vazyme Biotech Co., Ltd.). qPCR was conducted using the Taq Pro Universal SYBR qPCR Master Mix according to the manufacturer's protocol (Vazyme Biotech Co., Ltd.). The thermocycling conditions were as follows: initial denaturation at 95°C for 3 min, followed by 40 cycles of denaturation at 95°C for 15 sec and annealing/extension at 60°C for 30 sec. Melt curve analysis was performed at the end of amplification by increasing the temperature from 65°C to 95°C in 0.5°C increments every 5 sec to confirm the specificity of the amplification products. Standard curves were generated for each primer set and were used to calculate Cq values with the expression threshold set to 100 RFU (24). Expression values were normalized to GAPDH. The forward and reverse primer sequences (5′→3′) were as follows: GAPDH (GGCTGAGAACGGGAAGCTTGTCAT; CAGCCTTCTCCATGGTGGTGAAGA); dynein axonemal Intermediate Chain 2 (DNAI2) (CGATCAGCATGTCGGAACAC; CGAGCTGCATGATGGCGTTA); Chloride Channel Accessory 1 (CLCA1) (ACAACAATGGCTATGAAGGCA; GGTCTCAAGTTTTGGTCTCACAT); Mucin 5AC (MUC5AC) (ACCAATGCTCTGTATCCTTCCC; TGGTGGACGGACAGTCAC T) and Forkhead Box J1 (FOXJ1) (TCTGAGCCAGGCACCACATA; CCATGTCTGCGGGGACTCT).

RNA-sequencing (seq)

The quality and integrity of total RNA samples were analyzed using the Agilent 2100 Bioanalyzer (Agilent Technologies) according to the manufacturer's instructions, and libraries were prepared utilizing the VAHTS® Universal V8 RNA-Seq Library Prep kit (NRM605-02) for MGI and VAHTS® RNA Adapters Set 8 for MGI (NM208-01) (both Vazyme Biotech Co., Ltd.), according to the manufacturer's instructions. Final libraries were quantified using the Qubit 4.0 Fluorometer (Thermo Fisher Scientific) and their size distribution was confirmed via the Agilent 2100 Bioanalyzer. The libraries were diluted to a final loading concentration of 1.5 nM. Sequencing was performed as paired-end 150 bp reads, with strand-specific sequencing using the MGI-SEQ 2000 platform at BGI Group. The demultiplexed reads were mapped to the GRCh38 version of the human genome using HISAT2 (25). To quantify transcripts and analyze differential expression, the demultiplexed reads were processed with feature Counts using R package (version 4.4.1) (26). Differential expression was evaluated using DESeq2 (27). Additionally, Gene Ontology (28) and Kyoto Encyclopedia of Genes and Genomes (KEGG) (29) pathway enrichment analyses were conducted using Database for Annotation, Visualization and Integrated Discovery (DAVID; david.ncifcrf.gov/).

Statistical analysis

Statistical analyses were performed using SPSS 19.0 (IBM Corp.) and GraphPad Prism 5.0 (Dotmatics). Comparisons between three groups were conducted using one-way analysis of variance with Tukey's HSD (Honest Significant Difference) Test. Fisher's Exact Test was used to assess associations between two categorical variables and the data were represented as frequency and percentages. Independent samples t-test was used to assess the continuous variables. All assays were repeated at least three times to ensure reproducibility. Data are presented as the mean ± standard deviation. A power analysis was carried out using R-package (pwr) to validate the sample size, with the α level set at 0.01. For datasets with n≤50, the Shapiro-Wilk test was used to assess the normality of data distribution. P<0.05 was considered to indicate a statistically significant difference.

Results

Increased number of pyroptosis signals are observed in patients with nECRSwNP compared with ECRSwNP

To mitigate the influence of potential confounding variables, the demographic and clinical data between patients with ECRSwNP or nECRSwNP groups were compared. The present study involved 103 patients diagnosed with CRSwNP, of whom 58 met the inclusion criteria. Of these, 27 were excluded based on the aforementioned criteria. Among the included 31 patients, 15 were classified as nECRSwNP and 16 as ECRSwNP. To enhance the robustness of the findings, a control group comprising 13 individuals without CRSwNP was included. These controls were matched to the patient cohort for age and sex, and screened to exclude any nasal pathology or systemic inflammatory conditions. There were no significant disparities in key parameters such as age, sex distribution, prevalence of asthma, allergic rhinitis, history of NP surgery, smoking status or allergy to food or drugs between the ECRSwNP and nECRSwNP groups, with marked difference for Total VAS scores, Endoscopy scores, and CT scores (Table I), indicating heterogeneous clinical features.

Table I. Demographic and clinical characteristics of participants.

Table I.

Demographic and clinical characteristics of participants.

Characteristic	ECRSwNP (n=16)	nECRSwNP (n=15)	Controls (n=13)	P-value
Mean age, years	46.06±10.19	52.27±12.81	47.23±15.40	0.145
Male (%)	13 (81.25)	9 (60.00)	9 (69.23)	0.252
Asthma (%)	2 (12.50)	1 (6.67)	0 (0.00)	>0.999
AR (%)	5 (31.25)	2 (13.33)	0 (0.00)	0.394
History of NP surgery (%)	4 (25.00)	1 (6.67)	0 (0.00)	0.333
Smoking (%)	6 (37.50)	7 (46.67)	2 (15.38)	0.722
Allergy to food or drugs (%)	2 (12.50)	0 (0.00)	0 (0.00)	0.484
Mean total VAS score	15.88±3.05	11.47±2.92	N/A	<0.001
Mean endoscopy score	10.81±1.22	6.60±1.92	N/A	<0.001
Mean CT score	20.13±3.20	11.93±5.40	N/A	<0.001

[i] nECRSwNP, non-eosinophilic chronic rhinosinusitis with nasal polyps; VAS, visual analog scale; N/A, not applicable; AR, allergic rhinitis; CT, computed tomography.

Shapiro-Wilk test was conducted to assess normality. Age, total VAS, and CT scores in ECRSwNP and nECRSwNP groups, as well as endoscopy scores in the nECRSwNP group were normally distributed. While endoscopy scores in the ECRSwNP group showed slight deviation, absolute skewness (<3) and kurtosis (<10) values indicated acceptable approximation to normality, justifying the use of parametric tests (Table II). The total VAS was 15.88±3.05 for patients with ECRSwNP and 11.47±2.92 for patients with nECRSwNP. However, notable distinctions were observed in the endoscopy and CT scores between the ECRSwNP and nECRSwNP cohorts. The mean endoscopy score was 10.81±1.22 for patients with ECRSwNP and 6.60±1.92 for patients with nECRSwNP, while the mean CT score was 20.13±3.20 for ECRSwNP and 11.93±5.40 for nECRSwNP. These discrepancies in endoscopy and CT score reflect variations in disease severity between the two CRSwNP phenotypes as the power analysis demonstrated statistical power values of 0.9019, 0.9999 and 0.9891 for total VAS, endoscopy and CT scores, respectively.

Table II. Shapiro-Wilk test for continuous variables.

Table II.

Shapiro-Wilk test for continuous variables.

Characteristic	Group	n	Mean	SD	Skewness	Kurtosis	W-value	P-value
Age	ECRSwNP	16	46.063	10.188	−0.724	0.008	0.938	0.330
	nECRSwNP	15	52.267	12.814	−0.276	−0.665	0.938	0.364
Total VAS score	ECRSwNP	16	15.875	3.052	−0.379	−0.862	0.943	0.389
	nECRSwNP	15	11.467	2.924	0.751	−0.692	0.887	0.060
Endoscopy score	ECRSwNP	16	10.813	1.223	−0.345	−1.570	0.808	0.003
	nECRSwNP	15	6.600	1.920	−0.036	−1.059	0.881	0.050
CT score	ECRSwNP	16	20.125	3.202	−0.937	1.281	0.902	0.087
	nECRSwNP	15	11.933	5.405	0.274	−1.394	0.915	0.164

[i] nECRSwNP, non-eosinophilic chronic rhinosinusitis with nasal polyps; VAS, visual analog scale.

To assess pyroptosis in patients with nECRSwNP and ECRSwNP, the expression of NLRP3 and IL-1β was analyzed. H&E staining was used to evaluate morphological changes and the infiltration of inflammatory cells in NP samples from patients with CRSwNP (Fig. 1A). Consistent with clinical observations, the control group showed no notable infiltration of inflammatory cells. By contrast, the ECRSwNP group exhibited a substantial infiltration of eosinophils. Conversely, the nECRSwNP group displayed few eosinophils and basement membrane thickening and infiltration of inflammatory cells, including neutrophils, plasma cells and lymphocytes. Immunohistochemical staining demonstrated a significant increase in the number of NLRP3- and IL-1β-positive cells in both nECRSwNP and ECRSwNP groups compared with the control (Fig. 1B-D). To validate these findings, cleaved GSDMD and Caspase-1 expression was assessed using IF staining. Consistently, >80% of the cells were positive for both cleaved GSDMD and Caspase-1, indicating the activation of the pyroptosis signaling pathway. The intensity of cleaved GSDMD and cleaved caspase-1 signals was stronger in the nECRSwNP group compared with the ECRSwNP group (Fig. 2). These results suggest an association between pyroptosis and the development of CRSwNP, particularly in patients with nECRSwNP.

Figure 1. NLRP3 and IL-1β expression is increased in CRSwNP. (A) H&E staining was used to assess morphology in the control group (arrows show neutrophil cells), ECRSwNP (arrows show eosinophil cells) and nECRSwNP group (black arrows show lymphocytes; red arrows show neutrophils). Immunohistochemical staining of (B) NLRP3 and (C) IL-1β protein levels. (D) Histopathology scores of NLRP3 and IL-1β in CRSwNP relative to control mucosa. Scale bar, 50 µm. **P<0.05, ***P<0.01 and ****P<0.001 vs. control. NLRP3, nucleotide-binding domain, leucine-rich–containing family, pyrin domain–containing-3; nECRSwNP, non-eosinophilic chronic rhinosinusitis with nasal polyps; H&E, hematoxylin and eosin.

Figure 2. Cleaved GSDMD and Caspase-1 are upregulated in the CRSwNP mucosa. (A) Immunofluorescent staining of cleaved GSDMD and cleaved Caspase-1 in CRSwNP. (B) Quantitative analysis of positive cells relative to the control. ***P<0.01, ****P<0.001 vs. control. GSDMD, gasdermin D; nECRSwNP, non-eosinophilic chronic rhinosinusitis with nasal polyps; ns, not significant.

Peripheral venous serum from patients with CRSwNP induces pyroptosis of basal cells

To assess the potential of serum from patients with CRSwNP to induce pyroptosis in basal cells, RPMI-2650 cells were treated with diluted serum from patients with either nECRSwNP or CRSwNP for 72 h. Immunocytochemistry revealed a notable increase in the expression of cleaved GSDMD in both groups compared with the control group, with a pronounced increase observed in the nECRSwNP group (Fig. 3A). The expression of total GSDMD, Caspase-1, cleaved GSDMD, cleaved Caspase-1 and NLRP3 was further investigated by western blotting. Consistent with the immunocytochemistry results, cleaved GSDMD and Caspase-1 and NLRP3 showed a notable increase in expression in cells treated with serum from patients with nECRSwNP and ECRSwNP compared with the control group, despite no substantial changes in the total protein levels of GSDMD and Caspase-1. The levels of these proteins were significantly higher in the nECRSwNP compared with the ECRSwNP group (Fig. 3B and C). These findings implicated that components present in the serum from patients with CRSwNP may induce pyroptosis, with a more pronounced effect in nECRSwNP, contributing to the manifestation of CRSwNP.

Figure 3. Cleaved GSDMD is upregulated in basal cells treated with serum from patients with CRSwNP. (A) Immunofluorescent staining of cleaved GSDMD. (B) Representative western blotting. (C) Expression of NLRP3, Caspase-1, cleaved Caspase-1, GSDMD and cleaved GSDMD. GAPDH was used as a loading control. GSDMD, gasdermin D; nECRSwNP, non-eosinophilic chronic rhinosinusitis with nasal polyps; NLRP3, nucleotide-binding domain, leucine-rich–containing family, pyrin domain–containing-3; NC, negative control. ***P<0.01 and ****P<0.001 vs. control.

IL-5 and IL-17A induce the ECRSwNP and nECRSwNP phenotype, respectively

Previous studies indicate that IL-5 and IL-17A are the dominant immune cytokines in the peripheral venous serum of patients with ECRSwN (30) and nECRSwNP (31), respectively. To investigate whether these trigger pyroptosis in CRSwNP, their expression in nECRSwNP and ECRSwNP samples was investigated. IHC revealed increased expression of IL-5 in patients with ECRSwNP and IL-17A in patients with nECRSwNP (Fig. 4A). RPMI-2650 cells were treated with IL-5 or IL-17A for 24 h to assess the activation of pyroptosis. No differences were observed in cell morphology and number between groups (Fig. 4B). However, western blot analysis revealed the induction of cleaved GSDMD and cleaved Caspase-1 stimulated by IL-5 and IL-17A compared with the control group, despite no substantial changes for total GSDMD and Caspase-1. Conversely, the addition of pyroptosis inhibitor DMF) resulted in significantly reduced levels of cleaved GSDMD and cleaved Caspase-1 compared with the IL5- or IL17-alone groups (Fig. 4C).

Figure 4. IL-5 and IL-17A induce the ECRSwNP and nECRSwNP phenotype, respectively. (A) Immunohistochemical staining of IL-5 and IL-17A protein. (B) Morphology and quantity of basal HNEpCs cells stimulated with IL-5, IL-17A and their inhibitor DMF for 24 h. (C) GSDMD, cleaved GSDMD, Caspase-1 and cleaved Caspase-1 were analyzed by western blotting in HNEpCs stimulated with IL-5 (****P<0.0001 IL-5 group, IL-5+DMF group vs. Control group; ####P<0.0001 IL-5+DMF group vs. IL-5 group) or IL-17A (&&&&P<0.0001 IL-17 group vs. Control group; &P<0.05 IL-17+DMF group vs. Control group; $$$$P<0.0001 IL-17+DMF group vs. IL-17 group). RNA-sequencing analysis of basal cells treated with (D) IL-5 or (E) IL-17. Heatmap shows differential gene expression. Red, upregulation; blue, downregulation. Kyoto Encyclopedia of Genes and Genomes pathway analysis was conducted to display the pathway of differentially expressed genes. (F) Common up- and downregulated genes of basal cells treated with IL-5 and IL-17. DMF, dimethyl fumarate; CTRL, control; nECRSwNP, non-eosinophilic chronic rhinosinusitis with nasal polyps; GSDMD, Gasdermin D; HNEpC, human nasal epithelial cells; ns, not significant.

To gain molecular insight into the effects of IL-5 and IL-17A on RPMI-2650 cells, RNA-seq analysis was performed on control cells and cells stimulated with either IL-5 or IL-17 to analyze associated genes and signaling pathways involved. Relative to the control cells, 105 genes were up- and 12 genes were downregulated in the IL-5 group, while 245 genes were up- and 484 genes were downregulated in the IL-17A group. Among these genes, 12 were up- and one was downregulated in the IL-5 vs. IL-17A overlap. KEGG analysis revealed that inflammatory signaling pathways such as ‘cytokine-cytokine receptor interaction’, ‘NOD-like receptor signaling pathway’, ‘TNF signaling’, ‘NF-κβ signaling pathway’, ‘toll-like receptor signaling pathway’ and ‘IL-17 signaling pathway’ were associated with IL-5 stimulation. Conversely, ‘coronavirus disease-COVlD-19’ and ‘ribosome’ were ranked as top in the IL-17A-stimulated group (Fig. 4D and E).

Inhibition of pyroptosis rescues the differentiation imbalance of basal cells

To understand the role of pyroptosis in the development of CRSwNP, its impact on basal cell differentiation capacity was examined. RT-qPCR revealed that the expression of CLCA1, the key marker of goblet cells, was upregulated in RPMI-2650 cells treated with either IL-5 or IL-17A, indicating a shift towards goblet cell differentiation. Conversely, the expression of DNAI2, the key regulator of ciliated cells, was downregulated, suggesting a decrease in ciliated cell differentiation (Fig. 5A). DMF, a pyroptosis inhibitor, rescued this differentiation imbalance, implicating the activation of pyroptosis as a key trigger of the differentiation imbalance in basal cells (Fig. 5A and B). These results were validated in HNEpCs, demonstrating that pyroptosis inhibition partially rescued the differentiation imbalance, particularly in IL-17A-treated cells (Fig. 4C).

Figure 5. Inhibition of pyroptosis mitigates the differentiation imbalance of basal cells. mRNA expression of (A) CLCA1 and DNAI2(****P<0.0001 IL-5 group, IL-5+DMF group vs. Control group; ####P<0.0001 IL-5+DMF group vs. IL-5 group; &&&&P<0.0001 IL-17, IL-17+DMF group vs. Control group; $$$$P<0.0001 IL-17+DMF group vs. IL-17 group) and (B) FOXJ1 (&&&&P<0.0001 IL-17, IL-17+DMF group vs. Control group; $$P<0.01 IL-17+DMF group vs. IL-17 group) and MUC5AC (&P<0.05 IL-17 group vs. Control group; $$P<0.01 IL-17+DMF group vs. IL-17 group). RNA-sequencing analysis of basal cells treated with (C) IL-5 and (D) IL-17, with and without DMF. The bar chart was generated using DAVID, http://david.ncifcrf.gov/). DMF, dimethyl fumarate, BP, biological process; CC, cellular component; MF, molecular function; CTRL, control; CLCA1, chloride Channel Accessory 1; DNAI2, Dynein Axonemal Intermediate Chain 2; MUC5AC, Mucin 5AC.

RNA-seq analysis revealed a significant reversal of gene expression patterns after DMF administration, particularly in the IL-17A-treated group. Gene Ontology function analysis of differentially expressed genes in the IL-5-treated group revealed enrichment in ‘angiogenesis’, ‘cell adhesion’, ‘regulation of nitric oxide-mediated signal transduction’, ‘neutrophil chemotaxis’ and ‘extracellular space’, as well as ‘hydrogen sulfide biosynthetic process’, ‘heparin binding’ and ‘carbon monoxide binding’. By contrast, in the IL-17A-treated group, targeting pyroptosis by DMF resulted in enrichment of ‘cell adhesion’, ‘positive regulation of canonical Wnt signaling pathway’, ‘mitochondrion’, ‘cytoskeleton’ and ‘plasma membrane protein complex’, as well as ‘nervous system development’, ‘sphingolipid biosynthetic process’ and ‘iron-sulfur cluster assembly complex’ (Fig. 5C and D). These findings suggest that pyroptosis may contribute to the impairment of basal cell differentiation in the nasal epithelium of patients with CRSwNP.

Discussion

Despite the identification of the NLRP3 inflammasome signal pathway being implicated in the pathogenesis of CRSwNP, notable gaps persist in the understanding of whether this phenotype influences the development of CRSwNP. The present study revealed that the activation of pyroptosis mediates the imbalanced differentiation of basal cells in the nasal epithelium in CRSwNP. This discovery suggests that targeting pyroptosis may represent a novel therapeutic approach for managing CRSwNP.

A notable increase in the expression of pyroptosis-associated markers was observed, including NLRP3, Caspase-1, GSDMD and IL-1β, in NP, with increased levels detected in nECRSwNP compared with ECRSwNP samples. These findings were consistent across cell experiments in which basal cells were exposed to IL-5 and IL-17A and serum from patients with ECRSwNP or nECRSwNP. This aligns with previous research, indicating a potential association between the predominance of neutrophil infiltration in nECRSwNP and the heightened neutrophilic response associated with type 3 immune reactions (10,11). However, the typical features of pyroptosis-induced cell death, such as cell membrane perforation and cleavage, were not observed. The low concentrations of IL-5 and IL-17A used in the present study may not have been sufficient to induce cell death.

RNA-seq suggested that IL-5 and IL-17A participate in pyroptosis primarily by modulating inflammatory pathways, which further exacerbate the impairment of nasal epithelial cell differentiation. Previous studies (32–34) have reported that inflammasome NLRP3/Caspase-1-mediated pyroptosis induced by viral infection occurs in both airway epithelial and immune cells (32). HIF-1α has been revealed to activate NLRP3 by phosphorylating NLRP3 at serine 295 (12). This activation of the inflammasome leads to the recruitment of Caspase-1 and apoptosis-associated speck-like protein containing a CARD, inhibition of ciliated cell expression and promotion of goblet cell differentiation and basal cell proliferation (12). For example, during rhinovirus infection, there is a notable increase in the expression of NLRP3, IL-1β and MUC5AC in nasal mucosa, leading to goblet cell proliferation. The NLRP3 inflammasome relies on the DEAH-Box Helicase 33 (DDX33)- DDX58-NLRP3-Caspase-1-GSDMD-IL-1β signaling axis to mediate airway epithelial inflammation, pyroptosis and mucin production (32). Studies on bronchial epithelium have revealed increased expression of Caspase-1, NLRP3 and IL-1β in human bronchial epithelium (35,36). Additionally, asthmatic patients exhibit increased expression of IL-1β and MUC5AC, with IL-1β upregulating MUC5AC expression via the NF-κB pathway (37). RT-qPCR data confirmed the differentiation deficit of basal cells biased toward goblet cell fate, which is a typical hallmark of CRSwNP. Therefore it was hypothesized that inflammatory signaling pathway may exhibit crosstalk with differentiation capacity via pyroptosis.

Previous clinical data have indicated marked increases in vascularity, pro-angiogenic gene expression (including platelet and endothelial cell adhesion molecule 1 and platelet-activating factor receptor), blood vessel morphogenesis and blood flow in the mucosal tissue of patients with CRSwNP (38,39). Additionally, intercellular adhesion molecule genes are significantly elevated in the blood and sinuses of patients with CRSwNP (40). Basal cell adhesion molecules, which serve as markers of airway stem cells, have a key role in epithelial remodeling during Type 2 inflammation (41). Conversely, the expression of eosinophil adhesion molecule vascular cell adhesion molecule-1 (VCAM-1) markedly decreases after therapy with dupilumab, a monoclonal anti-IL-4Rα antibody (42). Furthermore, nitric oxide (NO) increases ciliary beating, the airway primary physical defense mechanism. Fractional exhaled NO is a convenient and sensitive marker for evaluating the efficacy of standard anti-inflammatory therapy for CRSwNP. Studies have demonstrated that the airway epithelial layers contribute to exhaled NO in type 2 inflammation, including eosinophilic chronic rhinosinusitis (43,44). Of note, the extracellular space may be related to tight junctions (TJs) between nasal epithelial cells, with TJs serving an essential role in the development and progression of CRSwNP (45). Rescue data in the IL-5 group of the present study suggest that DMF alleviated the CRSwNP phenotype, potentially via modulation of these signaling pathways.

In nECRSwNP, existing literature indicates activation of the canonical Wnt pathway, which has been associated with cytokine release and inhibition of multiciliated cell differentiation in nasal epithelium regeneration (46). Inhibiting the Wnt/β-catenin signaling pathway mitigates inflammation and the epithelial-to-mesenchymal transition in CRSwNP, both in vivo and in vitro (47). Moreover, the pathogenesis of CRSwNP may involve the production of mitochondrial reactive oxygen species, disrupted mitochondrial function and structural changes in nasal epithelial cells (48). The downregulation of tryptophan-aspartic acid repeat-containing planar cell polarity effector in nasal epithelium may impact mitochondria through the MAPK/ERK pathway, potentially contributing to ciliary dysfunction in CRSwNP (49). Additionally, the cytoskeleton, which is involved in cell morphology and integrity, may undergo alterations associated with changes in cell morphology during pyroptosis. Future investigations should explore how basal and neural cells use inflammation-induced pyroptosis, providing valuable insights into the pathogenesis of CRSwNP.

Given the role of pyroptosis in driving inflammation and basal cell dysfunction in CRSwNP, targeting this pathway offers a promising approach to mitigate disease progression and improve patient outcomes (12). Pyroptosis inhibition could not only decrease epithelial damage and immune cell infiltration but also restore normal epithelial differentiation, potentially breaking the cycle of chronic inflammation (50). However, challenges must be addressed before translating these findings into clinical practice. Effective drug delivery strategies are key, particularly for targeting the nasal epithelium while minimizing systemic exposure. Additionally, off-target effects pose a concern, as systemic pyroptosis inhibition could interfere with essential immune responses. Lastly, variability in patient responses, driven by distinct phenotypes of CRSwNP (eosinophilic vs. neutrophilic) and genetic differences, highlights the need for personalized therapeutic strategies. Future research should develop localized delivery systems, identify specific inhibitors with minimal side effects and stratify patients to maximize therapeutic efficacy.

While the present study offered insight into the role of pyroptosis in chronic rhinosinusitis with CRSwNP and the therapeutic potential of targeting pyroptosis, several limitations should be acknowledged. The present study primarily relied on in vitro experiments and patient-derived samples to demonstrate the role of pyroptosis in CRSwNP. Although the data suggested that inhibiting pyroptosis restores basal cell differentiation balance, the lack of in vivo models limits the ability to validate the therapeutic potential and physiological relevance of pyroptosis inhibition. Future studies using animal models of CRSwNP would provide more comprehensive insights into the systemic effects of pyroptosis modulation and its impact on disease progression. The present study investigated both ECRSwNP and nECRSwNP subtypes of CRSwNP, but the sample size was relatively small, particularly for subgroup comparisons. Larger, multicenter cohorts are needed to validate the differential pyroptosis mechanisms between ECRSwNP and nECRSwNP and assess the influence of demographic and clinical variables. Although the present study identified IL-5 and IL-17A as upstream triggers of pyroptosis, the precise signaling mechanisms linking these cytokines to pyroptosis activation remain incompletely defined. More detailed mechanistic studies are necessary to elucidate the precise molecular interactions. The present study used DMF to inhibit pyroptosis, but DMF also exerts anti-inflammatory and immunomodulatory effects through other pathways, such as NF-κB and oxidative stress modulation (51). Genetic approaches (such as clustered Regularly Interspaced Short Palindromic Repeat-mediated gene editing) are necessary to confirm the specificity of the present findings.

In conclusion, the present study suggested that pyroptosis, mediated by IL-5 and IL-17A, contributes to the impaired differentiation of nasal epithelial cells, particularly promoting the goblet cell phenotype seen in CRSwNP.

Acknowledgements

Not applicable.

Funding

The present study was supported by grants from National Natural Science Foundation of China (grant no. 32070859), Natural Science Foundation of Shandong Province (grant nos. ZR2020MC083 and ZR2021MH350) and Taishan Scholars Program of Shandong Province (grant no. TS20190931).

Availability of data and materials

The data generated in the present study may be found in the Sequence Read Archive database under accession number PRJNA1224023 or at the following URL: ncbi.nlm.nih.gov/sra/?term=PRJNA1224023.

Authors' contributions

GZ, SY and ZW designed the study and wrote the manuscript. GZ, SJ, JL, LL and XX performed human specimen collection, cell culture, immunohistochemical and immunofluorescent staining, western blotting, RT-qPCR and data analysis. YD and ZL constructed the figures, revised the manuscript, supplemented and analyzed the data. LL and XX confirm the authenticity of all the raw data. All authors have read and approved the final manuscript.

Ethics approval and consent to participate

The present study received approval from the Ethics Committee of the Affiliated Hospital of Qingdao University (Qingdao, China; Ethical approval no. QYFY WZLL28477). Participants provided written informed consent to take part in the present study.

Patient consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

References