Open Access

The development of simultaneous measurement of viral load and physical status for human papillomavirus 16 and 18 co‑infection using multiplex quantitative polymerase chain reaction

  • Authors:
    • Prinya Prasongdee
    • Patcharaporn Tippayawat
    • Temduang Limpaiboon
    • Chanvit Leelayuwat
    • Molin Wongwattanakul
    • Patcharee Jearanaikoon
  • View Affiliations

  • Published online on: October 4, 2018     https://doi.org/10.3892/ol.2018.9549
  • Pages: 6977-6987
  • Copyright: © Prasongdee et al. This is an open access article distributed under the terms of Creative Commons Attribution License.

Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )


Abstract

Persistent infection with human papillomavirus (HPV) type 16 and 18 is known to be a major risk factor for cervical cancer. Increased prevalence of co‑infection with these high‑risk types has been observed in pre‑cancerous and cancerous tissues. The determination of physical status and copy numbers of viruses is therefore useful in clinical settings. A simple multiplex quantitative polymerase chain reaction (qPCR) for HPV16/HPV18 co‑infection in one tube reaction was established in the present study using TaqMan®‑based PCR for E2 and E6 viral DNA. The detection range was up to 106 copies with 100% specificity and high precision (CV of cycle time <0.5%). The analytical accuracy and robustness were verified by competitive assay using an unequal mixture of HPV16/HPV18 DNA. No significant effect was demonstrated when compared with the simplex qPCR. The detection of physical status was evaluated in cervical samples, including 5 pre‑cancerous and 15 cancerous samples. No significant difference was observed between simplex and multiplex qPCR (P=0.372). In conclusion, the developed multiplex qPCR method successfully demonstrated the viral status of the common HPV types in one tube. This assay will facilitate viral assessment and monitoring of cervical cancer associated with HPV16 and HPV18 co‑infection.

Introduction

Cervical cancer (CXCA) is the fourth leading cause of cancer-associated mortality among females worldwide (1). The majority of CXCA cases are associated with high risk human papillomavirus (HR-HPV) infection. Among HR-HPV, HPV16 and HPV18 account for 70% of all CXCA cases worldwide (1), including in Asian populations (2). Epidemiological data revealed an increase in multiple HPV infection from 10% of CXCA cases in 2005 (3) to 65% in 2016 (35). However, these figures may reflect a higher sensitivity of detection, resulting in the co-infection of HPV16 and HPV18 being reported as the most common HR-HPV in Africa (6) and Asia (7), and specifically in Thailand (8), as 31.9, 20.8 and 27.8%, respectively. An increased odds ratio of HPV16 and 18 co-infection compared with single infection was demonstrated by Chaturvedi et al (9) and Trottier et al (10), but the opposite results were reported by Salazar et al (11). These controversial findings implied that other viral parameters, not only HPV genotype, may serve important roles in disease progression.

The physical state of HPV infection occurs as one of two forms: An episomal or an integrated form. The episomal state involves the complete life cycle of viral replication in the infected host cells, whereas the integrated form involves integration of HPV DNA into the host DNA, a major genetic event leading to cervical carcinogenesis (12). Viral integration and viral load have previously been reported to be biomarkers for cancer with high-grade cervical lesions (13). Several methods have been used for the detection of integrated HPV, including polymerase chain reaction (PCR) (14), in situ hybridization (15,16) and amplification of papillomavirus oncogene transcripts (APOT) (17). These are all qualitative measurements. Recently, we established a quantitative PCR of E2 and E6 genes to measure the viral load and physical status of HPV16 DNA in one tube (18). A ratio of E2/E6 gene of 1.0 is used to define the episomal form, while a decreased ratio (less than 1.0) indicates the integrated form, due to deletion of the E2 gene during viral integration. The present study demonstrated the benefit of using viral numbers and physical status as surrogate markers of cancer progression.

To the best of our knowledge, the present study was the first to report the simultaneous measurement of 4 genes, E2 and E6 genes of HPV16 and HPV18, in a single tube. The development of multiplex qPCR in the present study provides a total coverage of 70% of HR-HPV-associated CXCA, including single and co-infection of HPV16 and HPV18. The analytical performance of the multiplex qPCR was evaluated in clinical samples, compared with simplex qPCR.

Materials and methods

Samples

A total of 20 cervical tissues harboring single or co-infection of HPV16 and HPV18 were collected from 5 pre-cancerous lesions (mean, 42.2±6.6 years) and 15 cancerous lesions (mean, 49.5±13.7 years). Samples were collected between 2002 and 2004 under written informed consents approved by the Ethical Committee of Khon Kaen University, Khon Kaen, Thailand (approval no. HE562296) and between 2013 and 2014 approved by the the Ubonratchathani Cancer Hospital, Ubon Ratchathani, Thailand (approval no. CE012/2013). DNA samples were extracted using a QIAamp Viral DNA kit (Qiagen GmbH, Hilden, Germany), according to the manufacturer's protocol. Extracted DNA was used for HPV16 and HPV18 screening by Nested Multiplex PCR, as previously described (19).

Cell culture

The human papillomavirus Caski and HeLa cell lines containing the integrated form of HPV16 (600 DNA copies per cell) and HPV18 (20–50 DNA copies per cell) were used as internal standard for determination of physical status of HPV16 and 18, respectively. HeLa cell line containing HPV18 and CaSki cell line containing HPV16 were used as HPV positive controls. Cells were cultured in 25 cm2 flasks at 37°C with 5% CO2 in Dulbecco's Modified Eagle Medium high glucose (DMEM-HG) media supplemented with 10% fetal bovine serum and 1% penicillin-streptomycin (10,000 U/ml penicillin and 10 mg/ml streptomycin; all Invitrogen; Thermo Fisher Scientific, Inc., Waltham, MA, USA). At 70% confluency, cells were trypsinized with 1 ml of 1X trypsin-EDTA at 37°C for 5 min. The cell pellets were collected and centrifuged at 2,000 rpm for 3 min and subsequently used for DNA extraction.

HPV16 and HPV18 integration status assay

Plasmids containing the whole genomes of HPV16, HPV18, HPV45 and HPV58 (PBR322 for HPV16 and HPV58, PGM4 for HPV18 and HPV45) were provided by Professor Pientong from the Department of Microbiology, Faculty of Medicine, Khon Kaen University. Purified recombinant plasmid copy numbers were estimated by a spectrophotometer concentration measurement (NanoDrop 2000; Thermo Fisher Scientific, Inc.). The DNA calculation formula was 6.02×1023 (copies/mol) xA260 (ng/ml)/(DNA length ×660)=copies/ml. Plasmid DNA was then diluted with sterile water to obtain between 106 and 102 copies, and was used to establish calibration curves for measuring E2 and E6 by multiplex qPCR using a TaqMan® probe assay (Bioneer Corporation, Daejeon, Korea). The oligonucleotide sequences of primers and probes were followed as previously described (20,21), with modifications to the quencher and reporter fluorescent dyes (Table I). E2 and E6 DNA were amplified using a qPCR thermocycler (Exicycler™; Bioneer Corporation). Each 50 µl reaction mixture contained a premix (AccuPower® DualStar™; Bioneer Corporation) with 0.4 µM probes and primers. The PCR reaction was initiated at 95°C for 10 min, followed by 40 cycles at 95°C for 15 sec and 63°C for 60 sec. Reactions lacking DNA template were used as negative controls as previously described. Quantification of E2 and E6 genes were analyzed using the calibration curve plotted between the quantification cycle (Cq) on the x-axis and the logarithm of the standard copy number on the y-axis (102−106 copies). Linear regression equations were estimated as indicated in Fig. 1. The obtained Cq from samples were used to calculate E2 and E6 copies from these equations. Amplification efficiency was determined from the slope of log-linear calibration curve (10−1/slope−1) (22).

Table I.

Oligonucleotide sequences and TaqMan® probes used for amplification of E2 and E6 genes of HPV16 and HPV18.

Table I.

Oligonucleotide sequences and TaqMan® probes used for amplification of E2 and E6 genes of HPV16 and HPV18.

HPV typeNameSequence (5′-3′)Amplified product length (bp)(Refs.)
HPV16HPV16 E2 Forward primer AACGAAGTATCCTCTCCTGAAATTATTAG82Peitsaro et al, 2002 (20)
HPV16 E2 Reverse primer CCAAGGCGACGGCTTTG
HPV16 E2 Probe (TAMRA)-CACCCCGCCGCGACCCATA-(BHQ)
HPV16 E6 Forward primer GAGAACTGCAATGTTTCAGGACG81
HPV16 E6 Reverse primer TGTATAGTTGTTTGCAGCTCTGTGC
HPV16 E6 gene Probe(Texus red)-CAGGAGCGACCCAGAAAGTTACCACAGTT-(BHQ)
HPV18HPV18 E2 Forward primer AGAAGCAGCATTGTGGACCT167Damay et al, 2009 (21)
HPV18 E2 Reverse primer GGTCGCTATGTTTTCGCAAT
HPV18 E2 Probe (TeT)-TCAACC-CACTTCTCGGTGCAGC-(BHQ)
HPV18 E6 Forward primer TCACAACATAGCTGGGCACT91
HPV18 E6 Reverse primer CTTGTGTTTCTCTGCGTCGT
HPV18 E6 Probe (FAM)-GCCATTCGTGCTGCAACCGA-(BHQ)

[i] HPV, human papillomavirus; bp, base pairs.

Optimization of temperature for multiplex qPCR

Multiplex qPCR temperature for HPV16 (E2 and E6 genes) and HPV18 (E2 and E6 genes) was optimized. A mixture of 105 copies of plasmids containing the whole genomes of HPV16 and HPV18 was used to optimize the annealing temperature from 55 to 64°C. The temperature that produced the lowest Cq was selected as the optimal annealing temperature.

Evaluation of multiplex qPCR performances
Multiplex qPCR analytical range

Ten-fold dilutions of mixed HPV16 and HPV18 whole genomic DNA (from 102 to 106 copies) were used as templates for determining the analytical range.

Multiplex qPCR analytical imprecision

Within-run and between-run precision were each determined using low (103 copies) and high (106 copies) concentrations of whole genome HPV16 and HPV18 DNA mixtures.

Multiplex qPCR analytical specificity

Cross-reactivity with two other HPV genotypes, HPV45 and HPV58, was tested. No fluorescent signal indicated a lack of cross-reaction, and uninfected HPV DNA was used as a negative control.

Competitive effect of HPV16 and HPV18 in multiplex qPCR

A mixture of unequal concentrations of HPV16 and HPV18 DNA (from 103 to 106 copies) was used to evaluate competitive effects in multiplex qPCR. E2 and E6 copies obtained from unequal HPV16 and HPV18 templates (test) were compared to those determined using a single template of HPV16 or HPV18 (control) by a paired t-test. No significant difference (P>0.05) indicated no competitive effect.

Evaluation of physical status using multiplex qPCR in clinical samples

The cut-off value for an episomal form (complete E2 and E6 sequence) was first determined using plasmid DNA containing whole HPV16 and HPV18 genomes. The E2/E6 ratio was calculated by the 95% confidence interval (CI) and used to interpret physical status in clinical samples as previously described (18). To verify the accuracy of the multiplex qPCR of HPV16 and HPV18, 105 copies of Caski and HeLa cells containing pure integrated HPV16 and HPV18, respectively, were prepared according to the DNA calculation formula and used as internal standards for the integrated form. A total of 105 copies of whole plasmid genome HPV16 and HPV18 were used as internal standards for the episomal form. The two cell lines were provided by Professor Pientong. A total of 20 cervical samples with single and mixed infection were used to compare the copy number and physical status between the simplex and multiplex qPCR using paired t-tests and χ2 tests.

Statistical analysis

The linear regression equation was estimated from standard curves between viral copy number (y-axis) and cycle time (x-axis). The percentage of efficiency between 80–120% and correlation (R2) >0.98 were used to determine the standard curve. The comparison of viral copy number between multiplex and simplex was performed using paired t-tests, while physical status was compared by χ2 test. P<0.05 was considered to indicate a statistically significant difference. Statistical analysis was performed using SPSS 19 software (IBM Corp., Armonk, NY, USA) under a Khon Kaen University license.

Results

Multiplex qPCR performance for the detection of HPV16 and HPV18 (E2 and E6 genes)

The optimization of Cq was performed under annealing temperatures from 55 to 64°C, as demonstrated in Fig. 2. The optimal Cq for the E2 and E6 genes of HPV16 was 63°C, whereas the optimal Cq for HPV18 was between 55 and 64°C. Therefore, 63°C was used to construct a standard curve for HPV16 and HPV18 multiplex qPCR, as demonstrated in Fig. 1. According to the guidelines for validation of quantitative PCR methods, linear regression and correlation (R2) analyses for each gene revealed an acceptable efficiency of 109–115% (23). The analytical range was verified at 1,000-1,000,000 copies for HPV16 and HPV18, with average imprecision from 0.42 to 0.50% CV as demonstrated in Fig. 1. The imprecision of measured HPV copies is presented in Table II. The average CV of within-run and between-run was 10.2 and 12.1, respectively. No cross reactivity was observed with HPV58 and HPV45 (Fig. 3).

Table II.

Analytical imprecision of the HPV16 (E2 and E6 genes) and HPV18 (E2 and E6 genes) measurement using multiplex quantitative polymerase chain reaction.

Table II.

Analytical imprecision of the HPV16 (E2 and E6 genes) and HPV18 (E2 and E6 genes) measurement using multiplex quantitative polymerase chain reaction.

HPV16 E2 geneHPV16 E6 gene


PrecisionMean ± SD (CV%) CqMean ± SD (CV%) Copy numberMean ± SD (CV%) CqMean ± SD (CV%) Copy number
Within-run (n=12)a
Low levelc32.41±0.18 (0.54)961±127.1 (13.23)33.67±0.17 (0.52)1,084±149.1 (13.74)
High leveld23.11±0.08 (0.35)952,490±59,040.35 (6.19)24.59±0.10 (0.39)1,097,119±81,784.1 (7.45)
Between-run (n=15)b
Low levelc32.61±0.20 (0.60)973±141.36 (14.53)34.26±0.19 (0.54)929±137.45 (14.79)
High leveld23.37±0.14 (0.59)911,140±91,626.87 (10.06)25.04±0.14 (0.55) 1,040,597±112,028.74 (10.77)

HPV18 E2 geneHPV18 E6 gene


PrecisionMean ± SD (CV) CqMean ± SD (CV) Copy numberMean ± SD (CV) CqMean ± SD (CV) Copy number

Within-run (n=12)a
  Low levelc33.47±0.17 (0.52)1,159±160.1 (13.81)34.83±0.18 (0.52)1,067±144.35 (13.52)
  High leveld24.61±0.07 (0.29)1,123,790±60,126.32 (5.4)25.73±0.11 (0.44)1,023,242±86,472.54 (8.45)
Between-run (n=15)b
  Low levelc34.03±0.19 (0.57)996±147.1 (14.76)34.77±0.19 (0.53)958±134.18 (14.00)
  High leveld25.00±0.11 (0.43)992,011±81,890.14 (8.25)25.42±0.13 (0.51) 1,054,498±101,053.01 (9.58)

a 12 replicates per experiment

b Triplicate in 5 independent experiments

c 103 copies of HPV16 and HPV18 DNA

d 106 copies of HPV16 and HPV18 DNA. HPV, human papillomavirus; Cq, quantification cycle.

Evaluation of competitive effect of unequal HPV16 and HPV18 template concentrations in multiplex qPCR

To mimic the presence of HPV16 and HPV18 co-infection up to 1,000-fold difference in the same sample, measurement of mixed HPV16 and HPV18 DNA was compared in parallel with that of single HPV16 and HPV18. Different concentrations of HPV16 and HPV18 exhibited no effect on the quantification of E2 (P=0.319 and P=0.526, respectively) and E6 genes (P=0.347 and P=0.146, respectively), as demonstrated in Tables III and IV. Therefore, our established multiplex qPCR platform provided an accurate measurement for the presence of HPV16 and HPV18 co-infection.

Table III.

Competitive effect of unequal DNA copies between HPV16 and HPV18 on the measurement of HPV16 E2 and E6 genes using multiplex quantitative polymerase chain reaction.

Table III.

Competitive effect of unequal DNA copies between HPV16 and HPV18 on the measurement of HPV16 E2 and E6 genes using multiplex quantitative polymerase chain reaction.

HPVE2 geneHPVE6 gene


Unequal mixture HPV16 and HPV18Single HPV16Unequal mixture HPV16 and HPV18Single HPV16
Copy RatioMeasuredCopy ofMeasured copiesCopy RatioMeasuredCopyMeasured copies
(HPV16:HPV18)copies (Test)aHPV16 (Control)a(HPV16:HPV18)copies (Test)aof HPV16 (Control)a
106:103945,3671061,026,287 106:103979,4971061,039,326
106:104901,450106915,772 106:104900,328106913,776
106:105921,335106897,221 106:105914,673106911,439
106:106979,241106980,160 106:1061,039,326106964,189
105:10389,55410590,112 105:10387,55610589,341
105:10495,749105103,356 105:10491,58610598,371
105:10596,968105105,065 105:10597,092105103,174
105:10694,15910592,332 105:106112,708105100,329
104:1038,8321049,149 104:10311,21910410,439
104:1048,83610410,626 104:1049,1751049,303
104:1058,9131049,319 104:1058,64110410,322
104:10611,34710410,861 104:10610,9891049,018
103:1031,1431031,200 103:1031,0391031,153
103:104867103912 103:104907103865
103:1058811031,122 103:105848103973
103:106848103901 103:106846103908

a Non-significant differences between test and control for HPV16 E2 (P=0.319; paired Student's t-test) and HPV16 E6 (P=0.347; paired Student's t-test). HPV, human papillomavirus.

Table IV.

Competitive effect of unequal copies between HPV16 and HPV18 on the measurement of HPV18 E2 and E6 genes using multiplex quantitative polymerase chain reaction.

Table IV.

Competitive effect of unequal copies between HPV16 and HPV18 on the measurement of HPV18 E2 and E6 genes using multiplex quantitative polymerase chain reaction.

HPVE2 geneHPVE6 gene


Unequal mixture HPV18 and HPV16Single HPV18Unequal mixture HPV18 and HPV16Single HPV18
Copy ratioMeasured copiesCopy ofMeasured copies ofCopy ratioMeasured copiesCopy ofMeasured copies of
(HPV18:HPV16)of HPV18E2 (Test)aHPV18HPV18E2 (Control)a(HPV18:HPV16)of HPV18E6 (Test)aHPV18HPV18E6 (Control)a
106:1031,135,6611061,075,620 106:1031,015,4641061,107,241
106:1041,097,9761061,181,450 106:1041,107,1701061,125,579
106:105877,3851061,135,265 106:105911,742106893,768
106:1061,092,086106993,922 106:106965,6781061,040,114
105:103104,61110596,998 105:10390,54610594,778
105:104101,164105113,785 105:10497,952105113,933
105:105105,464105101,469 105:105110,17510587,996
105:106102,760105113,715 105:10687,492105107,587
104:1039,1291048,789 104:10310,2011049,746
104:1049,5501049,443 104:1049,73210410,395
104:1058,6391049,988 104:10510,4031048,665
104:10610,7001049,812 104:1068,91010410,550
103:1039121031,120 103:1039371031,056
103:1049361031,078 103:104910103938
103:105849103831 103:105901103833
103:1068961031,168 103:1068691031,063

a Non-significant difference between test and control for HPV18E2 (P=0.526; paired t-test) and HPV18E6 (P=0.146; paired t-test). HPV, human papillomavirus.

Evaluation of physical status in clinical samples

Cut-off values for viral status were calculated as previously described by Wanram et al (18) and are shown in Table V. The E2/E6 ratio was identified as 0.78–1.10 and 0.85–1.18 for HPV16 and HPV18, respectively. An E2/E6 ratio of 0 was defined as the absolute integrated form, whereas E2/E6 >0 and less than the cut-off value was interpreted as the mixed form of episomal and integrated HPV (18). Comparisons of HPV16 and HPV18 copy numbers between the simplex and multiplex qPCR in CXCA samples are summarized in Table VI. No significant difference between simplex and multiplex qPCR was observed for HPV16 E2 and E6 (P=0.307 and P=0.288; paired t-test) and HPV18 E2 and E6 genes (P=0.396 and P=0252; paired t-test). The physical status obtained from multiplex qPCR was also compared with that from the simplex qPCR. The cut-off value for the episomal form of HPV16 (0.79–1.10) and HPV18 (0.85–1.18) was calculated as previously described for multiplex qPCR. Interpretation of physical status was similar in 95% (19/20) of cases between multiplex and simplex qPCR assays, and differed in one case, CX-1 (P=0.372; χ2 test; Table VI).

Table V.

Estimation of cut-off values (E2 and E6 ratios) for the interpretation of physical status using various concentrations of whole genome plasmid DNA from 104 to 106 copies.

Table V.

Estimation of cut-off values (E2 and E6 ratios) for the interpretation of physical status using various concentrations of whole genome plasmid DNA from 104 to 106 copies.

HPV16HPV18


No.Mixture of equal concentration of HPV16 and HPV18E2 gene (copy)E6 gene (copy)E2/E6E2 gene (copy)E6 gene (copy)E2/E6
11031,1151,1031.011,1531,2330.94
21031,1151,1850.941,0191,2100.84
31039081,0440.871,1931,2110.99
41031,1681,16911,1551,1341.02
51031,0381,0470.991,1461,1790.97
61048,88210,8140.8210,7609,8581.09
71048,78910,4380.849,1879,4080.98
81049,01910,3790.878,7039,0620.96
91049,2339,26818,5138,2201.04
101049,1179,3370.989,68711,6220.83
1110594,603105,8190.89110,462107,9701.02
12105108,055108,9280.99107,699102,8821.05
1310588,246100,4490.88106,38998,2691.08
1410587,938105,3700.83114,166112,2761.02
15105106,246100,9781.05109,971113,4420.97
161061,098,5311,059,6411.041,086,195991,3201.1
17106926,410982,1530.941,097,976996,5241.1
18106912,7831,076,1850.851,085,161927,6451.17
191061,020,080931,1431.11,086,1951,005,8261.08
20106940,240997,2340.941,146,4351,142,5881
Mean0.94 Mean1.01
SD0.08 SD0.08
Mean ± 2SD0.78–1.10 Mean ± 2SD0.85–1.18

[i] HPV, human papillomavirus; SD, standard deviation.

Table VI.

Comparison of viral copy number and physical status determination between multiplex qPCR (test) and simplex qPCR (control) in 20 cervical tissues samples harboring single and co-infection of HPV16 and HPV18.

Table VI.

Comparison of viral copy number and physical status determination between multiplex qPCR (test) and simplex qPCR (control) in 20 cervical tissues samples harboring single and co-infection of HPV16 and HPV18.

Simplex qPCR (Control)Multiplex qPCR (Test)


Copies/ng DNAPhysical statusCopies/ng DNAPhysical statusCopies/ng DNAPhysical statusCopies/ng DNAPhysical status








CXCA samples (HPV)HPV16 E2HPV16 E6E2/E6 ratio (0.79)aInterpretationHPV18 E2HPV18 E6E2/E6 ratio (0.81)bInterpretationHPV16 E2HPV16 E6E2/E6 ratio (0.78)cInterpretationHPV18 E2HPV18 E6E2/E6 ratio (0.85)dInterpretation
PCX 1 (16)5,139498,7620.01Mixed4,196470,4920.01Mixed
PCX 2 (16)31232,1900.01Mixed20330,6130.01Mixed
PCX 3 (16)5,8156,0870.96Episomal5644.396196.230.91Episomal
PCX 4 (18)191,0650Integrated153,5400Integrated
PCX 5 (18)9,3800Integrated11,8970Integrated
CX 1 (16)118,584157,5220.75Mixed108,968133,7760.81Episomal
CX2 (16)30,35326,3531.15Episomal32,58824,1181.35Episomal
CX 3 (16)24,2370Integrated26,8140Integrated
CX 4 (16)38,04144,1220.86Episomal38,78848,1080.81Episomal
CX 5 (16)6,2096,7210.92Episomal6,8797,3950.93Episomal
CX 6 (18)15,64945,4550.34Mixed16,85742,2400.4Mixed
CX 7 (18)73,9290Integrated70,9120Integrated
CX 8 (18)74,23756,2711.32Episomal71,24354,0391.32Episomal
CX 9 (16+18)8553,4680.25Mixed3265210.63Mixed1,0143,9190.26Mixed2054200.49Mixed
CX 10 (16+18)39,350123,4200.32Mixed2664100.65Mixed36,000155,4290.23Mixed1132370.48Mixed
CX 11 (16+18)2,834,8876,008,7650.47Mixed4,0903,0871.32Episomal2,592,8575,571,4290.47Mixed3,0642,4141.27Episomal
CX 12 (16+18)4,12214,9790.28Mixed4034780.84Episomal3,30517,3600.19Mixed3713561.04Episomal
CX 13 (16+18)1202770.43Mixed2194150.53Mixed922270.41Mixed1973390.58Mixed
CX 14 (16+18)9,12424,5100.37Mixed1,0340Integrated8,73320,6000.42Mixed8530Integrated
CX 15 (16+18)512,9800Integrated9810Integrated488,5000Integrated7410Integrated
Internal control
HPV16; Caski095,8590Integrated000091,7910Integrated000
HPV18; HeLa0000102,8250Integrated0000110,2750Integrated
Whole plasmid HPV16109,334102,6751.06Episomal106,445105,9881.00Episomal
Whole plasmid HPV1899,54598,96551.01Episomal100,59999,4531.01Episomal

{ label (or @symbol) needed for fn[@id='tfn9-ol-0-0-9549'] } The cut-off value of physical status interpretation for

a HPV16

b HPV18 using simplex qPCR; for

c HPV16

d HPV18 using multiplex qPCR. There was no significant difference in copy numbers between simplex and multiplex qPCR for HPV16 E2 gene (P=0.307; paired t-test); HPV16 E6 gene (P=0.288; paired t-test). There was no significant difference in copy numbers between simplex and multiplex qPCR for HPV18 E2 gene (P=0.396; paired t-test); HPV18 E6 gene (P=0.252; paired t-test). There was no significant difference in physical status from multiplex qPCR compared with simplex qPCR (P=0.372; χ2 test). Caski and HeLa cell lines containing 100,000 copies of E6 gene were used as internal standard for integrated HPV16 and HPV18/Whole plasmid HPV16 and HPV18 100,000 copies of E2 and E6 genes were used as internal standard for episomal HPV16 and HPV18. qPCR, quantitative polymerase chain reaction; HPV, human papillomavirus; PCX, pre-cancerous cervical tissues; CX, cervical cancer tissues.

Discussion

Multiple HR-HPV infection, particularly HPV16 and HPV18 co-infection, is now a concern due to its effects on cervical neoplasia development. The failure rate of treatment was previously reported to be increased by 5-fold in multiple infection (57%), compared with single infection (12%) (24). Therefore, a suitable risk assessment among patients with persistent multiple HR-HPV infection is required. To assess the risk, viral load and viral physical status may be used for cancer prognosis. In the present study, a one tube qPCR assay for HPV16 and HPV18 co-infection was successfully established with acceptable performance in terms of specificity, accuracy and precision.

Upon performing a literature search for multiplex qPCR of 4 genes in one tube, one study by Zhao et al (25) was identified. The authors reported detection of 4 viral DNAs: HPV16 (E6 gene), HPV18 (E6 gene), HSV1 and HSV2, with an improved detection limit at 10 copies compared with the present study. The difference in the detection limit may result from the different size of viral DNA standard. Small fragments of viral DNA (66–139 bp) were used as standard in the study undertaken by Zhao et al, whereas the whole HPV genome (10728–12267 bp) was used in the present study. Accordingly, the small size template has an advantage for amplification when compared with the whole genome. Therefore, our established technique better represents the real viral infection in a clinical setting. To resolve this limitation, more DNA template may be adjusted. The accuracy of interpretation, including possible cross reactivity, was verified using DNA of known viral status from cervical Caski and HeLa cell lines. HPV58 and HPV45 were selected for cross reactivity according to the top 4 common HR-HPV types (HPV 16, 18, 45 and 58), covering 90% of cases among Thai women (26). Accurate quantification was not only demonstrated via comparison with simplex qPCR, but it was also revealed that there was no competitive effect of an unequal mixed HPV DNA template from 10- to 1,000-fold (Tables III and IV).

Furthermore, the comparison of viral physical status between simplex and multiplex qPCR in clinical samples achieved 95% (19/20 samples) agreement in the results of viral physical status. The different physical status of CX1 was caused by the variation of E2/E6 ratio between simplex (0.75) and multiplex (0.81) which closed to the cut-off value for episomal form (0.79 and 0.78) resulting in discrepancy results as mixed form and episomal form, respectively. This limitation of accuracy occurred at values close to the cut-off values.

In conclusion, the increased incidence of HPV16 and HPV18 co-infection is a high-risk factor for CXCA progression in patients with persistent HR-HPV infection. Therefore, the successful development of multiplex qPCR for detecting HPV16 and HPV18 viral load and physical status in a single tube would provide a significant benefit in terms of cost effectiveness and shorter assay time in the clinic. To assess the potential of using this assay as a risk assessment for cancer progression in patients with single and co-infection with HPV16 and HPV18, a larger sample size with clinical outcome data should be included in future studies. In particular, pre-cancerous and early cancerous cases harboring high risk factors should be followed up frequently with monitoring of risk factors.

Acknowledgements

Clinical stage of samples were provided by Dr Metee Wongsena (Chief of Gynecologic Cancer Department, Ubonratchathani Cancer Center, Ubonratchathani, Thailand) and Dr Pissamai Yuenyao (Srinagarind Hospital, Khon Kaen, Thailand).

Funding

The present study was supported by the Targeted Research Fund of Khon Kaen University from the The National Research Council of Thailand (Khon Kaen, Thailand) and the Post-doctoral training program for MW (grant no. 58330) from the Graduate School of Khon Kaen University, Thailand.

Availability of data and materials

The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.

Authors' contributions

PJ supervised, designed and assisted in the coordination of the present study. PP performed the research, the analysis and prepared data for the first draft of manuscript. TL and CL made substantial contributions in the conception and experimental design. MW was involved in data analysis, interpretation of data and drafting the final manuscript. PT assisted with data interpretation and revising the final manuscript. All authors have read and approved the final manuscript.

Ethics approval and consent to participate

The present study was approved by the Ethical Committee of Ubonratchathani Cancer Hospital (approval no. CE012/2013; Ubonratchathani, Thailand) and Khon Kaen University (approval no. HE562296; Kho Kaen, Thailand).

Patient consent for publication

All patients provided written informed consent for the publication of the present study.

Competing interests

The authors declare that they have no competing interests.

Glossary

Abbreviations

Abbreviations:

CXCA

cervical cancer

HR-HPV

high risk human papillomavirus

qPCR

quantitative polymerase chain reaction

CV

coefficient of variation

References

1 

Bruni L, Barrionuevo-Rosas L, Albero G, Serrano B, Mena M, Gómez D, Muñoz J, Bosch FX and de Sanjosé S: ICO information centre on HPV and cancer (HPV Information Centre). Human papillomavirus and related diseases in the World. Summary Report. 30–July;2017.

2 

Bruni L, Barrionuevo-Rosas L, Albero G, Serrano B, Mena M, Gómez D, Muñoz J, Bosch FX and de Sanjosé S: ICO information centre on HPV and cancer (HPV Information Centre). Human papillomavirus and related diseases in Asia. Summary Report. 27–July;2017.

3 

Li N, Franceschi S, Howell-Jones R, Snijders PJ and Clifford GM: Human papillomavirus type distribution in 30,848 invasive cervical cancers worldwide: Variation by geographical region, histological type and year of publication. Int J Cancer. 128:927–935. 2011. View Article : Google Scholar : PubMed/NCBI

4 

Wu EQ, Yu XH, Zha X, Zhang GN, Wang JH, Fan Y, Tang YY, Zhao ZX, Wu YG and Kong W: Distribution of human papillomavirus genotypes in archival cervical lesions in eastern inner Mongolian autonomous region. China Int J Gynecol Cancer. 19:919–923. 2009. View Article : Google Scholar : PubMed/NCBI

5 

Youssef MA, Abdelsalam L, Harfoush RA, Talaat IM, Elkattan E, Mohey A, Abdella RM, Farhan MS, Foad HA, Elsayed AM, et al: Prevalence of human papilloma virus (HPV) and its genotypes in cervical specimens of Egyptian women by linear array HPV genotyping test. Infect Agent Cancer. 11:1750–9378. 2016. View Article : Google Scholar

6 

Téguété I, Dolo A, Sangare K, Sissoko A, Rochas M, Beseme S, Tounkara K, Yekta S, De Groot AS and Koita OA: Prevalence of HPV 16 and 18 and attitudes toward HPV vaccination trials in patients with cervical cancer in Mali. PLoS One. 12:e01726612017. View Article : Google Scholar : PubMed/NCBI

7 

Siddiqa A, Zainab M, Qadri I, Bhatti MF and Parish JL: Prevalence and genotyping of high risk human papillomavirus in cervical cancer samples from Punjab, Pakistan. Viruses. 6:2762–2777. 2014. View Article : Google Scholar : PubMed/NCBI

8 

Suthipintawong C, Siriaunkgul S, Tungsinmunkong K, Pientong C, Ekalaksananan T, Karalak A, Kleebkaow P, Vinyuvat S, Triratanachat S, Khunamornpong S and Chongsuwanich T: Human papilloma virus prevalence, genotype distribution, and pattern of infection in Thai women. Asian Pac J Cancer Prev. 12:853–856. 2011.PubMed/NCBI

9 

Chaturvedi AK, Katki HA, Hildesheim A, Rodríguez AC, Quint W, Schiffman M, Van Doorn LJ, Porras C, Wacholder S, Gonzalez P, et al: Human papillomavirus infection with multiple types: Pattern of coinfection and risk of cervical disease. J Infect Dis. 203:910–920. 2011. View Article : Google Scholar : PubMed/NCBI

10 

Trottier H, Mahmud S, Costa MC, Sobrinho JP, Duarte- Franco E, Rohan TE, Ferenczy A, Villa LL and Franco EL: Human papillomavirus infections with multiple types and risk of cervical neoplasia. Cancer Epidemiol Biomark Prev. 15:1274–1280. 2006. View Article : Google Scholar

11 

Salazar KL, Zhou HS, Xu J, Peterson LE, Schwartz MR, Mody DR and Ge Y: Multiple human papilloma virus infections and their impact on the development of high-risk cervical lesions. Acta Cytol. 59:391–398. 2015. View Article : Google Scholar : PubMed/NCBI

12 

Pett M and Coleman N: Integration of high-risk human papillomavirus: A key event in cervical carcinogenesis? J Pathol. 212:356–367. 2007. View Article : Google Scholar : PubMed/NCBI

13 

Cricca M, Morselli-Labate AM, Venturoli S, Ambretti S, Gentilomi GA, Gallinella G, Costa S, Musiani M and Zerbini M: Viral DNA load, physical status and E2/E6 ratio as markers to grade HPV16 positive women for high-grade cervical lesions. Gynecol Oncol. 106:549–557. 2007. View Article : Google Scholar : PubMed/NCBI

14 

Wu EQ, Zha X, Yu XH, Zhang GN, Wu YG, Fan Y, Ren Y, Kong LQ and Kong W: Profile of physical status and gene variation of human papillomavirus 58 genome in cervical cancer. J Gen Virol. 90:1229–1237. 2009. View Article : Google Scholar : PubMed/NCBI

15 

Qureshi MN, Bolick D, Ringer PJ, Spagler FL and Zimmerman G: HPV testing in liquid cytology specimens: Comparison of analytic sensitivty and specificity for in situ hybridization and chemiluminescent nucleic acid testing. Acta Cytol. 49:120–126. 2005. View Article : Google Scholar : PubMed/NCBI

16 

Fujii T, Masumoto N, Saito M, Hirao N, Niimi S, Mukai M, Ono A, Hayashi S, Kubushiro K, Sakai E, et al: Comparison between in situ hybridization and real-time PCR technique as a means of detecting the integrated form of human papillomavirus 16 in cervical neoplasia. Diagn Mol Pathol. 14:103–108. 2005. View Article : Google Scholar : PubMed/NCBI

17 

Chaiwongkot A, Pientong C, Ekalaksananan T, Vinokurova S, Kongyingyoes B, Chumworathayi B, Patarapadungkit N, Siriaunkgul S and von Knebel Doeberitz M: Detection of the human papillomavirus 58 physical state using the amplification of papillomavirus oncogene transcripts assay. J Virol Methods. 189:290–298. 2013. View Article : Google Scholar : PubMed/NCBI

18 

Wanram S, Limpaiboon T, Leelayuwat C, Yuenyao P, Guiney DG, Lulitanond V, Lulitanond V and Jearanaikoon P: The use of viral load as a surrogate marker in predicting disease progression for patients with early invasive cervical cancer with integrated human papillomavirus type 16. Am J Obstet Gynecol. 201:79.e1–e7. 2009. View Article : Google Scholar

19 

Sotlar K, Diemer D, Dethleffs A, Hack Y, Stubner A, Vollmer N, Menton S, Menton M, Dietz K, Wallwiener D, et al: Detection and typing of human papillomavirus by E6 nested multiplex PCR. J Clin Microbiol. 42:3176–3184. 2004. View Article : Google Scholar : PubMed/NCBI

20 

Peitsaro P, Johansson B and Syrjanen S: Integrated human papillomavirus type 16 is frequently found in cervical cancer precursors as demonstrated by a novel quantitative real-time PCR technique. J Clin Microbiol. 40:886–891. 2002. View Article : Google Scholar : PubMed/NCBI

21 

Damay A, Didelot-Rousseau MN, Costes V, Konate I, Ouedraogo A, Nagot N, Foulongne V, Van de Perre P, Mayaud P and Segondy M: Viral load and physical status of human papillomavirus (HPV) 18 in cervical samples from female sex workers infected with HPV 18 in Burkina Faso. J Med Virol. 81:1786–1791. 2009. View Article : Google Scholar : PubMed/NCBI

22 

Bustin SA, Benes V, Garson JA, Hellemans J, Huggett J, Kubista M, Mueller R, Nolan T, Pfaffl MW, Shipley GL, et al: The MIQE guidelines: Minimum information for publication of quantitative real-time PCR experiments. Clin Chem. 55:611–622. 2009. View Article : Google Scholar : PubMed/NCBI

23 

Broeders S, Huber I, Grohmann L, Berben G, Taverniers I, Mazzara M, Roosens N and Morisset D: Guidelines for validation of qualitative real-time PCR methods. Trends Food Sci Technol. 37:115–126. 2014. View Article : Google Scholar

24 

Munagala R, Donà MG, Rai SN, Jenson AB, Bala N, Ghim SJ and Gupta RC: Significance of multiple HPV infection in cervical cancer patients and its impact on treatment response. Int J Oncol. 34:263–271. 2009.PubMed/NCBI

25 

Zhao Y, Cao X, Tang J, Zhou L, Gao Y, Wang J, Zheng Y, Yin S and Wang Y: A novel multiplex real-time PCR assay for the detection and quantification of HPV16/18 and HSV1/2 in cervical cancer screening. Mol Cell Probes. 26:66–72. 2012. View Article : Google Scholar : PubMed/NCBI

26 

Bruni L, Barrionuevo-Rosas L, Albero G, Serrano B, Mena M, Gómez D, Muñoz J, Bosch FX and de Sanjosé S: ICO Information Centre on HPV and Cancer (HPV information centre). Human papillomavirus and related diseases in Thailand. Summary Report. 27–July;2017.

Related Articles

Journal Cover

December-2018
Volume 16 Issue 6

Print ISSN: 1792-1074
Online ISSN:1792-1082

Sign up for eToc alerts

Recommend to Library

Copy and paste a formatted citation
x
Spandidos Publications style
Prasongdee P, Tippayawat P, Limpaiboon T, Leelayuwat C, Wongwattanakul M and Jearanaikoon P: The development of simultaneous measurement of viral load and physical status for human papillomavirus 16 and 18 co‑infection using multiplex quantitative polymerase chain reaction. Oncol Lett 16: 6977-6987, 2018.
APA
Prasongdee, P., Tippayawat, P., Limpaiboon, T., Leelayuwat, C., Wongwattanakul, M., & Jearanaikoon, P. (2018). The development of simultaneous measurement of viral load and physical status for human papillomavirus 16 and 18 co‑infection using multiplex quantitative polymerase chain reaction. Oncology Letters, 16, 6977-6987. https://doi.org/10.3892/ol.2018.9549
MLA
Prasongdee, P., Tippayawat, P., Limpaiboon, T., Leelayuwat, C., Wongwattanakul, M., Jearanaikoon, P."The development of simultaneous measurement of viral load and physical status for human papillomavirus 16 and 18 co‑infection using multiplex quantitative polymerase chain reaction". Oncology Letters 16.6 (2018): 6977-6987.
Chicago
Prasongdee, P., Tippayawat, P., Limpaiboon, T., Leelayuwat, C., Wongwattanakul, M., Jearanaikoon, P."The development of simultaneous measurement of viral load and physical status for human papillomavirus 16 and 18 co‑infection using multiplex quantitative polymerase chain reaction". Oncology Letters 16, no. 6 (2018): 6977-6987. https://doi.org/10.3892/ol.2018.9549