Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Oncology Letters
Join Editorial Board Propose a Special Issue
Print ISSN: 1792-1074 Online ISSN: 1792-1082
Journal Cover
January-2019 Volume 17 Issue 1

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
January-2019 Volume 17 Issue 1

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article Open Access

MicroRNA‑183 and microRNA‑141 are potential risk factors for poor prognosis in patients with nasopharyngeal carcinoma

  • Authors:
    • Junsheng Lian
    • Yujie Li
    • Min Yu
  • View Affiliations / Copyright

    Affiliations: Department of Otolaryngology Head and Neck Surgery, Zhengzhou Central Hospital Affiliated to Zhengzhou University, Zhengzhou, Henan 450007, P.R. China
    Copyright: © Lian et al. This is an open access article distributed under the terms of Creative Commons Attribution License.
  • Pages: 1172-1176
    |
    Published online on: November 1, 2018
       https://doi.org/10.3892/ol.2018.9650
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

This study investigated whether microRNA‑183 and microRNA‑141 in nasopharyngeal carcinoma (NPC) lesions are potential risk factors for poor prognosis. A total of 317 NPC patients admitted to Zhengzhou Central Hospital Affiliated to Zhengzhou University from January 2010 to March 2015 were included. Reverse transcription‑quantitative PCR (RT‑qPCR) was used to detect the expression of microRNA‑183 and microRNA‑141 in lesions and adjacent tissues, and the relationship between the microRNA‑183 and microRNA‑141 expression levels and prognosis was analyzed. The expression levels of microRNA‑183 and microRNA‑141 in lesions were significantly higher than those in adjacent tissues (p<0.05). Patients with distant metastasis had significantly higher expression levels of microRNA‑183 and microRNA‑141 than patients without distant metastasis (p<0.01). Patients with disease‑free survival (DFS) <3 years showed significantly higher expression levels of microRNA‑183 and microRNA‑141 than those with DFS ≥3 years (p<0.01). NPC patients with high expression levels of microRNA‑183 and microRNA‑141 showed poor prognosis. MicroRNA‑183 and microRNA‑141 may play an important role in the distant metastasis of NPC, and have a great impact on prognosis.

Introduction

Incidence of nasopharyngeal carcinoma (NPC) in southern China is high and NPC is a common head and neck malignancy (1). The etiology of the disease varies, and EB virus infection, genetic and environmental factors all contribute to its occurrence (2). Incidence rate of NPC has reached 10/300,000 (3). More than half of the patients are in advanced stages at the time of diagnosis, and ~1/3 of patients have a survival period of <5 years (4). NPC has the characteristics of rapid growth, high degree of malignancy, and is prone to early metastasis. Distant metastasis is the main cause of death after radiotherapy, and ~60–70% of patients are diagnosed with distant metastases (5). Tumor metastasis is the detachment of the tumor cells from their primary site to traffic through blood vessels or lymphatic vessels, reach distant positions and form tumors of the same nature. In this process, low level of E-cadherin reduces intercellular adhesion, induces epithelial-mesenchymal transition, and promotes invasion and metastasis of tumor cells (6).

MicroRNA is a group of short single-stranded RNAs identified in eukaryotic cells with pivotal roles in the regulation of post-transcriptional gene processing (7). Increasing number of studies have shown that microRNA plays an important role in regulating tumor invasion and metastasis (8). Studies have also shown that microRNA-141 is upregulated in endometrial and colorectal cancers, and the higher the expression, the worse the prognosis is (9,10). In addition, some studies have suggested that microRNA-141 is highly expressed in NPC, but some other studies have reported that microRNA-141 expression is not observed in NPC and adjacent normal tissues (11). At present, the functional role of microRNA-183 and microRNA-141 in NPC is still controversial. This study explored the influence of microRNA-183 and microRNA-141 on prognosis of patients with NPC with an expectation of providing guidance for the diagnosis, treatment and prognosis of NPC and other tumors.

Materials and methods

General information

A total of 317 NPC patients admitted to Zhengzhou Central Hospital Affiliated to Zhengzhou University (Zhengzhou, China) between January 2010 and March 2016 were selected for this research. Patients included 238 males and 79 females. All patients underwent routine nasopharynx and neck MRI, chest CT, abdominal CT, and bone scans to determine the recurrence and distant metastases. Inclusion criteria: i) age ≥18 years, ≤65 years; ⅱ) patients who had received no radiotherapy or chemotherapy prior to treatment; ⅲ) there were no other malignant tumors or other diseases severely affecting survival; and ⅳ) there were no immediate relatives among the patients. Precautionary and lactating women were excluded. All patients or their relatives signed an informed consent. The study was approved by the Ethics Committee of Zhengzhou Central Hospital Affiliated to Zhengzhou University.

Main reagents and instruments

TRIzol RNA extraction kit and miRNA first-strand cDNA synthesis kit (both from Sangon Biotech Co., Ltd., Shanghai, China); SYBR® PrimeScript™ miRNA RT-PCR kit (Takara Bio, Inc., Otsu, Japan); NanoDrop 2000 (Thermo Fisher Scientific, Inc., Waltham, MA, USA); CFX96 fluorescence quantitative PCR instrument (Bio-Rad Laboratories, Inc., Hercules, CA, USA).

Specimen collection and RNA extraction

NPC tumor and adjacent healthy tissues were collected from NPC patients and were stored in a refrigerator at −80°C. Total RNA was extracted from the tissues by using TRIzol RNA extraction kit. The specific extraction steps were as follows: TRIzol was added to lysate cells, followed by centrifugation at 4°C (12,300 × g) for 10 min; supernatant was transferred to a new RNase-free tube, and equal volume of chloroform was added, followed by centrifugation at 4°C (12,300 × g) for 10 min; supernatant was transferred to a new RNase-free tube, and equal volume of isopropanol was added and kept at room temperature for 1 h, followed by centrifugation at 4°C (12,300 × g) for 10 min; supernatant was discarded, and the pellet was washed twice with 75% ethanol; after air dry, DEPC water was added. NanoDrop 2000 was used to test RNA quality and concentration. RNA with a A260/280 ratio >1.8 was subjected to 1.5% agarose gel electrophoresis to check RNA integrity.

First-strand cDNA synthesis

First-strand cDNA was synthesized according to the instructions of cDNA first strand synthesis kit. The reaction system consisted of 1 µl of 2.5 U/µl poly(A) polymerase, 1 µl of RTase Mix, 5 µl of 5X PAP/RT buffer, 2 µg of total RNA, and RNase free dH2O was added to reach a final volume of 25 µl. Reaction conditions: 37°C for 1 h and 85°C for 5 min.

Detection of microRNA-183 and microRNA-141 expression in lesion and adjacent tissues of patients by reverse transcription-quantitative PCR (RT-qPCR)

Synthesized cDNA was used as template and U6 as an endogenous control. MicroRNA-183 and microRNA-141 expression levels were detected by RT-qPCR. Reaction system: 10 µl of SYBR-Green Master Mix, 0.5 µl of upstream and downstream primers, 1 µl of cDNA, and ddH2O was added to reach a final volume of 20 µl. MicroRNA-141-F and microRNA-183-F were used as upstream primers, and Uni-miR qPCR Primer in SYBR® PrimeScript™ miRNA RT-PCR kit was used as downstream primer (Table I). The RT-qPCR reaction conditions were: 95°C for 3 min, followed by 40 cycles of 95°C for 30 sec and 58°C for 1 min. Data were processed using 2−ΔΔCq method (12).

Table I.

Primer sequences.

Table I.

Primer sequences.

Primers (5′-3′)Sequences
Uni-miR qPCR primerTakara kit
MicroRNA-141-F CGTAACACTGTCTGGTAAAGATGGA
MicroRNA-183-F ACACTCCAGCTGGGTATGGCACTGGTAGAATT
U6-F CTCGCTTCGGCAGCACA
U6-R AACGCTTCACGAATTTGCGT
Statistical analysis

SPSS 17.0 (Beijing Xinmei Jiahong Technology Co., Ltd., Beijing, China) was used for statistical analysis. Measurement data were expressed as mean ± SD, and t-test was used for the comparison between two groups. Chi-square test was used for comparison of enumeration data. Kaplan-Meier test was used for the survival analysis followed by a long-rank test. P<0.05 was considered to indicate a statistically significant difference.

Results

General clinical data

A total of 317 NPC patients admitted to Zhengzhou Central Hospital Affiliated to Zhengzhou University from January 2010 to March 2015 were included. The patients were 238 males and 79 females, aging from 18 to 65 years, with a median age of 45 years. A total of 157 cases presented distant metastasis, 136 cases had no distant metastasis, and distant metastasis was unclear in 24 cases. In addition, 172 patients had a disease-free survival (DFS) ≥3 years, and 145 patients had DFS <3 years. Tumors were confined to the nasopharyngeal area or had infiltrated the pharyngeal soft tissue in 56 cases. Lymph node metastasis occurred in 308 patients (Table II). The 1-, 2-, and 3-year survival rates of the 317 patients were 82.6% (262), 64.4% (204), and 54.3% (172), respectively.

Table II.

General clinical data of 317 NPC patients.

Table II.

General clinical data of 317 NPC patients.

Variablen (%)
Age (years)
  ≥45156 (49.2)
  <45161 (50.8)
Sex
  Male238 (75.1)
  Female79 (24.9)
Distant metastasis
  Unclear24 (7.6)
  Non-distant metastasis136 (42.9)
  Distant metastasis157 (49.5)
DFS (years)
  ≥3172 (54.3)
  <3145 (45.7)
T period
  T113 (4.1)
  T243 (13.6)
  T3166 (52.4)
  T495 (30.0)
N stages
  N09 (2.8)
  N191 (28.7)
  N2168 (53.0)
  N349 (15.5)

[i] NPC, nasopharyngeal carcinoma; DFS, disease-free survival.

Analysis of the expression levels of microRNA-183 and microRNA-141

The expression of microRNA-183 and microRNA-141 was detected by RT-qPCR. The results showed that the expression levels of microRNA-183 and microRNA-141 in lesion tissues were significantly higher than those in adjacent tissues (p<0.05, Table III). Patients with distant metastases had significantly higher expression levels of microRNA-183 and microRNA-141 (3.85±0.23 and 3.95±0.13) than patients without distant metastasis (1.35±0.15 and 1.52±0.11; p<0.01, Fig. 1). Patients with DFS <3 years showed significantly higher levels of microRNA-183 and microRNA-141 (3.73±0.18 and 3.50±0.08) than patients with DFS ≥3 years (1.51±0.10 and 1.18±0.05; p<0.01, Fig. 2).

Figure 1.

Expression of microRNA-183 and microRNA-141 in patients with and without distant metastasis. The expression of microRNA-183 and microRNA-141 was detected by RT-qPCR. The results showed that the expression levels of microRNA-183 and microRNA-141 were significantly higher in patients with distant metastasis (group 1) than in patients without distant metastasis (group 2). *P<0.01. RT-qPCR, reverse transcription-quantitative PCR.

Figure 2.

Expression of microRNA-183 and microRNA-141 in patients with different DFSs. The expression of microRNA-183 and microRNA-141 was detected by RT-qPCR. The results showed that the expression levels of microRNA-183 and microRNA-141 in patients with DFS <3 years (group A) were significantly higher than those in patients with DFS ≥3 years (group B). *P<0.01. DFS, disease-free survival; RT-qPCR, reverse transcription-quantitative PCR.

Table III.

Expression of microRNA-183 and microRNA-141 in lesions and adjacent tissues (mean ± SD).

Table III.

Expression of microRNA-183 and microRNA-141 in lesions and adjacent tissues (mean ± SD).

GroupsLesionsAdjacent tissuestP-value
microRNA-1833.11±0.091.21±0.104.7710.041
microRNA-1412.98±0.121.13±0.088.2150.014
Relationship between microRNA-183 and microRNA-141 and prognosis

The relative expression levels of microRNA-183 and microRNA-141 in the lesion tissue of NPC patients were 2.78±0.35 and 2.52±0.43, respectively. With the average value as threshold, patients were divided into high and low expression groups. There were 163 cases with high expression of microRNA-183, 154 cases with low expression of microRNA-183, 161 cases with high expression of microRNA-141, and 156 cases with low expression of microRNA-141. After 3 years of follow-up for these patients, 163 patients with high microRNA-183 expression had recurrence and the total number of deaths was 124 (76.1%), and 154 patients with low microRNA-183 expression had recurrence and the total number of deaths was 21 (13.6%). A total of 161 patients with high expression of microRNA-141 had recurrence and the total number of deaths was 128 (79.5%), and 156 patients with low expression of microRNA-141 had recurrence and the total number of deaths was 17 (10.9%). The recurrence and mortality rates of high and low expression groups of microRNA-183 and microRNA-141 were significantly different from each other (χ2 was 124.382 and 150.257, respectively; p<0.01), suggesting that the high expression of microRNA-183 and microRNA-141 was associated with poor prognosis (Figs. 3 and 4).

Figure 3.

Survival curves of patients with high and low microRNA-183 expression. Group A is the microRNA-183 high expression group (163 cases), and group B is the microRNA-183 low expression group (154 cases). The survival rate of group B was significantly higher than that of group A (P<0.01).

Figure 4.

Survival curves of patients with high and low microRNA-141 expression. Group A is the high microRNA-141 expression group (161 cases) and group B is the microRNA-141 low expression group (156 cases). The survival rate of group B was significantly higher than that of group A (P<0.01).

Discussion

The occurrence and development process of NPC is complex, and distant metastasis is an important cause of death in NPC patients (13). Therefore, it is particularly important to explore the relevant molecular mechanisms of NPC distant metastasis.

MicroRNA plays an important role in the invasion of tumor cells. Recent studies have found that microRNA exerts the dual role of oncogenes and tumor suppressor gene in the development of tumors (14).

MicroRNA-183 can inhibit metastasis of cancer cells by inhibiting ezrin protein in lung (15) and breast cancer (16). In addition, it can also inhibit migration of lung cancer cells by downregulating WISP2 protein or upregulating the expression of S100P protein (17). MicroRNA-183 inhibits the expression of cell death factor 4 (PDCD4) in liver cancer and inhibits cell apoptosis (18). MicroRNA-183 inhibits the metastasis of colon cancer cells by inhibiting the expression of EGR1 and PTEN (19). In addition, the role of microRNA-183 in tumors is tissue-specific. MicroRNA-183 can play a tumor suppressive role and can also promote tumor invasion and migration in different cancer cells (20). In this study it was found that the expression level of microRNA-183 in patients with distant metastasis is significantly higher than that in patients without distant metastasis (p<0.01), suggesting that the expression level of microRNA-183 can be used to predict distant metastasis in NPC patients. When distant metastasis occurs, the expression of microRNA-183 increases, and microRNA-183 plays an important role in promoting the metastasis of tumor cells in NPC. Sarver et al (21) have found that the upregulation of microRNA-183 in colon cancer plays an important role in promoting the development of cancer. In the present study, it was found that the expression level of microRNA-183 in patients with DFS <3 years is significantly higher than that in patients with DFS ≥3 years (p<0.01), suggesting that microRNA-183 expression level is related to postoperative survival. At the end of the follow-up, recurrence and mortality were significantly higher in the microRNA-183 high expression group than in the low expression group, suggesting that high microRNA-183 expression is closely related to poor prognosis.

MicroRNA-141 is a member of microRNA-200 family. Xia et al (22) have found that the expression level of microRNA-141 in NPC cell lines with low differentiation is higher than that in highly differentiated NPC cell lines. It was considered that the increase of microRNA-141 expression attributes to NPC occurrence at early stage. In addition, microRNA-141 expression pattern is extremely different in different tumor cells, such as high expression in ovarian cancer (23), and low expression in hepatoma cells (24). In this study, the expression level of microRNA-141 was significantly higher in patients with distant metastasis than in patients without distant metastasis (p<0.01). Ahmed et al (25) have found that the appearance of lymph node and distant metastasis is accompanied by the increased expression level of microRNA-141, which is consistent with the findings in this study. The expression level of microRNA-141 in patients with DFS <3 years was significantly higher than that in patients with DFS ≥3 years (p<0.01). Furthermore, recurrence and mortality of patients with high expression of microRNA-141 were also significantly higher than those of patients with low expression, suggesting that increased expression of microRNA-141 predicts distant metastasis and shortened DFS, and leads to poor prognosis.

In conclusion, microRNA-183 and microRNA-141 can be used as markers for the prediction of distant metastasis of NPC, and have a reference value for the prognosis of NPC. The specific molecular mechanism of microRNA-183 and microRNA-141 in the occurrence and development of NPC remains to be further studied.

Acknowledgements

Not applicable.

Funding

No funding was received.

Availability of data and materials

The datasets used and/or analyzed during the present study are available from the corresponding author on reasonable request.

Authors' contributions

JL wrote the manuscript. JL and MY were responsible for cDNA synthesis. JL and YL performed PCR. All authors read and approved the final manuscript.

Ethics approval and consent to participate

The study was approved by the Ethics Committee of Zhengzhou Central Hospital Affiliated to Zhengzhou University (Zhengzhou, China). Signed informed consents were obtained from the patients or the guardians.

Patient consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

References

1 

Chan KC, Hung EC, Woo JK, Chan PK, Leung SF, Lai FP, Cheng AS, Yeung SW, Chan YW, Tsui TK, et al: Early detection of nasopharyngeal carcinoma by plasma Epstein-Barr virus DNA analysis in a surveillance program. Cancer. 119:1838–1844. 2013. View Article : Google Scholar : PubMed/NCBI

2 

Marsh GM, Youk AO and Morfeld P: Mis-specified and non-robust mortality risk models for nasopharyngeal cancer in the National Cancer Institute formaldehyde worker cohort study. Regul Toxicol Pharmacol. 47:59–67. 2007. View Article : Google Scholar : PubMed/NCBI

3 

Zhang B and Tang PZ: Introduction to ‘NCCN clinical practice guidelines in head and neck cancer (2009 Chinese version)’. Zhonghua Er Bi Yan Hou Tou Jing Wai Ke Za Zhi. 44:707–709. 2009.(In Chinese). PubMed/NCBI

4 

Lee N, Harris J, Garden AS, Straube W, Glisson B, Xia P, Bosch W, Morrison WH, Quivey J, Thorstad W, et al: Intensity-modulated radiation therapy with or without chemotherapy for nasopharyngeal carcinoma: Radiation therapy oncology group phase II trial 0225. J Clin Oncol. 27:3684–3690. 2009. View Article : Google Scholar : PubMed/NCBI

5 

Chen J, Zong J, Wu J and Pan J: Prognostic analysis of nasopharyngeal carcinoma patients with distant metastasis after curative radiotherapy. Zhonghua Zhong Liu Za Zhi. 37:216–221. 2015.(In Chinese). PubMed/NCBI

6 

Lin Y, Ukaji T, Koide N and Umezawa K: Inhibition of late and early phases of cancer metastasis by the NF-κB inhibitor DHMEQ derived from microbial bioactive metabolite epoxyquinomicin: A review. Int J Mol Sci. 19:192018. View Article : Google Scholar

7 

Engels BM and Hutvagner G: Principles and effects of microRNA-mediated post-transcriptional gene regulation. Oncogene. 25:6163–6169. 2006. View Article : Google Scholar : PubMed/NCBI

8 

Ma L, Teruya-Feldstein J and Weinberg RA: Tumour invasion and metastasis initiated by microRNA-10b in breast cancer. Nature. 449:682–688. 2007. View Article : Google Scholar : PubMed/NCBI

9 

Snowdon J, Zhang X, Childs T, Tron VA and Feilotter H: The microRNA-200 family is upregulated in endometrial carcinoma. PLoS One. 6:e228282011. View Article : Google Scholar : PubMed/NCBI

10 

Cheng H, Zhang L, Cogdell DE, Zheng H, Schetter AJ, Nykter M, Harris CC, Chen K, Hamilton SR and Zhang W: Circulating plasma MiR-141 is a novel biomarker for metastatic colon cancer and predicts poor prognosis. PLoS One. 6:e177452011. View Article : Google Scholar : PubMed/NCBI

11 

Xie YJ, Long ZF and He XS: Involvement of EBV-encoded BART-miRNAs and dysregulated cellular miRNAs in nasopharyngeal carcinoma genesis. Asian Pac J Cancer Prev. 14:5637–5644. 2013. View Article : Google Scholar : PubMed/NCBI

12 

Livak KJ and Schmittgen TD: Analysis of relative gene expression data using realtime quantitative PCR and the 2(-Delta Delta C(T)) method. Methods. 25:402–408. 2001. View Article : Google Scholar : PubMed/NCBI

13 

Ouyang L, Shi Z, Zhao S, Wang FT, Zhou TT, Liu B and Bao JK: Programmed cell death pathways in cancer: A review of apoptosis, autophagy and programmed necrosis. Cell Prolif. 45:487–498. 2012. View Article : Google Scholar : PubMed/NCBI

14 

Xiao Z, Ching Chow S, Han Li C, Chun Tang S, Tsui SK, Lin Z and Chen Y: Role of microRNA-95 in the anticancer activity of Brucein D in hepatocellular carcinoma. Eur J Pharmacol. 728:141–150. 2014. View Article : Google Scholar : PubMed/NCBI

15 

Wang G, Mao W and Zheng S: MicroRNA-183 regulates Ezrin expression in lung cancer cells. FEBS Lett. 582:3663–3668. 2008. View Article : Google Scholar : PubMed/NCBI

16 

Tang R, Li FX, Shao WF, Wen QS, Yu XR and Xiong JB: Protein-protein interaction between ezrin and p65 in human breast cancer cells. Genet Mol Res. 15:152016. View Article : Google Scholar

17 

Li G, Luna C, Qiu J, Epstein DL and Gonzalez P: Targeting of integrin beta1 and kinesin 2alpha by microRNA 183. J Biol Chem. 285:5461–5471. 2010. View Article : Google Scholar : PubMed/NCBI

18 

Li J, Fu H, Xu C, Tie Y, Xing R, Zhu J, Qin Y, Sun Z and Zheng X: miR-183 inhibits TGF-beta1-induced apoptosis by downregulation of PDCD4 expression in human hepatocellular carcinoma cells. BMC Cancer. 10:3542010. View Article : Google Scholar : PubMed/NCBI

19 

Kim J, Kang HS, Lee YJ, Lee HJ, Yun J, Shin JH, Lee CW, Kwon BM and Hong SH: EGR1-dependent PTEN upregulation by 2-benzoyloxycinnamaldehyde attenuates cell invasion and EMT in colon cancer. Cancer Lett. 349:35–44. 2014. View Article : Google Scholar : PubMed/NCBI

20 

Meng F, Li Z, Yan J, Manjanatha M, Shelton S, Yarborough S and Chen T: Tissue-specific microRNA responses in rats treated with mutagenic and carcinogenic doses of aristolochic acid. Mutagenesis. 29:357–365. 2014. View Article : Google Scholar : PubMed/NCBI

21 

Sarver AL, Li L and Subramanian S: MicroRNA miR-183 functions as an oncogene by targeting the transcription factor EGR1 and promoting tumor cell migration. Cancer Res. 70:9570–9580. 2010. View Article : Google Scholar : PubMed/NCBI

22 

Xia H, Ng SS, Jiang S, Cheung WK, Sze J, Bian XW, Kung HF and Lin MC: miR-200a-mediated downregulation of ZEB2 and CTNNB1 differentially inhibits nasopharyngeal carcinoma cell growth, migration and invasion. Biochem Biophys Res Commun. 391:535–541. 2010. View Article : Google Scholar : PubMed/NCBI

23 

van Jaarsveld MT, Helleman J, Boersma AW, van Kuijk PF, van Ijcken WF, Despierre E, Vergote I, Mathijssen RH, Berns EM, Verweij J, et al: miR-141 regulates KEAP1 and modulates cisplatin sensitivity in ovarian cancer cells. Oncogene. 32:4284–4293. 2013. View Article : Google Scholar : PubMed/NCBI

24 

Xue J, Niu YF, Huang J, Peng G, Wang LX, Yang YH and Li YQ: miR-141 suppresses the growth and metastasis of HCC cells by targeting E2F3. Tumour Biol. 35:12103–12107. 2014. View Article : Google Scholar : PubMed/NCBI

25 

Ahmed FE, Amed NC, Vos PW, Bonnerup C, Atkins JN, Casey M, Nuovo GJ, Naziri W, Wiley JE and Allison RR: Diagnostic microRNA markers to screen for sporadic human colon cancer in blood. Cancer Genomics Proteomics. 9:179–192. 2012.PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Lian J, Li Y and Yu M: MicroRNA‑183 and microRNA‑141 are potential risk factors for poor prognosis in patients with nasopharyngeal carcinoma. Oncol Lett 17: 1172-1176, 2019.
APA
Lian, J., Li, Y., & Yu, M. (2019). MicroRNA‑183 and microRNA‑141 are potential risk factors for poor prognosis in patients with nasopharyngeal carcinoma. Oncology Letters, 17, 1172-1176. https://doi.org/10.3892/ol.2018.9650
MLA
Lian, J., Li, Y., Yu, M."MicroRNA‑183 and microRNA‑141 are potential risk factors for poor prognosis in patients with nasopharyngeal carcinoma". Oncology Letters 17.1 (2019): 1172-1176.
Chicago
Lian, J., Li, Y., Yu, M."MicroRNA‑183 and microRNA‑141 are potential risk factors for poor prognosis in patients with nasopharyngeal carcinoma". Oncology Letters 17, no. 1 (2019): 1172-1176. https://doi.org/10.3892/ol.2018.9650
Copy and paste a formatted citation
x
Spandidos Publications style
Lian J, Li Y and Yu M: MicroRNA‑183 and microRNA‑141 are potential risk factors for poor prognosis in patients with nasopharyngeal carcinoma. Oncol Lett 17: 1172-1176, 2019.
APA
Lian, J., Li, Y., & Yu, M. (2019). MicroRNA‑183 and microRNA‑141 are potential risk factors for poor prognosis in patients with nasopharyngeal carcinoma. Oncology Letters, 17, 1172-1176. https://doi.org/10.3892/ol.2018.9650
MLA
Lian, J., Li, Y., Yu, M."MicroRNA‑183 and microRNA‑141 are potential risk factors for poor prognosis in patients with nasopharyngeal carcinoma". Oncology Letters 17.1 (2019): 1172-1176.
Chicago
Lian, J., Li, Y., Yu, M."MicroRNA‑183 and microRNA‑141 are potential risk factors for poor prognosis in patients with nasopharyngeal carcinoma". Oncology Letters 17, no. 1 (2019): 1172-1176. https://doi.org/10.3892/ol.2018.9650
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team