Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Oncology Letters
Join Editorial Board Propose a Special Issue
Print ISSN: 1792-1074 Online ISSN: 1792-1082
Journal Cover
January 2013 Volume 5 Issue 1

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
January 2013 Volume 5 Issue 1

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Mesenchymal stem-like cells isolated from human esophageal carcinoma and adjacent non-cancerous tissues

  • Authors:
    • Jiabo Hu
    • Zhongwei Zhou
    • Shunbin Shi
    • Xiaozhong Zhu
    • Xiaohui Wang
    • Wei Zhang
    • Sanqiang Hu
    • Hui Qian
    • Wenrong Xu
  • View Affiliations / Copyright

    Affiliations: School of Medical Science and Laboratory Medicine, Jiangsu University, Zhenjiang, Jiangsu 212013, P.R. China, Department of Thoracic Surgery, the Affiliated Hospital of the Jiangsu University, Zhenjiang, Jiangsu 212001, P.R. China
  • Pages: 179-184
    |
    Published online on: October 30, 2012
       https://doi.org/10.3892/ol.2012.1003
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

Mesenchymal stem cells (MSCs) or MSC-like cells have now been isolated from various sites, including different types of tumor tissues. Whether MSCs or MSC-like cells in different tumor tissues possess differentiated biological characteristics remains unclear, and the correlation between MSCs or MSC-like cells and tumors has been a controversial topic. In the present study, we isolated MSC-like cells from human esophageal carcinoma (hEC-MSCs) and adjacent non‑cancerous tissues (hECN-MSCs). Although the two types of MSC-like cells were in different microenvironments and had certain differences, they possessed similar morphological properties and surface antigens, including CD13, CD29, CD44 and CD105. Our results indicated that hEC-MSCs and hECN-MSCs are similar in a number of ways. This may have implications for further research on the esophageal carcinoma microenvironment and its pathological mechanism.

Introduction

Mesenchymal stem cells (MSCs) are non-hematopoietic stromal cells that are a heterogeneous population of cells which are able to proliferate in vitro as plastic-adherent cells. They have fibroblast-like morphology, form colonies in vitro and are capable of differentiating into bone, cartage and fat cells (1). It has been shown that MSCs have the propensity to migrate to sites of injury and disease (2,3). Due to their multi-differentiation potential and migratory capacity, MSCs are regarded as ideal candidates for regenerative therapy or tissue engineering.

In addition to bone marrow, MSCs and MSC-like cells have now been isolated from various sites, including adipose tissue, amniotic fluid, periosteum and fetal tissues, and show phenotypic heterogeneity (4–10). With the recent developments of research, it has also been reported that MSCs and MSC-like cells may be isolated from certain non-solid tumors, such as lipoma and bone sarcoma, and solid tumors, such as gastric and uterine cervix cancer (11–14). The study of the correlation between MSCs or MSC-like cells and tumors is ongoing. Whether MSCs inhibit or promote the growth or development of tumors has been a controversial topic and there have been many opposing reports in the past few years (15–17). At the same time, the biological characteristics of MSCs and MSC-like cells in different tissues have also been studied extensively (18–21).

In this study, we attempted to locate and isolate MSC-like cells from human esophageal squamous cell carcinoma tissues (hEC-MSCs) and adjacent non-cancerous esophageal tissues (hECN-MSCs) and compare their biological characteristics so as to build a foundation for further study of the microenvironment and pathological mechanisms of esophageal carcinoma in the future.

Materials and methods

Isolation of hEC-MSCs and hECN-MSCs

A total of 25 paired primary esophageal carcinoma tissues and adjacent non-cancerous esophageal tissues were collected from April 2010 to January 2011 at the Department of Thoracic Surgery, the Affiliated Hospital of Jiangsu University, China. There were 22 male and 3 female patients ranging from 49 to 73 years old (median, 60 years). None of the patients received adjuvant radiation or chemotherapy prior to surgery. Specimens used in this study were approved by the Ethical Committees of Jiangsu University. Written informed consent was obtained from the patient. The fresh esophageal carcinoma tissue and its paired non-cancerous esophageal tissue were collected and washed with phosphate-buffered saline (PBS). The tissues were cut into 1–3 mm3-sized sections, then digestion with 0.1% collagenase type IV (Sigma, St. Louis, MO, USA) was performed at 37°C for 30 min. The suspension was centrifuged at 800 rpm for 5 min. Centrifugal precipitates were washed twice, then resuspended in Dulbecco’s modified Eagle’s medium (DMEM) containing 15% fetal bovine serum (FBS) on 35 mm culture dishes, and incubated at 37°C with 5% CO2 for 30 min. After removing the non-adherent cells, the remaining cells were left to incubate for 1–2 weeks (22). The adherent cells were then trypsinized and passaged into a new culture flask at a ratio of 1:3 for further expansion. The cells were used for subsequent experimental study at the third passage.

Cell growth curves

The cell growth curves were determined by cell counting at a regular time every day. hEC-MSCs, hECN-MSCs and MSC-like cells at the third passage from human bone marrow (hBM-MSCs) (23) were seeded in 24-well plates at a density of 5×103 per well during the logarithmic growth phase. The number of adherent cells per well was counted on days 1–8 of culture, and the procedure was repeated three times.

FACS analysis

For the FACS analysis, hEC-MSCs, hECN-MSCs and hBM-MSCs were trypsinized. After being rinsed twice with PBS, 1×106 cells were incubated with specific PE-conjugated antibodies against CD13, CD29, CD44, CD45, CD105 (for hEC-MSCs and hECN-MSCs) and CD133, FITC-conjugated antibodies against CD34 and HLA-DR (Becton-Dickinson, San Jose, CA, USA) in 250 μl PBS for 30 min. After being rinsed with PBS, the labeled cells were analyzed using FACSCalibur. PE-IgG1 and FITC-IgG1 were used as controls.

RT-PCR

To compare differentially expressed genes between hEC-MSCs and hECN-MSCs, total RNA was extracted using TRIzol (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s instructions, and cDNA was generated using Reverse transcriptase II and Oligo-dT primer (Toyobo, Japan) according to the manufacturer’s instructions. RT-PCR was performed with the following temperature profile: a pre-denaturation step of 5 min at 94°C, followed by 35 cycles of 94°C for 30 sec, annealing temperature for 30 sec and 72°C for 30 sec and a final exposure to 72°C for 10 min. β-actin was used as a control and the specific primers are listed in Table I.

Table I

Primer sequences for the amplification of target genes and β-actin.

Table I

Primer sequences for the amplification of target genes and β-actin.

GenesPrimer sequence (5′-3′)Amplicon size (bp)Annealing temperature (°C)
Oct-4For: TATACACAGGCCGATGTGG
Rev: GTGCATAGTCGCTGCTTGA39760
NanogFor: ATGCCTCACACGGAGACTG
Rev: CTGCGTCACACCATTGCTA36960
Bmi-1For: GCTGCCAATGGCTCTAATG
Rev: AGGAGACTGCACTGGAGTACTG53061
TGF-βFor: GGTGGAAACCCACAACGAAATC
Rev: GCTAAGGCGAAAGCCCTCAAT38560
VimentinFor: CCAGGCAAAGCAGGAGTC
Rev: GGGTATCAACCAGAGGGAGT38059
SnailFor: CTGGGTGCCCTCAAGATG
Rev: GTGGAGCAGGGACATTCG26159
NucleosteminFor: ACGCATGACCTGCCATAAGC
Rev: ACCTGAGGACATCTGCAACC45059
TwistFor: CGGGAGTCCGCAGTCTTA
Rev: CACGCCCTGTTTCTTTGA49757
α-SMAFor: CTGACTGAGCGTGGCTATTC
Rev: CCACCGATCCAGACAGAGTA45258
E-cadherinFor: CGCATTGCCACATACACTCT
Rev: TTGGCTGAGGATGGTGTAAG43560
IGF-1For: CTCCTCGCATCTCTTCTACC
Rev: CTCCAGCCTCCTTAGATCAC23557
N-cadherinFor: AGTCAACTGCAACCGTGTCT
Rev: AGCGTTCCTGTTCCACTCAT28160
VEGFFor: CCTTGCTGCTCTACCTCCAC
Rev: ATCTGCATGGTGATGTTGGA28061
β-actinFor: CACGAAACTACCTTCAACTCC
Rev: CATACTCCTGCTTGCTGATC26556
Immunohistochemistry

For immunohistochemical staining, the streptavidin-biotin-peroxidase complex method was used to detect the proteins. hEC-MSCs, hECN-MSCs and hBM-MSCs were fixed with 4% paraformaldehyde at room temperature and endogenous peroxidase activity was quenched and blocked with hydrogen peroxidase (30% H2O2 and methanol, 1:50) for 30 min and 5% BSA for 20 min. The cells were sequentially incubated with primary antibodies for α-SMA, CK18 and VEGF (Boster, Wuhan, China) for 80 min, followed by biotin-labeled anti-rabbit or anti-mouse secondary antibody (Boster) for 20 min at 37°C, and developed with 3,3′-diaminobenzidine (Boster). For negative controls, the conditions were identical except that primary antibodies were replaced by PBS.

Statistical analysis

Statistical analysis carried out using SPSS standard version 13.0 software. Data are reported as the mean ± SD from at least three independent tests. Significance of difference was analyzed using the Student’s t-test. P<0.05 was considered to indicate a statistically significant result.

Results

Morphology and growth characteristics of hEC-MSCs and hECN-MSCs

hEC-MSCs and hECN-MSCs were successfully isolated by collagenase digestion. A small quantity of long spindle-shaped cells were found after 3–4 days of primary culture, and the cells reached 80–90% confluence after 15–20 days of primary culture. hEC-MSCs and hECN-MSCs had a similar morphologically and were long and spindle-shaped (Fig. 1A). The growth curves of hEC-MSCs and hECN-MSCs showed that hEC-MSCs grew faster than hECN-MSCs in the same culture conditions after 5 days of culture (P<0.05). hBM-MSCs were used as a control (Fig. 1B).

Figure 1

Morphology and growth curves of mesenchymal stem cells (MSCs) from human esophageal carcinoma (hEC-MSCs) and adjacent non-cancerous tissues (hECN-MSCs). (A) The characteristic morphology of (a) hEC-MSCs and (b) hECN-MSCs were fibroblast-like after 3–4 days of primary culture; (c) hEC-MSCs and (d) hECN-MSCs reached 80–90% confluence after 15–20 days of primary culture. (B) The growth curves were used to compare the cell growth characteristics between hEC-MSCs and hECN-MSCs. Human bone marrow MSCs (hBM-MSCs) served as a control.

Expression of surface antigens

FACS analysis demonstrated that hEC-MSCs and hECN-MSCs expressed the typical MSC surface antigens. hBM-MSCs served as a control (Fig. 2).

Figure 2

Surface antigens of mesenchymal stem cells (MSCs) from human esophageal carcinoma (hEC-MSCs) and adjacent non-cancerous tissues (hECN-MSCs). hEC-MSCs and hECN-MSCs expressed CD13, CD29 and CD44 and weakly expressed CD105, but did not express CD34, CD45, CD133 and HLA-DR. Human bone marrow MSCs (hBM-MSCs) served as a control.

Gene expression in hEC-MSCs and hECN-MSCs

RT-PCR results showed that hEC-MSCs and hECN-MSCs expressed stem cell-related genes, including Oct-4, Nanog, Bmi-1 and Nucleostemin, and stroma cell-related genes, including TGF-β, Vimentin, Twist, α-SMA and Snail. However, the expression levels of VEGF, Bmi-1, Nanog and Oct-4 were higher in hEC-MSCs than in hECN-MSCs between the three pairs of hEC-MSCs and hECN-MSCs. Neither hEC-MSCs nor hECN-MSCs expressed E-cadherin. hBM-MSCs served as a control and β-actin was used as a housekeeping gene (Fig. 3).

Figure 3

Gene expression in mesenchymal stem cells (MSCs) from human esophageal carcinoma (hEC-MSCs) and adjacent non-cancerous tissues (hECN-MSCs). RT-PCR was applied to compare the expression levels of VEGF, Bmi-1, Nanog, Oct-4, N-cadherin, E-cadherin, TGF-β, α-SMA, IGF-1, Vimentin, Twist, Snail and Nucleostemin between three pairs of hEC-MSCs and hECN-MSCs. Human bone marrow MSCs (hBM-MSCs) served as a control and β-actin was used as a housekeeping gene.

Immunohistochemical staining of hEC-MSCs and hECN-MSCs

The results of immunohistochemical staining showed that the protein expression levels of CK18 and VEGF were higher in hEC-MSCs than in hECN-MSCs, while the expression level of α-SMA was similar between hEC-MSCs and hECN-MSCs (Fig. 4).

Figure 4

Protein expression in mesenchymal stem cells (MSCs) from human esophageal carcinoma (hEC-MSCs), adjacent non-cancerous tissues (hECN-MSCs) and human bone marrow (hBM-MSCs). An immumohistochemical study was applied to compare the expression levels of α-SMA, CK18 and VEGF among hEC-MSCs, hECN-MSCs and hBM-MSCs. The negative control contained no primary antibody.

Discussion

As essential components of tumor stroma cells, MSCs play an important part in the tumor microenvironment which modulates tumor growth and development in a number of ways. MSCs are able to become tumor-associated fibroblasts (TAFs) or carcinoma-associated fibroblasts (CAFs) which contribute to fibrovascular network expansion and tumor progression (24,25). They are also capable of differentiating into pericytes and mural cells around tumor blood vessels, which contribute to the formation of a mature vasculature in tumors (26).

MSCs in tumor tissue are generally believed to be stem cells from bone marrow (27). Strong evidence demonstrates that MSCs are able to home to injury sites in a number of pathological conditions, including inflammation, tissue repair and neoplasia (2,3,28). During progression and development of tumors, MSCs can be recruited in large numbers to the tumor site (29).

In the present study, we successfully isolated five paired hEC-MSCs and hECN-MSCs from 25 paired primary esophageal squamous cell carcinoma tissues and adjacent non-cancerous esophageal tissues. The cells presented a typical long spindle shape. The cell growth rate of hEC-MSCs was significantly higher than that of paired hECN-MSCs. Our results indicated that hEC-MSCs and hECN-MSCs expressed CD13, CD29 and CD44, weakly expressed CD105, but did not express CD34, CD45, CD133 and HLA-DR, which was also similar to hBM-MSCs according to our previous studies (23).

To explore the role of hEC-MSCs and hECN-MSCs in tumor development and progression, gene expression was compared between them by RT-PCR. Among the 13 known genes, Oct-4, Nanog, Bmi-1 and Nucleostemin were associated with stem cells, while N-cadherin, TGF-β, Vimentin, Twist, α-SMA and Snail were associated with stromal cells. Previous studies have shown that the expression of Oct-4 and Nanog was at a higher level in certain epithelial malignant tumors compared with corresponding cancer-adjacent tissues and normal tissues (30,31). Similarly, Bmi-1 was reported to have low expression or even no expression in cancer-adjacent and normal tissues, but its expression was significantly higher in tumor tissues, and was associated with poor prognosis in patients (32,33). VEGF promotes the formation of new blood vessels in tumors, which plays an important role in the growth, invasion and metastasis of tumors (34,35). In our study, the expression levels of VEGF, Bmi-1, Nanog and Oct-4 were notably higher in hEC-MSCs than in hECN-MSCs.

Moreover, the results of immunohistochemistry showed that the protein expression levels of α-SMA and VEGF were correlated with the corresponding gene expression levels. The expression level of CK18 in hEC-MSCs was also higher than in hECN-MSCs. CK18 is a cytokeratin, and is a specific marker of epithelial cells. Research has shown that the expression level of CK18 is closely correlated with the malignant degree of cells. It was lower in normal epithelial cells than in tumor epithelial cells, and the expression level increases with the degree of malignancy (36,37).

In conclusion, our study showed that MSC-like cells may be successfully isolated from human esophageal carcinoma and adjacent non-cancerous esophageal tissues. The study may lay the foundations for further research on the esophageal carcinoma microenvironment and its mechanism of development.

Acknowledgements

This study was funded by the Startup Foundation for Advanced Talents, Jiangsu University (No. 9JDG037) and the National Natural Science Foundation of China (No. 31071421).

References

1 

Horwitz EM, Le Blanc K, Dominici M, et al: Clarification of the nomenclature for MSC: The International Society for Cellular Therapy position statement. Cytotherapy. 7:393–395. 2005. View Article : Google Scholar : PubMed/NCBI

2 

Natsu K, Ochi M, Mochizuki Y, Hachisuka H, Yanada S and Yasunaga Y: Allogeneic bone marrow-derived mesenchymal stromal cells promote the regeneration of injured skeletal muscle without differentiation into myofibers. Tissue Eng. 10:1093–1112. 2004. View Article : Google Scholar

3 

Rojas M, Xu J, Woods CR, Mora AL, Spears W, Roman J and Brigham KL: Bone marrow-derived mesenchymal stem cells in repair of the injured lung. Am J Respir Cell Mol Biol. 33:145–152. 2005. View Article : Google Scholar : PubMed/NCBI

4 

In’t Anker PS, Scherjon SA, Kleijburg-van der Keur C, et al: Amniotic fluid as a novel source of mesenchymal stem cells for therapeutic transplantation. Blood. 102:1548–1549. 2003.PubMed/NCBI

5 

Nakahara H, Dennis JE, Bruder SP, Haynesworth SE, Lennon DP and Caplan AI: In vitro differentiation of bone and hypertrophic cartilage from periosteal-derived cells. Exp Cell Res. 195:492–503. 1991. View Article : Google Scholar : PubMed/NCBI

6 

Zuk PA, Zhu M, Ashjian P, et al: Human adipose tissue is a source of multipotent stem cells. Mol Biol Cell. 13:4279–4295. 2002.PubMed/NCBI

7 

Kim SM, Lim JY, Park SI, et al: Gene therapy using TRAIL-secreting human umbilical cord blood-derived mesenchymal stem cells against intracranial glioma. Cancer Res. 68:9614–9623. 2008. View Article : Google Scholar : PubMed/NCBI

8 

Bieback K and Kluter H: Mesenchymal stromal cells from umbilical cord blood. Curr Stem Cell Res Ther. 2:310–323. 2007. View Article : Google Scholar : PubMed/NCBI

9 

Flynn A, Barry F and O’Brien T: UC blood-derived mesenchymal stromal cells: an overview. Cytotherapy. 9:717–726. 2007. View Article : Google Scholar : PubMed/NCBI

10 

Gucciardo L, Lories R, Ochsenbein-Kölble N, Done’ E, Zwijsen A and Deprest J: Fetal mesenchymal stem cells: Isolation, properties and potential use in perinatology and regenerative medicine. BJOG. 116:166–172. 2009. View Article : Google Scholar : PubMed/NCBI

11 

Lin TM, Chang HW, Wang KH, et al: Isolation and identification of mesenchymal stem cells from human lipoma tissue. Biochem Biophys Res Commun. 361:883–889. 2007. View Article : Google Scholar : PubMed/NCBI

12 

Gibbs CP, Kukekov VG, Reith JD, et al: Stem-like cells in bone sarcomas: implications for tumorigenesis. Neoplasia. 7:967–976. 2005. View Article : Google Scholar : PubMed/NCBI

13 

Xu X, Zhang X, Wang S, et al: Isolation and comparison of mesenchymal stem-like cells from human gastric cancer and adjacent non-cancerous tissues. Cancer Res Clin Oncol. 137:495–504. 2011. View Article : Google Scholar : PubMed/NCBI

14 

Sun X, Cai H, Qian H, Zhu W, Yan Y, Xu H and Xu W: Mesenchymal stem cells isolated from human uterine cervix cancer tissues. Cell Biol Int. 35:119–123. 2011. View Article : Google Scholar : PubMed/NCBI

15 

Khakoo AY, Pati S, Anderson SA, et al: Human mesenchymal stem cells exert potent antitumorigenic effects in a model of Kaposi’s sarcoma. J Exp Med. 203:1235–1247. 2006.PubMed/NCBI

16 

Xu WT, Bian ZY, Fan QM, Li G and Tang TT: Human mesenchymal stem cells (hMSCs) target osteosarcoma and promote its growth and pulmonary metastasis. Cancer Lett. 281:32–41. 2009. View Article : Google Scholar : PubMed/NCBI

17 

Ahmed N, Abubaker K, Findlay J and Quinn M: Epithelial mesenchymal transition and cancer stem cell-like phenotypes facilitate chemoresistance in recurrent ovarian cancer. Curr Cancer Drug Targets. 10:268–278. 2010. View Article : Google Scholar : PubMed/NCBI

18 

Moon JH, Kwak SS, Park G, et al: Isolation and characterization of multipotent human keloid-derived mesenchymal-like stem cells. Stem Cells Dev. 17:713–724. 2008. View Article : Google Scholar : PubMed/NCBI

19 

Bruno S, Bussolati B, Grange C, et al: Isolation and characterization of resident mesenchymal stem cells in human glomeruli. Stem Cells Dev. 18:867–879. 2009. View Article : Google Scholar : PubMed/NCBI

20 

Mitrano TI, Grob MS, Carrión F, et al: Culture and characterization of mesenchymal stem cells from human gingival tissue. J Periodontol. 81:917–925. 2010. View Article : Google Scholar : PubMed/NCBI

21 

Schüring AN, Schulte N, Kelsch R, Röpke A, Kiesel L and Götte M: Characterization of endometrial mesenchymal stem-like cells obtained by endometrial biopsy during routine diagnostics. Fertil Steril. 95:423–426. 2011.PubMed/NCBI

22 

Zhou ZW, Hu JB, Shi SB, Zhu XZ, Wang XH and Xu WR: Isolation of mesenchymal stem-like cells from human esophageal carcinoma and identification of their biological characteristics. Basic Clin Med. 32:798–803. 2012.

23 

Xu W, Zhang X, Qian H, et al: Mesenchymal stem cells from adult human bone marrow differentiate into a cardiomyocyte phenotype in vitro. Exp Biol Med. 229:623–631. 2004.PubMed/NCBI

24 

Spaeth EL, Dembinski JL, Sasser AK, et al: Mesenchymal stem cell transition to tumor-associated fibroblasts contributes to fibrovascular network expansion and tumor progression. PLoS One. 4:e49922009. View Article : Google Scholar : PubMed/NCBI

25 

Mishra P J, Mishra P J, Humeniuk R, et al: Carcinoma-associated fibroblast-like differentiation of human mesenchymal stem cells. Cancer Res. 68:4331–4339. 2008.PubMed/NCBI

26 

Rajantie I, Ilmonen M, Alminaite A, Ozerdem U, Alitalo K and Salven P: Adult bone marrow-derived cells recruited during angiogenesis comprise precursors for periendothelial vascular mural cells. Blood. 104:2084–2086. 2004. View Article : Google Scholar

27 

Bergfeld SA and DeClerck YA: Bone marrow-derived mesenchymal stem cells and the tumor microenvironment. Cancer Metastasis Rev. 29:249–261. 2010. View Article : Google Scholar : PubMed/NCBI

28 

Hall B, Andreeff M and Marini F: The participation of mesenchymal stem cells in tumor stroma formation and their application as targeted-gene delivery vehicles. Handb Exp Pharmacol. 180:263–283. 2007. View Article : Google Scholar : PubMed/NCBI

29 

Kidd S, Spaeth E, Dembinski JL, et al: Direct evidence of mesenchymal stem cell tropism for tumor and wounding micro-environments using in vivo bioluminescent imaging. Stem Cells. 27:2614–2623. 2009. View Article : Google Scholar : PubMed/NCBI

30 

Attasi Y, Mowla SJ, Ziaee SA, et al: Oct-4, an embryonic stem cell marker, is highly expressed in bladder cancer. Int J Cancer. 120:1598–1602. 2007. View Article : Google Scholar : PubMed/NCBI

31 

Chiou SH, Yu CC, Huang CY, et al: Positive correlations of Oct-4 and Nanog in oral cancer stem-like cells and high-grade oral squamous cell carcinoma. Clin Cancer Res. 14:4085–4095. 2008. View Article : Google Scholar : PubMed/NCBI

32 

Wang H, Pan K, Zhang HK, et al: Increased polycomb-group oncogene Bmi-1 expression correlates with poor prognosis in hepatocellular carcinoma. J Cancer Res Clin Oncol. 134:535–541. 2008. View Article : Google Scholar : PubMed/NCBI

33 

Kim JH, Yoon SY, Kim CN, et al: The Bmi-1 oncoprotein is overexpressed in human colorectal cancer and correlates with the reduced p16INK4a/p14ARF proteins. Cancer Lett. 203:217–224. 2004. View Article : Google Scholar : PubMed/NCBI

34 

Maeda K, Chung YS, Ogawa Y, et al: Prognostic value of vascular endothelial growth factor expression in gastric carcinoma. Cancer. 77:858–863. 1996. View Article : Google Scholar : PubMed/NCBI

35 

Takanami I, Tanaka F, Hashizume T and Kodaira S: Vascular endothelial growth factor and its receptor correlate with angiogenesis and survival in pulmonary adenocarcinoma. Anticancer Res. 17:2811–2814. 1997.PubMed/NCBI

36 

Xu W, Zhang MW, Huang J, Wang X, Xu SF, Li Y and Wang SJ: Correlation between CK18 gene and gastric carcinoma micrometastasis. World J Gastroenterol. 11:6530–6534. 2005.PubMed/NCBI

37 

Nanda KD, Ranganathan K, Devi U and Joshua E: Increased expression of CK8 and CK18 in leukoplakia, oral submucous fibrosis, and oral squamous cell carcinoma: An immunohistochemistry study. Oral Surg Oral Med Oral Pathol Oral Radiol. 113:245–253. 2012. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Hu J, Zhou Z, Shi S, Zhu X, Wang X, Zhang W, Hu S, Qian H and Xu W: Mesenchymal stem-like cells isolated from human esophageal carcinoma and adjacent non-cancerous tissues. Oncol Lett 5: 179-184, 2013.
APA
Hu, J., Zhou, Z., Shi, S., Zhu, X., Wang, X., Zhang, W. ... Xu, W. (2013). Mesenchymal stem-like cells isolated from human esophageal carcinoma and adjacent non-cancerous tissues. Oncology Letters, 5, 179-184. https://doi.org/10.3892/ol.2012.1003
MLA
Hu, J., Zhou, Z., Shi, S., Zhu, X., Wang, X., Zhang, W., Hu, S., Qian, H., Xu, W."Mesenchymal stem-like cells isolated from human esophageal carcinoma and adjacent non-cancerous tissues". Oncology Letters 5.1 (2013): 179-184.
Chicago
Hu, J., Zhou, Z., Shi, S., Zhu, X., Wang, X., Zhang, W., Hu, S., Qian, H., Xu, W."Mesenchymal stem-like cells isolated from human esophageal carcinoma and adjacent non-cancerous tissues". Oncology Letters 5, no. 1 (2013): 179-184. https://doi.org/10.3892/ol.2012.1003
Copy and paste a formatted citation
x
Spandidos Publications style
Hu J, Zhou Z, Shi S, Zhu X, Wang X, Zhang W, Hu S, Qian H and Xu W: Mesenchymal stem-like cells isolated from human esophageal carcinoma and adjacent non-cancerous tissues. Oncol Lett 5: 179-184, 2013.
APA
Hu, J., Zhou, Z., Shi, S., Zhu, X., Wang, X., Zhang, W. ... Xu, W. (2013). Mesenchymal stem-like cells isolated from human esophageal carcinoma and adjacent non-cancerous tissues. Oncology Letters, 5, 179-184. https://doi.org/10.3892/ol.2012.1003
MLA
Hu, J., Zhou, Z., Shi, S., Zhu, X., Wang, X., Zhang, W., Hu, S., Qian, H., Xu, W."Mesenchymal stem-like cells isolated from human esophageal carcinoma and adjacent non-cancerous tissues". Oncology Letters 5.1 (2013): 179-184.
Chicago
Hu, J., Zhou, Z., Shi, S., Zhu, X., Wang, X., Zhang, W., Hu, S., Qian, H., Xu, W."Mesenchymal stem-like cells isolated from human esophageal carcinoma and adjacent non-cancerous tissues". Oncology Letters 5, no. 1 (2013): 179-184. https://doi.org/10.3892/ol.2012.1003
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team