Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Oncology Letters
Join Editorial Board Propose a Special Issue
Print ISSN: 1792-1074 Online ISSN: 1792-1082
Journal Cover
October-2018 Volume 16 Issue 4

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
October-2018 Volume 16 Issue 4

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article Open Access

Positive expression of ZNF689 indicates poor prognosis of hepatocellular carcinoma

  • Authors:
    • Peng Sheng Yi
    • Bin Wu
    • Da Wei Deng
    • Guang Nian Zhang
    • Jian Shui Li
  • View Affiliations / Copyright

    Affiliations: Department of Hepato‑Biliary‑Pancrease, Institute of General Surgery, The Affiliated Hospital of North Sichuan Medical College, Nanchong, Sichuan 639000, P.R. China
    Copyright: © Yi et al. This is an open access article distributed under the terms of Creative Commons Attribution License.
  • Pages: 5122-5130
    |
    Published online on: August 10, 2018
       https://doi.org/10.3892/ol.2018.9295
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

The objective of the present study was to investigate the association between zinc finger protein (ZNF) 689 expression and the clinicopathological features and prognosis of hepatocellular carcinoma (HCC). A total of 102 paired HCC and paired non‑cancerous tissues, and 16 normal liver tissues were collected. ZNF689 expression was examined in HCC tissues, paired‑noncancerous tissues, and normal liver tissues using RT‑qPCR and immunohistochemistry analysis, and the association between ZNF689 expression and HCC prognosis was analyzed using the Kaplan‑Meier method. ZNF689 expression was not significantly different between HCC tissues and paired‑noncancerous tissues (P=0.61). ZNF689 expression in HCC and paired‑noncancerous tissues was significantly increased compared with that in normal liver tissues (P<0.01). Positive expression of ZNF689 protein in HCC was significantly associated with a tumor size of ≥10 cm, tumor capsule infiltration, and microvascular invasion (P<0.05). Positive expression of ZNF689 was a prognostic factor for overall survival time [hazard ratio (HR):1.961; P=0.048] and progression‑free survival time (HR:1.902; P=0.041). ZNF689 maybe a novel predictor for prognosis of patients with HCC.

Introduction

Hepatocellular carcinoma (HCC) is one of the most common cancer types globally, and the fifth highest cause of cancer-associated mortality (1). The etiology of HCC differs between regions; hepatitis C infection and alcohol abuse are the most common causes of HCC in western countries, while in China the majority of patients with HCC harbor a hepatitis B (HBV)infection (2,3). A variety of treatments are recommended for HCC, with radical treatments including radical resection, liver transplantation and radiofrequency ablation being recommended for the treatment of early stage HCC. Patients diagnosed with advanced stage HCC are candidates for palliative treatments, including sorafenib and other targeted treatments (4,5). In total, ~30% of all patients with HCC are diagnosed at an advanced stage in China (6), and novel treatments are required in orderto improve the prognosis of these patients.

Zinc finger proteins (ZNF) are a family of DNA binding proteins, encoded by 2% of all human genes (7). Generally, ZNFs are divided into eight categories: C2H2 like (Cys2His2), Gag knuckle, treble clef, zinc ribbon, Zn2/Cys6, TAZ2 domain like, Zinc binding loops and metallothionein (8). C2H2 type zinc finger protein is the largest of these groups. Previous studies have revealed an association between ZNF expression and HCC prognosis; Wang et al (9) demonstrated that increased zinc finger and BTB domain containing 20 (ZBTB20) expression is associated with poor HCC prognosis, and Kan et al (10) recently reported that ZBTB20 is an independent prognostic biomarker for HCC. Yang et al (11) analyzed 92 HCC tumor tissue samples and identified that zinc finger E-box binding homeo box 2 expression was associated with tumor metastasis. Recently, Wu et al (12) determined that ZNF191 inhibited HCC metastasis by inactivating discs large 1-mediated yes-associated protein.

ZNF689, a C2H2 type ZNF, is a putative transcription regulating factor. A previous study demonstrated that the knockdown of ZNF689 results in tumor cell growth inhibition (8). It has also been identified that ZNF689 inhibited tumor cell apoptosis via downregulation of the pro-apoptotic factors B cell lymphoma (Bcl)2 antagonist/killer 1, Bcl2 associated X protein (Bax) and BH3 interacting domain death agonist (Bid) (13). In the aforementioned study, immunohistochemical analysis was also performed on HCC tumor samples and it was revealed that 4/12 cases presented with nuclear expression of ZNF689. In order to further explore whether ZNF689 is a novel treatment target and its significance in determining HCC prognosis, the present study used an increased number of specimens to analyze the association between ZNF689 expression and the baseline characteristics of patients with HCC.

Materials and methods

Patients and follow-up

A total of 102 paired HCC tissues and adjacent non-cancerous tissues were collected from patients who underwent radical liver resection between January 2011 and December 2012 in West China Hospital of Sichuan University (Chengdu, Sichuan Province, China), including 93 males and 9 females. Patients who were diagnosed by histological detection and with a preserved liver function (Child A,B), without prior systematic therapy or local treatments prior to liver resection were included; additionally patients who withdrew from follow-up or without sufficient clinical data were excluded. Written informed consent was obtained from all enrolled patients, and the study was ethically approved by the Biomedical Ethics Committee of West China Hospital. The median patient age was 55 years (range, 21–76), with 42 patients ≥60 years (41.2%). A total of 51 patients (50%) presented with an α-fetoprotein level >400 ng/ml, and 96 patients (94.1%) presented with positive expression of the HBV surface antigen. Among all patients, tumor size ranged from 1.5 to 13.8 cm (median size, 6.0 cm). Tumor differentiation was classified as high differentiation, moderate differentiation or low differentiation (14). According to the Barcelona Clinical Liver Cancer system (BCLC), HCC was classified as early stage (BCLC A), intermediate stage (BCLC B), or advanced stage (BCLC C) (4). A total of 15 patients (14.7%) were staged as BCLC A, 48 (47.1%) as BCLC B, and 39 (38.2%) as BCLC C. Liver function was measured by Child-Pugh grade system, which is the most common evaluating system for liver function. It comprises five variables total bilirubin, prothrombin time, albumin, ascites, and hepatic encephalopathy. Child A is defined as score 5,6, Child B is defined as score 7–9 (15). No patients received radiofrequency ablation or trans-arterial chemoembolization prior to liver resection. Liver tissues were collected <15 min after liver resection and stored at −80°C. Paired non-cancerous tissue was defined as liver tissue >3 cm from the tumor resection edge. All frozen liver samples tested in the present study were stored in the Clinical Sample Bank of West China Hospital. Follow-up was performed at one to three-month intervals via an outpatient visit or telephone call. Recurrence was defined as new lesions within the residual liver or distant organ metastasis detected by ultrasound, computed tomography or magnetic resonance imaging scans. Follow-up was completed in May 2016.

Reverse transcription-quantitative polymerase chain reaction (RT-qPCR)

Total RNA was extracted from each specimen using TRIzol® reagent (Life Technologies; Thermo Fisher Scientific, Inc., Waltham, MA, USA) according to the manufacturer's protocol. RNA concentration was determined with a ScanDrop Nuclear Acid Analyzer (AnalytikJenaAG, Jena, Germany). To determine the integrity of RNA, 3 µg of each RNA sample was separated on a 1% denatured agarose gel and then detected via a Chemical Mpimaging system (Bio-Rad, Laboratories, Inc, Hercules, CA, USA). If the peak area of the 28S ribosome RNA (rRNA) was approximately twice that of 18S rRNA, the integrity of the total RNA was considered as acceptable and used for continued investigation. ZNF689 mRNA was quantified using RT-qPCR, with primers designed via Primer 5.0 software (PremierBiosoft, International, Palo Alto, CA, USA), and synthesized by Sangon Biotech (Shanghai, China) (Table I). The reference gene used for qPCR is GAPDH, the detail sequence was listed in Table I. cDNA was synthesized using a RevertAid First-Strand cDNA Synthesis kit (ThermoFisher Scientific, Inc.), and qPCR was performed in triplicate for each sample using Maxima SYBR Green qPCR Master mix (Thermo Fisher Scientific, Inc.) on the CFX connect Real-Time system (Bio-Rad, Laboratories, Inc.). Amplification proceeded for 3 min at 95°C for denaturing, followed by 40 cycles for ZNF689 and GAPDH, at 95°C for 15 sec, 60°C for 30 sec in the CFX connect Real-Time system. Relative expression levels of each gene were calculated using the 2−ΔΔCq method (16).

Table I.

Primers used in RT-qPCR.

Table I.

Primers used in RT-qPCR.

PrimerSequence (5′-3′)No. of bases
ZNF689-forward TGGAACGAAACACCGATGACT21
ZNF689-reverse CCATTCTTCTTTCTGGTTCTGCT23
GAPDH-forward ACTCCTCCACCTTTGACGC19
GAPDH-reverse GCTGTAGCCAAATTCGTTGTC21

[i] ZNF, zinc finger protein.

Cell culture and transfection

The normal hepatic cell line LO2 and HCC cell lines (Huh7, MHCC97H, and Hep3B) were purchased from the Cell Bank of Type Culture Collection of the Chinese Academy of Sciences (Shanghai, China). HCC cell lines were preserved in Dulbecco's modified Eagle's medium (DMEM) (Hyclone, GE Healthcare Life Sciences, Logan, UT, USA). LO2 cells were maintained in RPMI-1640 medium (Invitrogen; Thermo Fisher Scientific, Inc.) supplemented with 10% fetal bovine serum (FBS) (Hyclone; GE Healthcare Life Sciences), 100 units/ml penicillin, and 100 mg/ml streptomycin. Cells were placed in a humidified atmosphere containing 5% CO2 at 37°C. Cells were transfected with lentivirus or plasmids using Turbo transfection reagent. Lentivirus were purchased from Shanghai Genechem Co Ltd (Shanghai, China) shRNA were loaded by GV208, EGFP, and AMP vectors. Trans-KD™ Easy was used as transfection reagent, and purchased from Shanghai Genechem Co Ltd. Transfection incubation was set at 37°C for 48 h.

HCC cell migration and wound-healing assays

To perform a transwell migration assay, 1×105 cells obtained from MHCC-97 shRNA transfection (M-Si) cell line were seeded into the upper chamber of transwell plates (BD Biosciences, Franklin Lakes, NJ, USA) with serum-free DMEM. The lower chamber was filled with DMEM containing 10% FBS. After incubation for 48 h at 37°C, cells in the upper surface of the filters were softly removed by a cotton swap, then cells migrating to the lower surface of the filters were fixed inethanol for 20 min at room temperature. Cells were randomly counted in eight fields, from threedifferent membranes. Considering Wound-healing assay, Cells in logarithmic growth phase were cultured in a 6-well plate until 90% confluence was reached. Next, a single wound was created in the monolayer cells by gently scratching the attached cells with a sterile 10 µl micropipette tip (time 0 h). After scratching, the cells were incubated with serum-free DMEM medium for 24 h. Cell migration was photographed using fluorescence microscopy (IX70; Olympus, Japan) and ax10 objective at 48 h following injury. Remodeling was measured as the diminishing distance across the induced injury, normalized to the 0 h control, and expressed as relative migration. Each experiment was performed at least three times independently.

Western blot analysis

Protein was extracted from tissues using radioimmunoprecipitation assay (RIPA buffer) (BeyotimeInstitute of Biotechnology, Shanghai, China) buffer containing a 1/10 Complete Miniprotease inhibitor cocktail (Roche Diagnostics GmbH, Mannheim, Germany). RIPA lysate was added into the samples, at 0°C for 30 min following vortex blending, and then a 10 min intermittent oscillation was performed. The protein concentration was measured using a bicinchoninic acid protein assay kit (Beyotime, Institute of Biotechnology). Following denaturing at 95°C for 10 min, 50 µg of each protein sample was separated using SDS-PAGE (10% gel) and then transferred to a polyvinylidene difluoride membrane. Subsequent to blocking with 5% nonfat dry milk in TBS with 0.1% Tween-20 (TBST) for 1 h at room temperature, the membrane was incubated with primary antibodies at 4°C overnight. The primary antibodies used for western blot included ZNF-689 from Sigma-Aldrich, Merck KGaA, Darmstadt, Germany (1:1,000, Cat no. SAB1408243), E-cadherin (1:1,000, Cat no. 3195T), β-catenin (1:1,000, Cat no. 8480T) and Snail 1 (1:1,000, Cat no. 3879T) from Cell signaling Technology, Inc., Danvers, MA, USA, the GAPDH employed as normalized control from Zen BioScience (1:2,000, Cat no. 220068, Chengdu, China). Subsequent to washing three times with TBST buffer for 10 min per wash, the membrane was further incubated at room temperature for 1 h with horseradish peroxidase conjugated rabbit anti-mouse IgG (cat no. 250097) or mouse anti-rabbit (cat no. 701051) Secondary antibodies were also purchased from Zen BioScience, (Chengdu, China) and used at a dilution of 1:5,000. Subsequently, the results were scanned with a Chemical Mp Imaging System (Bio-Rad Laboratories). Following treatment with immobilon ECL ultra western HRP substrate of Millipore (Merck KGaA, Darmstadt, Germany) according to the manufacturer's protocol the expression levels of each protein was quantified by Image J software version 1.8.0 (National Institutes of Health, Bethesda, MD, USA).

Immunohistochemistry (IHC) staining

IHC was conducted according to the instructions of the SP-9001 kit (Beyotime Institute of Biotechnology). Images were observed at magnification, ×400 under a fluorescence microscope. 10% formalin-fixed, paraffin-embedded tissue sections of representative areas of tumor were cut into 4 µm-thick sections. IHC was performed with a standard two-step method. First, the slides were de-paraffinized with xylene and rehydrated a graded alcohol series (100, 90, 70 and 50% ethyl alcohol) for 10 min at room temperature, and antigen retrieval was performed by incubating samples in sodium citrate buffer (pH 6.0) for 30 min at 98°C. Inactivation of endogenous peroxidase was performed with a 3% hydrogen peroxide solution for 20 min at room temperature. After 30 min blocking (5% normal goat serum purchased from Beyotime Institute of Biotechnology) at room temperature), the tissue sections were incubated with rabbit polyclonal anti-ZNF689 primary antibodies (SAB2701570; dilution 1:100) (Sigma-Aldrich; Merck KGaA) overnight at 4°C. Subsequent to washing, the slides were incubated with horseradish peroxidase-conjugated secondary antibody for 40 min at 37°C (SAB2701462; dilution 1:500) (Sigma-Aldrich; Merck KGaA).

IHC staining was evaluated by an immunoreactivity score (IRS), which was calculated by multiplying the staining intensity and extent as previously described (17). Deng DW who works in Department of hepato-biliary-pancrease of Affiliated Hospital of North Sichuan College performed IHC and he was blinded to the mRNA ZNF689 expression results. The staining intensity was classified as: 0(negative), 1(weak), 2(moderate) or 3(strong). Based on the percentage of positively stained cells throughout the tumor, the extent of staining was defined as 0(0%), 1(<10%), 2(10%-50%), 3(51%-80%) or 4(>80%). IRS score is the staining intensity score multiplied by the extent of staining score, ranging from 0 to 12, with an IRS score of ≥4 defined as positive expression, and an IRS score of <4 defined as negative expression.

Statistical analysis

Statistical analysis was performed using SPSS software (version 21.0; IBM Corp, Armonk, NY, USA) and GraphPad Prism software (version 5.00; GraphPad Software, Inc., La Jolla, CA, USA). P<0.05 was considered to indicatea statistically significant difference. Continuous variables are presented as the mean ± standard deviation or mean ± standard difference with 95% confidence intervals (CI). An unpaired Student's t-tests or one-way analysis of variance tests were performed to compare continuous variables with parametric distributions, the post-hoc test used following the analysis of variance was Student Newman Keuls test. Categorical data were analyzed using the chi-squared or Fisher's exact tests. Survival data were calculated with the Kaplan-Meier method and compared by the log-rank test. Univariate and multivariate analyses were performed using Cox's regression method.

Results

Expression of ZNF689 in HCC, paired non-cancerous tissue, and normal liver tissue

RT-qPCR analysis revealed no significant difference in the expression of ZNF689 mRNA between HCC and paired non-cancerous tissues, with a mean difference of −0.26 (95% CI, −1.32, 0.80; P=0.62). In addition, the expression of ZNF689 mRNA was detected in 16 normal liver tissues collected from patients with hemangioma who underwent liver resection in West China Hospital of Sichuan University from January 2011 to December 2012. The diagnosis of hemangioma was based on pathological test, and patients with hemangioma who have not received any systematic or local therapy were included, those who also complicated with tumor lesions in other organs were excluded. Of these 16 patients, 10 were female, 6 were male, and the median age was 41.7 years (age range 27–68 years). All these 16 patients were diagnosed as hemangioma and not included in the above 102 patients. The results demonstrated that ZNF689 mRNA expression was increased in HCC tissues and paired non-cancerous tissues compared with the normal liver tissues. The differences between means were 2.246±0.4840 (95% CI, 1.278, 3.214) and 2.510±0.3273 (95% CI, 1.856, 3.165), respectively (P<0.05; Fig. 1).

Figure 1.

Relative mRNA levels of ZNF689 in hepatocellular carcinoma tissues, paired non-cancerous tissues, and normal tissues. ZNF, zinc finger protein. **P<0.05.

IHC analysis demonstrated that the mean IRS score was 4, 4.03, and 0.4 in the tumor, paired non-cancerous and normal liver tissues, respectively (Fig. 2). IHC revealed positive expression of ZNF689 protein (IRS score ≥4) in 45 cases (45/102, 44.12%) of HCC and 45 cases (45/102, 44.12%) of paired non-cancerous tissues. There was no significant difference in the expression levels of the ZNF689 protein between HCC and paired non-cancerous tissues, and the mean difference of the ZNF689 protein in HCC and non-cancerous tissues was −0.02941 (95% CI, −1.587, 1.528, P=0.97). However, the expression levels of the ZNF689 protein in HCC and non-cancerous tissues were significantly higher compared with those in normal liver tissues (P<0.05; Fig. 2). Representative images of the IHC analysis are presented in Fig. 3.

Figure 2.

Comparison of zinc finger protein 689 protein expression in HCC tissues, paired non-cancerous tissues, and normal tissues. HCC, hepatocellular carcinoma; IRS, immunoreactivity score. **P<0.05.

Figure 3.

Representative immunohistochemical images of zinc finger protein 689 stainingin HCC, non-cancerous tissues, and normal tissues. (A) HCC tissue. (B) Paired non-cancerous tissue. (C) Normal liver tissue. Magnification, ×400. HCC, hepatocellular carcinoma.

The relative mRNA levels of ZNF689 were analyzed in the positive and the negative expression group and it was identified that the mRNA level in the positive expression group was significantly increased compared with that in the negative expression group (P=0.038), indicating that ZNF689 expression was consistent between them RNA and protein level (Fig. 4).

Figure 4.

Relative mRNA level of ZNF689 in the positive and negative expression groups. ZNF, zinc finger protein; IRS, immunoreactivity score.

Association between ZNF689 levels in HCC tissues and clinicopathological parameters

Associations between ZNF689 expression in HCC and clinicopathological parameters is summarized in Table II. Positive expression of the ZNF689 protein in HCC was significantly associated with a tumor size of ≥10 cm (P=0.028), tumor capsule infiltration (P=0.005) and microvascular invasion (MVI; P=0.037). No significant association was observed between expression of the ZNF689 protein and age, sex, HBV surface antigen, the extent of cirrhosis, tumor number, portal vein embolus, BCLC stage or differentiation.

Table II.

Associations between ZNF689 expression levels and the clinical characteristics of patients with hepatocellular carcinoma.

Table II.

Associations between ZNF689 expression levels and the clinical characteristics of patients with hepatocellular carcinoma.

CharacteristicsPositive expression (IRS score ≥4)Negative expression (IRS score <4)P-value
Sex 0.495
  Male4251
  Female36
Age (years) 0.171
  >601230
  <603327
α-fetoprotein (ng/ml) 0.549
  >4002427
<4002130
Hepatitis B surface antigen 0.492
  Positive4551
  Negative06
HBV-DNA 0.495
  >103/copies3030
  <103/copies1527
Child-Pugh classification 0.764
  Child A4254
  Child B33
Liver cirrhosis 0.506
  Yes3345
  No1212
Tumor number 0.613
  Single4248
  Multiple39
Tumor size (cm) 0.028
  >10183
  <102754
Tumor size (cm) 0.104
  >54239
  <5318
Cancer embolus in portal vein 0.718
  Yes1515
  No3042
BCLC stage 0.410
  BCLC A312
  BCLC B2127
  BCLC C2118
Tumor capsule 0.005
  Complete infiltration636
  No capsule infiltration3921
Microvascular invasion 0.037
  Yes3318
  No1239
Differentiation 0.273
  High33
  Moderate4245
  Low09

[i] BCLC, Barcelona clinic liver cancer staging; HBV, hepatitis B virus.

Positive expression of ZNF689 in HCC is associated with poor prognosis

Follow-up was completed in May 2016. Since the majority of the patients enrolled in the present study were from a rural area in China, a lack of compliance with treatment guidelines and financial difficulties resulted in a relatively high incidence of loss to follow-up.

Of the 63 patients who completed the follow-up, 47 (74.6%) experienced recurrence and 39 (61.9%) patients had succumbed to the disease by the follow-updeadline. The median follow-up time was 33 months (range, 1–65 months). The overall survival (OS) rate was 38.1% (24/63), with a median OS of 33 months. The median progression-free survival (PFS) was 20 months.

Patients with follow-up data were grouped into two categories according to the IRS in HCC tissues. The median OS in the positive expression group (27±1.10 months; 95% CI, 24.85–29.15) was significantly lower compared with that in the negative expression group (47±6.33 months; 95% CI, 34.59–59.41; χ2=3.954; P=0.047; Fig. 5). The median PFS in the positive expression group (19±1.40 months; 95% CI, 15.28–20.73) was also significantly lower compared with that in the negative expression group (23±4.17; 95% CI, 14.85–31.16; χ2=4.762; P=0.029; Fig. 6).

Figure 5.

Association between zinc finger protein 689 expression in hepatocellular carcinoma and overall survival. IRS, immunoreactivity score.

Figure 6.

Association between zinc finger protein 689 expression in hepatocellular carcinoma and progression-free survival. IRS, immunoreactivity score.

Prognostic factors for OS and PFS

Univariate analysis indicated that cancer embolus in the portal vein [hazard ratio (HR), 3.894; P=0.013], MVI (HR, 3.109; P=0.040) and positive expression of ZNF689 (HR, 2.033; P=0.041) were prognostic factors for OS. Multiple tumors (HR, 2.399; P=0.019), cancer embolus in the portal vein (HR, 2.388; P=0.009), tumor capsule infiltration (HR, 2.398; P=0.013), MVI (HR, 2.799; P=0.002) and positive expression of ZNF689 (HR, 1.967; P=0.036) were prognostic factors for PFS detected by univariate analysis.

For multivariate analysis, the known prognostic factors by univariate analysis were selected together with the known significant clinical variables. Cancer embolus in the portal vein (HR, 2.298; P=0.038), MVI (HR, 2.178; P=0.047) and positive expression of ZNF689 (HR, 1.961; P=0.048) were significantly associated with OS, whereas multiple tumors (HR, 1.398; P=0.021), cancer embolus in the portal vein (HR, 1.561; P=0.045), MVI (HR, 2.108; P=0.014) and positive expression of ZNF689 (HR, 1.902; P=0.041) were prognostic factors for PFS (Table III).

Table III.

Prognostic factors for overall survival and progression-free survival by univariate and multivariate analysis.

Table III.

Prognostic factors for overall survival and progression-free survival by univariate and multivariate analysis.

A, Univariate analysis

Overall survivalProgression free survival


FactorsHR95% CIP-valueHR95% CIP-value
Age (years, >60 vs. <60)0.458(0.156,1.348)0.1561.246(0.700,2.219)0.455
α-fetoprotein (ng/ml, >400 vs. <400)0.774(0.280,2.138)0.6210.956(0.518,1.764)0.886
Hepatitis B surface antigen (positive vs. negative)0.653(0.085,5.015)0.6822.402(0.329,17.528)0.387
HBV-DNA (copies, >103 vs. <103)0.613(0.217,1.730)0.3550.810(0.441,1.488)0.497
Child-Pugh classification (Child B vs. Child A)2.466(0.317,19.198)0.3891.451(0.349,6.039)0.609
Liver cirrhosis (Yes vs. no)1.989(0.440,8.989)0.3721.639(0.725,3.704)0.235
Tumor number (multiple vs. single)1.681(0.465,6.081)0.4282.399(1.153,4.989)0.019
Tumor size (cm, >10 vs. <10)1.291(0.569,2.930)0.5411.405(0.655,3.015)0.383
Tumor size (cm, >5 vs. <5)0.899(0.300,2.696)0.8501.432(0.715,2.869)0.311
Cancer embolus in portal vein (Yes vs. no)3.849(1.331,11.126)0.0132.388(1.238,4.605)0.009
Tumor capsule (infiltration vs. complete)1.579(0.537,4.643)0.4062.398(1.201,4.788)0.013
Microvascular invasion (Yes vs. no)3.109(1.108,9.976)0.0402.799(1.464,5.351)0.002
Differentiation High+moderate vs. low1.313(0.455,3.792)0.6151.155(0.616,2.169)0.653
ZNF689 expression (positive vs. negative)2.033(1.054,3.920)0.0411.967(1.092,3.543)0.036

B, Multivariate analysis
Overall survivalProgression free survival

FactorsHR95% CIP-valueHR95% CIP-value

Tumor number (multiple vs. single)1.473(0.116,1.929)0.2971.398(1.181,2.872)0.021
Cancer embolus in portal vein (Yes vs. no)2.298(1.481,4.835)0.0381.561(1.058,3.922)0.045
Tumor capsule (infiltration vs. complete)0.946(0.294,3.014)0.9261.597(0.750,3.401)0.225
Microvascular invasion (Yes vs. no)2.178(1.118,4.245)0.0472.108(1.162,3.825)0.014
ZNF689 expression (positive vs. negative)1.961(1.023,3.758)0.0481.902(1.061,3.412)0.041

[i] HR, hazard ration; CI, confidence interval; ZNF, zinc finger protein; HBV, hepatitis B virus.

Underlying mechanism of ZNF689 regulating invasion and migration of HCC

The ZNF689 expression was evaluated in LO2 cells and three HCC cell lines (Huh7, MHCC97H and Hep3B). It was identified that the expression of ZNF689 in HCC cell lines was significantly higher compared with that in LO2 (P<0.05; Fig. 7). ZNF689 was knocked down and over-expressed in the HCC cell line MHCC97L, and it was revealed that knockdown of ZNF689 substantially suppressed the proliferation and migration of HCC cells (Fig. 8).

Figure 7.

Comparison of ZNF689 expression in LO2 and hepatocellular carcinoma cell lines. *P<0.05 and **P<0.01 vs. LO2 cells. ZNF, zinc finger protein.

Figure 8.

Comparison of proliferation and migration between ZNF689 M-Si and M-O cell lines. (A) Proliferation experiment. (B) Migration experiment. M-Si, ZNF689 knockdown; M-O, ZNF689 overexpression; znf, zinc finger protein; OD, optical density.

To investigate the potential underlying molecular mechanism of ZNF689 regulating the invasion and migration of HCC, the expression of E-cadherin, which is the most important biomarker of the epithelial-mesenchymal transition (EMT), was investigated in normal and ZNF689 knockdown MHCC97L cells. The expression of E-cadherin was higher in ZN689 knockdown MHCC97L cells compared with that in normal MHCC97L cells (Fig. 9), which revealed the potential role of ZNF689 in regulating the EMT process. Further supporting the function of ZNF689 in regulating EMT, the expression of β-catenin and the target gene SNAIL1 were substantially decreased following knockdown of ZNF689 in MHCC97L cells, SNAIL1 is the abbreviation of snail family transcriptional repressor 1, which is a member of transcription factors, is critical for inducing and sustaining cancer EMT (18) (Fig. 10). It is hypothesized that ZNF689 may regulate the EMT of HCC via the Wnt-β-catenin-snail signaling pathway.

Figure 9.

Expression of E-cadherin in zinc finger protein 689 M-Si and M-NMHCC97L cells. M-Si, knockdown; M-N, normal.

Figure 10.

Knockdown of zinc finger protein 689 resulted in the downregulation of β-catenin and snail. (A) Result of reverse transcription-quantitative polymerase chain reaction. (B) Result of western blotting.

Discussion

The aim of the present study was to investigate the expression of ZNF689 in HCC at the mRNA and protein expression levels. Its expression did not differ significantly between HCC tissues and paired non-cancerous tissues. However, the expression of ZNF689 in HCC tissues and paired non-cancerous tissues was significantly higher compared with that in normal liver tissues. Positive expression of ZNF689 was significantly associated with a tumor size >10 cm, MVI and tumor capsule infiltration. Additionally, the positive expression of ZNF689 in HCC was associated with the poor prognosis of HCC.

ZNF689 has previously been implicated in the development of HCC. Silva et al (8) analyzed the gene-expression profiles of 20 HCC tissue samples, and identified a novel gene (transcription-involved protein upregulated in HCC) that encoded a 500-amino-acid protein containing 12 zinc-finger domains and a Kruppel-associated box domain, which was later termed ZNF689. ZNF689 was identified to be involved in suppressing the apoptosis of HCC cells via downregulation of the expression of pro-apoptotic factors.

ZNF689 protein expression was detected by IHC in 102 cases of HCC tissues and paired non-cancerous tissues in the present study and 45 of the HCC cases were positive for expression of ZNF689, which was consistent with previous results (13), including a study by Shigematsu et al (13), reporting that ZNF689 knockdown induced expression of the pro-apoptotic factors of the Bcl-2 family, Bax, Bcl-2 antagonist/killer 1 and Bid, resulting in tumor cell apoptosis. Suppression of tumor cell apoptosis by ZNF689 is reflected by increased tumor burden, as indicated by tumor size. Hu et al (19) demonstrated that Bcl-2 associated death promoter (Bad) serves a key function in HCC development, and that low expression of Bad is associated with larger tumor size and poor prognosis. It was also identified that HCC tumor cell growth was inhibited by microRNA-204 via downregulation of Bcl-2, and low expression of microRNA-204 is markedly associated with increased tumor size (20). These data are consistent with the results of the present study, indicating an association between HCC cell apoptosis and solid tumor size.

MVI is an important indicator of poor prognosis for patients receiving radical liver resection; patients without MVI have improved short- and long-term survival outcomes and a lack of MVI is associated with short- and long-term recurrence rate (21). Previous studies have revealed that tumor size is a predictor of MVI (22–24). For example, a cohort of patients from Australia was retrospectively analyzed, and investigators identified that a tumor size >5 cm was independently associated with MVI (25). Since positive expression of ZNF689 was associated with larger tumor size, it may also be directly associated with the presence of MVI. Although a variety of studies have investigated the association between tumor angiogenesis and MVI, the mechanism of MVI has not yet been completely elucidated. The question of whether ZNF689 serves a key function in the angiogenesis of HCC requires further investigation.

The tumor capsule is a unique characteristic of HCC, functioning as a barrier preventing cancer cell invasion of adjacent tissues or distant organs (26). Investigators have reached a consensus that tumor capsule infiltration is an important prognostic factor of HCC following liver resection. Iguchi et al (26) suggested that extracapsular penetration is a prognostic factor of overall and disease-free survival, and demonstrated that the percentage of tumor capsule infiltration in larger tumor types is increased compared with that in smaller tumor types (27). Consequently, tumor capsule infiltration may be considered as a result of tumor cell growth (28). Consistent with these results, ZNF689 was identified to participate in suppressing the apoptosis of HCC tumor cells, and inhibition of cell apoptosis may increase the diameter of solid tumor types, which may also lead to tumor capsule infiltration.

Considering the mechanism of ZNF689 in regulating the invasive ability of HCC, a series of in vitro experiments were performed. ZNF689 knockdown and overexpressed HCC cell lines were established and the expression of biomarkers and important components of EMT were compared. The present study demonstrated that the knockdown of ZNF689 may inhibit proliferation and invasion of HCC cells by the Wnt-β-catenin-snail pathway. It is known that EMT is associated with the progressive ability of numerous malignant tumors (29). Currently, three signaling pathways have been demonstrated to regulate the EMT process (30,31). The wnt-β-catenin signaling pathway has been demonstrated to serve key functions in regulating HCC invasion and migration by previous studies. Snail is a common target gene in the wnt-β-catenin pathway, which serves critical functions at the post-transcriptional level (32). The present study identified the association between ZNF689 alteration and the wnt-β-catenin pathway, however, in vivo experiments should be performed for further confirmation.

The present study had several limitations. First, a comparatively high rate of loss to follow-up reduced the reliability of the survival analysis. Furthermore, the majority of the patients in the present study suffered from a HBV infection, with underlying liver cirrhosis. Whether a difference in ZNF689 expression between HCC tissue and normal liver tissue also exists in non-cirrhotic HCC requires further investigation.

In conclusion, the present study demonstrated that ZNF689 was upregulated in HCC tissues compared with normal liver tissues, and the expression level of ZNF689 was associated with tumor size, MVI and tumor capsule infiltration. Positive expression of ZNF689 was identified to be a poor prognostic factor for OS and progression-free survival. These data suggest that ZNF689 may be a novel factor in the design of treatment strategies for HCC and in predicting the prognosis of patients with HCC following liver resection. Inhibitors of ZNF689 may be designed to knockdown expression of ZN689 and serve as a complementary strategy to HCC treatment.

Acknowledgements

The authors would like to acknowledge the support of the Department of Pathology and Clinical Sample Bank of West China Hospital.

Funding

The present study was funded by grants from the National Natural Science Foundation of China (grant. no. 71673193), and the Key Technology Research and Development Program of the Sichuan Province (grant. no. 2015SZ0131).

Availability of data and materials

All data generated or analyzed during this study are included in this published article.

Authors' contributions

PY wrote the paper and undertook the majority of experiments, BW and GZ were responsible for data collection, DD analyzed the available data, JL proposed the idea and approved the submission of the present study.

Ethics approval and consent to participate

Written informed consent was obtained from all enrolled patients, and the study was ethically approved by the Biomedical Ethics Committee of West China Hospital.

Patient consent for publication

Written informed consent was obtained from all study participants for publication associated data and images in this study.

Competing interests

The authors declare that they have no competing interests.

References

1 

Mazzanti R, Arena U and Tassi R: Hepatocellular carcinoma: Where are we? World J Exp Med. 6:21–36. 2016. View Article : Google Scholar : PubMed/NCBI

2 

Bruix J, Reig M and Sherman M: Evidence-based diagnosis, staging, and treatment of patients with hepatocellular carcinoma. Gastroenterology. 150:835–853. 2016. View Article : Google Scholar : PubMed/NCBI

3 

Yi PS, Zhang M and Xu MQ: Management of the middle hepatic vein in right lobe living donor liver transplantation: A meta-analysis. J Huazhong Univ Sci Technolog Med Sci. 35:600–605. 2015. View Article : Google Scholar : PubMed/NCBI

4 

Llovet JM, Bru C and Bruix J: Prognosis of hepatocellular carcinoma: The BCLC staging classification. Semin Liver Dis. 19:329–338. 1999. View Article : Google Scholar : PubMed/NCBI

5 

Llovet JM, Ricci S, Mazzaferro V, Hilgard P, Gane E, Blanc JF, de Oliveira AC, Santoro A, Raoul JL, Forner A, et al: Sorafenib in advanced hepatocellular carcinoma. N Engl J Med. 359:378–390. 2008. View Article : Google Scholar : PubMed/NCBI

6 

Hu MD, Jia LH, Liu HB, Zhang KH and Guo GH: Sorafenib in combination with transarterial chemoembolization for hepatocellular carcinoma: A meta-analysis. Eur Rev Med Pharmacol Sci. 20:64–74. 2016.PubMed/NCBI

7 

Yuan SX, Yang F, Yang Y, Tao QF, Zhang J, Huang G, Yang Y, Wang RY, Yang S, Huo XS, et al: Long noncoding RNA associated with microvascular invasion in hepatocellular carcinoma promotes angiogenesis and serves as a predictor for hepatocellular carcinoma patients' poor recurrence-free survival after hepatectomy. Hepatology. 56:2231–2241. 2012. View Article : Google Scholar : PubMed/NCBI

8 

Silva FP, Hamamoto R, Furukawa Y and Nakamura Y: TIPUH1 encodes a novel KRAB zinc-finger protein highly expressed in human hepatocellular carcinomas. Oncogene. 25:5063–5070. 2006. View Article : Google Scholar : PubMed/NCBI

9 

Wang Q, Tan YX, Ren YB, Dong LW, Xie ZF, Tang L, Cao D, Zhang WP, Hu HP and Wang HY: Zinc finger protein ZBTB20 expression is increased in hepatocellular carcinoma and associated with poor prognosis. BMC Cancer. 11:2712011. View Article : Google Scholar : PubMed/NCBI

10 

Kan H, Huang Y, Li X, Liu D, Chen J and Shu M: Zinc finger protein ZBTB20 is an independent prognostic marker and promotes tumor growth of human hepatocellular carcinoma by repressing FoxO1. Oncotarget. 7:14336–14349. 2016. View Article : Google Scholar : PubMed/NCBI

11 

Yang Z, Sun B, Li Y, Zhao X, Zhao X, Gu Q, An J, Dong X, Liu F and Wang Y: ZEB2 promotes vasculogenic mimicry by TGF-β1 induced epithelial-to-mesenchymal transition in hepatocellular carcinoma. Exp Mol Pathol. 98:352–359. 2015. View Article : Google Scholar : PubMed/NCBI

12 

Wu D, Liu G, Liu Y, Saiyin H, Wang C, Wei Z, Zen W, Liu D, Chen Q, Zhao Z, et al: Zinc finger protein 191 inhibits hepatocellular carcinoma metastasis through discs large 1-mediated yes-associated protein inactivation. Hepatology. 64:1148–1162. 2016. View Article : Google Scholar : PubMed/NCBI

13 

Shigematsu S, Fukuda S, Nakayama H, Inoue H, Hiasa Y, Onji M and Higashiyama S: ZNF689 suppresses apoptosis of hepatocellular carcinoma cells through the down-regulation of Bcl-2 family members. Exp Cell Res. 317:1851–1859. 2011. View Article : Google Scholar : PubMed/NCBI

14 

Jiang BG, Wan ZH, Huang J, Li LM, Liu H, Fu SY, Yang Y, Zhang J, Yuan SX, Wang RY, et al: Elevated ZC3H15 increases HCC growth and predicts poor survival after surgical resection. Oncotarget. 7:37238–37249. 2016.PubMed/NCBI

15 

Papatheodoridis GV, Cholongitas E, Dimitriadou E, Touloumi G, Sevastianos V and Archimandritis AJ: MELD vs Child-Pugh and creatinine-modified Child-Pugh score for predicting survival in patients with decompensated cirrhosis. World J Gastroenterol. 11:3099–3104. 2005. View Article : Google Scholar : PubMed/NCBI

16 

Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods. 25:402–408. 2001. View Article : Google Scholar : PubMed/NCBI

17 

Specht E, Kaemmerer D, Sanger J, Wirtz RM, Schulz S and Lupp A: Comparison of immunoreactive score, HER2/neu score and H score for the immunohistochemical evaluation of somatostatin receptors in bronchopulmonary neuroendocrine neoplasms. Histopathology. 67:368–377. 2015. View Article : Google Scholar : PubMed/NCBI

18 

Xu W, Liu H, Liu ZG, Wang HS, Zhang F, Wang H, Zhang J, Chen JJ, Huang HJ, Tan Y, et al: Histone deacetylase inhibitors upregulate Snail via Smad2/3 phosphorylation and stabilization of Snail to promote metastasis of hepatoma cells. Cancer Lett. 420:1–13. 2018. View Article : Google Scholar : PubMed/NCBI

19 

Hu W, Fu J, Lu SX, Liu LL, Luo RZ, Yun JP and Zhang CZ: Decrease of Bcl-xL/Bcl-2-associated death promoter in hepatocellular carcinoma indicates poor prognosis. Am J Cancer Res. 5:1805–1813. 2015.PubMed/NCBI

20 

Li K, Xyu Q, Liu X, Liu Q and Wang M: Growth inhibition of human hepatocellular carcinoma by miRNA-204 via down-regulation of Bcl-2 and Sirt1 expression. Xi Bao Yu Fen Zi Mian Yi Xue Za Zhi. 31:168–172. 2015.(In Chinese). PubMed/NCBI

21 

Yu YQ, Wang L, Jin Y, Zhou JL, Geng YH, Jin X, Zhang XX, Yang JJ, Qian CM, Zhou DE, et al: Identification of serologic biomarkers for predicting microvascular invasion in hepatocellular carcinoma. Oncotarget. 7:16362–16371. 2016.PubMed/NCBI

22 

Shen J, Wen J, Li C, Wen T, Yan L, Li B, Yang J and Lu C: The prognostic value of microvascular invasion in early-intermediate stage hepatocelluar carcinoma: A propensity score matching analysis. BMC Cancer. 18:2782018. View Article : Google Scholar : PubMed/NCBI

23 

Giannini EG, Bucci L, Garuti F, Brunacci M, Lenzi B, Valente M, Caturelli E, Cabibbo G, Piscaglia F, Virdone R, et al: Patients with advanced hepatocellular carcinoma need a personalized management: A lesson from clinical practice. Hepatology. 67:1784–1796. 2018. View Article : Google Scholar : PubMed/NCBI

24 

Imai K, Yamashita YI, Yusa T, Nakao Y, Itoyama R, Nakagawa S, Okabe H, Chikamoto A, Ishiko T and Baba H: Microvascular invasion in small-sized hepatocellular carcinoma: Significance for outcomes following hepatectomy and radiofrequency ablation. Anticancer Res. 38:1053–1060. 2018.PubMed/NCBI

25 

Schlichtemeier SM, Pang TC, Williams NE, Gill AJ, Smith RC, Samra JS, Lam VW, Hollands M, Richardson AJ, Pleass HC, et al: A pre-operative clinical model to predict microvascular invasion and long-term outcome after resection of hepatocellular cancer: The Australian experience. Eur J Surg Oncol. 42:1576–1583. 2016. View Article : Google Scholar : PubMed/NCBI

26 

Iguchi T, Aishima S, Taketomi A, Nishihara Y, Fujita N, Sanefuji K, Maehara Y and Tsuneyoshi M: Extracapsular penetration is a new prognostic factor in human hepatocellular carcinoma. Am J Surg Pathol. 32:1675–1682. 2008. View Article : Google Scholar : PubMed/NCBI

27 

Iguchi T, Aishima S, Sanefuji K, Fujita N, Sugimachi K, Gion T, Taketomi A, Shirabe K, Maehara Y and Tsuneyoshi M: Both fibrous capsule formation and extracapsular penetration are powerful predictors of poor survival in human hepatocellular carcinoma: A histological assessment of 365 patients in Japan. Ann Surg Oncol. 16:2539–2546. 2009. View Article : Google Scholar : PubMed/NCBI

28 

Li Y, Xu D, Bao C, Zhang Y, Chen D, Zhao F, Ding J, Liang L, Wang Q, Liu L, et al: MicroRNA-135b, a HSF1 target, promotes tumor invasion and metastasis by regulating RECK and EVI5 in hepatocellular carcinoma. Oncotarget. 6:2421–2433. 2015.PubMed/NCBI

29 

Brabletz T: Metastasis: EMT, microRNAs and cancer stem cells. Clin Experimental Metastasis. 32:187. 2015.

30 

Lamouille S, Xu J and Derynck R: Molecular mechanisms of epithelial-mesenchymal transition. Nat Rev Mol Cell Biol. 15:178–196. 2014. View Article : Google Scholar : PubMed/NCBI

31 

Kalluri R and Weinberg RA: The basics of epithelial-mesenchymal transition. J Clin Invest. 119:1420–1428. 2009. View Article : Google Scholar : PubMed/NCBI

32 

Yang JD, Nakamura I and Roberts LR: The tumor microenvironment in hepatocellular carcinoma: Current status and therapeutic targets. Semin Cancer Biol. 21:35–43. 2011. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Yi PS, Wu B, Deng DW, Zhang GN and Li JS: Positive expression of ZNF689 indicates poor prognosis of hepatocellular carcinoma. Oncol Lett 16: 5122-5130, 2018.
APA
Yi, P.S., Wu, B., Deng, D.W., Zhang, G.N., & Li, J.S. (2018). Positive expression of ZNF689 indicates poor prognosis of hepatocellular carcinoma. Oncology Letters, 16, 5122-5130. https://doi.org/10.3892/ol.2018.9295
MLA
Yi, P. S., Wu, B., Deng, D. W., Zhang, G. N., Li, J. S."Positive expression of ZNF689 indicates poor prognosis of hepatocellular carcinoma". Oncology Letters 16.4 (2018): 5122-5130.
Chicago
Yi, P. S., Wu, B., Deng, D. W., Zhang, G. N., Li, J. S."Positive expression of ZNF689 indicates poor prognosis of hepatocellular carcinoma". Oncology Letters 16, no. 4 (2018): 5122-5130. https://doi.org/10.3892/ol.2018.9295
Copy and paste a formatted citation
x
Spandidos Publications style
Yi PS, Wu B, Deng DW, Zhang GN and Li JS: Positive expression of ZNF689 indicates poor prognosis of hepatocellular carcinoma. Oncol Lett 16: 5122-5130, 2018.
APA
Yi, P.S., Wu, B., Deng, D.W., Zhang, G.N., & Li, J.S. (2018). Positive expression of ZNF689 indicates poor prognosis of hepatocellular carcinoma. Oncology Letters, 16, 5122-5130. https://doi.org/10.3892/ol.2018.9295
MLA
Yi, P. S., Wu, B., Deng, D. W., Zhang, G. N., Li, J. S."Positive expression of ZNF689 indicates poor prognosis of hepatocellular carcinoma". Oncology Letters 16.4 (2018): 5122-5130.
Chicago
Yi, P. S., Wu, B., Deng, D. W., Zhang, G. N., Li, J. S."Positive expression of ZNF689 indicates poor prognosis of hepatocellular carcinoma". Oncology Letters 16, no. 4 (2018): 5122-5130. https://doi.org/10.3892/ol.2018.9295
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team