International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.
International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.
Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.
Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.
Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.
Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.
Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.
International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.
Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.
Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.
Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.
An International Open Access Journal Devoted to General Medicine.
Lung cancer is one of the most lethal diseases worldwide, and is responsible for ~1.2 million cases of mortality each year (1). According to the pathological type, lung cancer can be divided into small cell lung cancer and non-small cell lung cancer (NSCLC). NSCLC accounts for 85% of all lung cancer cases. Squamous cell carcinoma represents ~30% of small cell lung cancer cases, and non-squamous cell carcinoma accounts for ~70%. NSCLC is the leading cause of tumor-associated mortality in the United States and Europe. The majority of patients (~60%) are diagnosed with locally advanced or metastatic NSCLC, and the 5-year survival rate is only ~5%. Vascular endothelial growth factor (VEGF) (2) and epidermal growth factor receptor (3) are currently the main therapeutic targets in NSCLC. However, >40% of patients with NSCLC develop tumor recurrence, even when they have received early treatment (4). Therefore, the specific mechanisms of NSCLC development, and novel therapeutic targets, require further investigation.
Apoptosis is a type of gene-encoded spontaneous cell death that occurs during cell growth, differentiation, development and pathology. It is also known as programmed cell death (5). Normal epithelial or endothelial cells are adhesive-dependent, and their survival depends on cell-cell and cell-matrix signaling (6). However, tumor cells can survive without adhesion, which is named anchorage independence (7). Anoikis is a specific form of programmed cell death induced by loss of contact between cells and extracellular matrices or other cells. Progress on the determination of anoikis-related genes has been made. It has been reported that the decrease of B-cell lymphoma-extra large (Bcl-XL) protein expression induces a significant increase in ovarian cancer cell anoikis; however, it has no effect on cells that are attached to other cells (8). Mutation or loss of heterozygosis of the phosphatase and tension homolog (PTEN) gene is closely associated with the occurrence and development of tumors, including glioblastoma and prostate cancer. It can also mediate the regulation of anoikis signaling (9). In addition, integrins serve a crucial role in anchorage independence as a central signaling pathway between cells and matrix (10).
Interleukin enhancer binding factor 2 (ILF2) is also known as nuclear factor 45. In the past few years, ILF2 has been extensively studied in tumors. For example, ILF2 is overexpressed in various types of malignancy, including glioma, NSCLC and esophageal cancer, and promotes their development (11–13). Therefore ILF2 upregulation may be necessary for cancer cell progression. In addition, recent studies reported that ILF2 expression is associated with tumor size in pancreatic ductal carcinoma (PDAC) (14,15). Furthermore, ILF2 can be a valuable prognostic indicator of PDAC survival (15). Lee et al (16) reported that ILF2 expression is high in liver cancer tissues by using immunohistochemistry and western blotting. However, the specific function of ILF2 and its mechanism underlying tumorigenesis require further investigation.
PTEN was the first tumor suppressor gene with phosphatase activity to be discovered (17). Numerous degrees of PTEN gene mutation or loss exist in various types of tumor tissues, cell lines and xenografts. PTEN is involved in many important intracellular pathways and serves therefore crucial roles in suppressing the occurrence and development of tumors. PTEN blocks the phosphoinositide 3-kinase (PI3K)/protein kinase B signaling pathway by decreasing phosphatidylinositol (3,4,5)-trisphosphate (PIP3) levels to promote apoptosis (18). PTEN is a diphosphatase, which activates PI3K to dephosphorylate PIP3. This reaction blocks PI3K-regulated growth factor signaling pathways and maintains cell growth during normal growth cycles (19). PTEN can also inhibit focal adhesion kinase phosphorylation to suppress cell migration (20). In addition, PTEN inhibits tumor angiogenesis through regulation of VEGF expression (21).
Although ILF2 has been previously reported in NSCLC, the present study aimed to examine the function of ILF2 in a completely novel way. The results from this study demonstrated that ILF2 was highly expressed in NSCLC cell lines and was associated with poor patient prognosis, according to an online database. In addition, ILF2 reduced cell-matrix adhesion and promoted anchorage independence. Further analyses revealed that ILF2 directly bound to the PTEN gene and regulated its expression. The results suggested that ILF2 may achieve these functions through PTEN regulation.
HUVEC-C, HBEC-5i, BEAS-2B, A549, H460, H1155 and H1299 cell lines were obtained from the American Type Culture Collection (Manassas, VA, USA). HUVEC-C is a human umbilical vein endothelium cell line. HBEC-5i is a human cerebral microvascular endothelium cell line. BEAS-2B is a human normal lung epithelial cell line. A549, H460, H1155 and H1299 are NSCLC cell lines. HUVEC-C cells were maintained in Kaighn's Modification of Ham's F-12 medium (Gibco; Thermo Fisher Scientific, Inc., Waltham, MA, USA) supplemented with 10% fetal bovine serum (FBS; Gibco; Thermo Fisher Scientific, Inc.), 0.1 mg/ml heparin (cat. no. H3393; Sigma-Aldrich; Merck KGaA, Darmstadt, Germany) and 40 µg/ml endothelial cell growth supplement (ECGS; cat. no. 354006; BD Biosciences, San Jose, CA, USA). HBEC-5i cells were maintained in Dulbecco's modified Eagle's medium/F12 (Gibco; Thermo Fisher Scientific, Inc.) supplemented with 10% FBS and 40 µg/ml ECGS. BEAS-2B, A549, H460, H1155 and H1299 cells were maintained in RPMI-1640 medium (Gibco; Thermo Fisher Scientific, Inc.) supplemented with 10% FBS. All cells were cultured at 37°C in a humidified incubator containing 5% CO2.
Cell culture dishes (diameter, 60-mm) were covered with fibronectin (500 µl, 10 µg/ml; Sigma-Aldrich; Merck KGaA) and incubated in a cell incubator overnight. HUVEC-C, HBEC-5i, A549 or H460 were transfected with control, shILF2, ILF2, shPTEN and PTEN. Dishes were washed twice with PBS (Thermo Fisher Scientific, Inc.), and 2×105 HUVEC-C, HBEC-5i, A549 or H460 cells in normal medium were seeded in each dish and incubated for 30 min at 37°C in a cell culture incubator. The media was discarded, and cells were washed twice with PBS. Crystal violet [0.05% (w/v)] was used to stain adhered cells for 10 min at room temperature, and plates were imaged by light microscopy (magnification, ×100). Finally, the number of cells that were stained were counted.
To examine the ability of anchorage independence, cells transfected with control, shILF2, ILF2, shPTEN and PTEN were seeded (~2×105) in low-attachment (Corning Inc., Corning, NY, USA) and normal surface 24-well plates at 37°C cell culture incubator. Cells that normally grow adherently cannot adhere to low-attachment (PolyHEMA-coated) 24-well plates. This can be used to simulate the detachment of cells from the matrix. According to the manufacturer's protocol, a Cell Death Detection ELISA PLUS kit (cat. no. 11774425001; Roche Diagnostics, Basel, Switzerland) was used to assess cell apoptosis. Apoptotic cells were measured using a microplate reader at 405 nm. The ELISA kit was used to detect the level of apoptosis. It determines the level of apoptosis by detecting the DNA-ladder produced by endogenous restriction endonuclease cleavage during apoptosis (22,23).
Total RNA was isolated from cells with TRIzol® reagent (Invitrogen; Thermo Fisher Scientific, Inc.) and reverse transcribed with oligo dT (Takara Biotechnology Co., Ltd., Dalian, China). The reverse transcription temperature protocol was 1 h at 42°C and 10 min at 72°C according to the manufacturer's protocol. RT-qPCR was performed with Ex Taq® polymerase (Takara Biotechnology Co., Ltd.), and the cycling conditions were as follows: Initial denaturation for 3 min at 95°C, followed by 31 cycles of 15 sec at 95°C, 15 sec at 55°C and 30 sec at 72°C, with a final extension for 7 min at 72°C. The sequences of the primers were designed as follows: ILF2 (gene ID: 3608), forward 5′-AGGCCCTTTGTACCACATATC-3′, reverse 5′-ATCCTGTGCTCTTAGGCTTTC-3′ (reverse); and GAPDH (gene ID: 2597), forward 5′-GATTCCACCCATGGCAAATTC-3′ and reverse 5′-GTCATGAGTCCTTCCACGATAC-3′. The 2−∆∆Cq method was used to normalize the expression to GAPDH (24).
For protein extraction, 2×106 cells were incubated in lysis buffer that was composed of 100 µl 50 mM Tris-HCl (pH 8.0) containing 1% NP-40, 150 mM NaCl, 100 µg/ml phenylmethylsulfonyl fluoride and 0.1% SDS. Lysis was performed on ice and lysates were subsequently denatured at 100°C for 10 min. A Pierce bicinchoninic acid protein assay kit (Invitrogen; Thermo Fisher Scientific, Inc.) was used to measure the protein concentration and 30-µg protein was loaded into each well. Proteins were separated by 10% SDS-PAGE and transferred to polyvinylidene fluoride membranes. The membranes were blocked in 3% (w/v) bovine serum albumin for 1 h at room temperature. The primary antibodies used were as follows: Rabbit polyclonal ILF2 (cat. no. ab154791; 1:5,000), the rabbit polyclonal PTEN (cat. no. ab31392; 1:1,000) and the mouse monoclonal GAPDH (cat. no. ab8245; 1:5,000; all from Abcam, Cambridge, UK), which were all dissolved in 5% bovine serum albumin (w/v). The primary antibodies were incubated with the membranes at 4°C overnight. The secondary antibodies used were the goat anti-rabbit immunoglobulin (Ig) G H&L (cat. no. ab6721; 1:1,000) and the goat anti-mouse IgG H&L (cat. no. ab6789; 1:1,000; all from Abcam), which were all dissolved in 3% bovine serum albumin (w/v). The secondary antibodies were incubated with the blots at room temperature for 2 h. Bands were visualized with using chemiluminescent horse radish peroxidase substrate (EMD Millipore, Billerica, MA, USA). X-ray films (Beijing Solarbio Science & Technology Co., Ltd., Beijing, China) and a GE Amersham Imager 600 (GE Healthcare, Chicago, IL, USA) were used for signal detection.
Human ILF2 and PTEN were amplified from H460 and HUVEC-C cDNA using Platinum® Taq DNA Polymerase (Invitrogen; Thermo Fisher Scientific, Inc.), respectively. The thermocycling conditions were as follows: Initial denaturation for 5 min at 95°C; followed by 35 cycles of 30 sec at 95°C, 30 sec at 55°C and 2 min at 72°C; and a final extension for 5 min at 72°C. ILF2 and PTEN were ligated into the lentiviral shuttle pCCL.PPT.hPGK.IRES.GFP/pre. The sequences of the primers used for amplification were as follows: ILF2-ORF, forward 5′-CGCGGATCCATGAGGGGTGACAGAGGCCG-3′, reverse 5′-CGCGGATCCTCACTCCTGAGTTTCCATGC-3′; and PTEN-ORF, forward 5′-CGCGGATCCATGACAGCCATCATCAAAGA-3′ and reverse 5′-CGCGGATCCTCAGACTTTTGTAATTTGTG-3′. Oligos encoding short hairpin (sh)RNA specific for ILF2 were ligated into pSUPER.retro.puro, and the fragment containing the H1 promoter and hairpin sequences was subcloned into the lentiviral shuttle pCCL.PPT.hPGK.GFP.Wpre. The shRNA sequences were as follows: shRNA-1 targeting ILF2, GGCCTTGCTGAAGAGGAATCA; shRNA-2 targeting ILF2, CTGTGATGAACAACCCCACCA; shRNA-1 targeting PTEN, GAAAGGGACGAACTGGTGTAA; and shRNA-2 targeting PTEN, GGCGTATACAGGAACAATATT. HEK293T was used for lentiviral packaging. A total of 15 ng target plasmid was transfected into HEK293T with a confluence of 80% in 100 mm dishes. Polyethylenimine (Polysciences, Inc., Mount Arlington, NJ, USA) was used as the transfection reagent and a 1:3 transfection reagent: Plasmid ratio was used. Cells were transfected for 4 h in DMEM, after which the media was replaced. Cells were incubated at 37°C after transfection and the lentivirus was collected 24 h after transfection. Lentivirus was used to infect the corresponding target cells for 24 h.
ChIP was performed as described by Liu and Garrard (25). The primary antibody against ILF2 was used at a 1:50 dilution.
DNA fragments of the PTEN upstream regulatory region were amplified from HUVEC-C DNA using Platinum® Taq DNA Polymerase (Invitrogen; Thermo Fisher Scientific, Inc.). Cycling conditions were as follows: Initial denaturation for 5 min at 95°C, followed by 35 cycles of 30 sec at 95°C, 30 sec at 55°C and 2 min at 72°C, with a final extension for 5 min at 72°C. They were inserted into the XhoI and the HindIII sites of pGL3-basic with firefly luciferase. A Renilla reniformis luciferase plasmid (pRL-TK) was used for normalization. A549 and H460 cells (1×105) were plated in 24-well plates and were transfected after ~24 h, once they reached ~80% confluence. Cells were co-transfected with 900 ng target plasmid and 15 ng pRL-TK using 1 µl Lipofectamine® 2000 (Invitrogen; Thermo Fisher Scientific, Inc.) at 37°C in a cell culture incubator. After 24 h, the Dual-Luciferase Reporter assay system (Promega Corporation, Madison, WI, USA) was used to lyse the cells and measure the luciferase activity with a Promega GloMax 20/20 Luminometer in Eppendorf Tubes according to the manufacturer's protocol.
SPSS v.19.0 software (IBM Corp., Armonk, NY, USA) was used to perform statistical analyses. Data are presented as the means ± standard deviation. Comparison analysis was performed using the Student's t-test and one-way analysis of variance. Dunnett's test was used for pairwise comparisons of multiple treatment groups with a single control group. All experimental groups were compared to the control groups. P<0.05 was considered to indicate a statistically significant difference. Kaplan-Meier survival analysis of ILF2 was performed with an online tool (http://kmplot.com/analysis/) and the log rank test was used to generate P-values.
ILF2 expression levels were detected in the human normal cell lines HUVEC-C, HBEC-5i and BEAS-2B, and in the NSCLC cell lines A549, H460, H1155 and H1299. High transcriptional and translational levels of ILF2 were detected in all NSCLC cell lines according to the results from RT-qPCR and western blotting experiments, respectively (Fig. 1A and B).
In order to investigate the effect of ILF2 in lung cancer, Kaplan-Meier survival analysis was used to determine the association between ILF2 expression and the survival time of patients with lung cancer using an online tool (http://kmplot.com/analysis/) (26). The results demonstrated that increased ILF2 expression was significantly associated with a worse overall survival rate of patients with lung cancer (n=2,437; P=0.000088; Fig. 1C), which suggested that ILF2 may serve a crucial role in lung cancer malignancy progression.
To determine the role of ILF2 in the development of NSCLC, a series of cytology tests were conducted. Although it has been reported that ILF2 affects NSCLC cell proliferation (12), the results from the present study demonstrated a different effect. HUVEC-C and HBEC-5i were the normal cell lines used. A previous study demonstrated that, HUVEC-C and HBEC-5i are sensitive to anoikis (22), which may aid determining the function and underlying mechanism of ILF2. Western blotting demonstrated that ILF2 overexpression in HUVEC-C and HBEC-5i cells using the lentivirus system was successful (Fig. 2A). In addition, the adhesion assay reported that ILF2 significantly reduced cell adhesion (Fig. 2B). Furthermore, following 24 h of suspension culture, the survival rate of floating cells overexpressing ILF2 decreased compared with the control cells, as measured with the Cell Death Detection ELISA PLUS kit (Fig. 2C). The results obtained from HBEC-5i cell line were similar (data not shown). Furthermore, ILF2 knockdown in A549 and H460 cells confirmed these phenomena (Fig. 2D-F). Western blotting confirmed ILF2 knockdown in A549 and H460 cell lines (Fig. 2D). In addition, ILF2 knockdown significantly increased cell adhesion and reduced cell survival after suspension culture (Fig. 2E and F, respectively). The results obtained from the H460 cell line were similar (data not shown). Taken together, these results suggested that ILF2 may reduce cell-cell and cell-matrix adhesions and promote anchorage independence.
The results demonstrated that ILF2 overexpression in HUVEC-C and HBEC-5i cell lines decreased the PTEN protein level (Fig. 3A). It has been reported that PTEN affects many aspects of tumor progression, including apoptosis promotion (27). Following PTEN knockdown by shRNA in HUVEC-C, the cell phenotype was similar (Fig. 3B and C) to the one observed following ILF2 overexpression. The results obtained from HBEC-5i cell line were similar (data not shown). These results suggested that ILF2 may reduce cell adhesion and promote anchorage independence by inhibiting PTEN expression. To test this hypothesis, the PTEN expression decrease caused by ILF2 overexpression was recovered by overexpressing PTEN. Cell adhesion and apoptosis after suspension culture recovered to some degree (Fig. 3B and C).
ILF2 knockdown in A549 and H460 cell lines led to PTEN upregulation (Fig. 3D). PTEN recovery reduced cell-matrix adhesion and stimulated cell survival following 24 h of suspension culture (Fig. 3E and F). The results obtained from the H460 cell line were similar (data not shown). These data indicated that ILF2 reduced cell adhesion and promoted anchorage independence by regulating PTEN expression.
The specific mechanism of ILF2 on PTEN regulation was further explored. Since ILF2 is a transcription factor, it was hypothesized that it could bind to the PTEN gene upstream to regulate its transcription. It has been reported that ILF2 interacts with the TGACAA motif of IL-2 proximal promoter (28). According to DNase I hypersensitive sites analyzed by the Encyclopedia of DNA Elements at the UCSC database (http://genome.ucsc.edu/ENCODE/), a series of primers for ChIP assays in the range of 10 kb upstream and downstream of the PTEN transcription start site were designed (Fig. 4A). In HUVEC-C and HBEC-5i cells overexpressing ILF2, the results from the ChIP assay demonstrated that ILF2 could bind to the R3 region of PTEN (Fig. 4B and C). A series of luciferase reporter vectors containing fragments of different lengths upstream of PTEN were then constructed. A549 and H460 cells highly expressing ILF2 were used to conduct the luciferase reporter gene assays. The results demonstrated that the activity of the luciferase reporter containing the −2,956 to −2,642 bp fragment was very high (Fig. 4D). Furthermore, the position of the −2,956 to −2,642 bp fragment overlaps with the R3 position. These results indicated that the transcription factor ILF2 bound directly to the upstream region of the PTEN gene to affect its expression.
Lung cancer is one of the most common malignancies worldwide. NSCLC includes squamous cell carcinoma, adenocarcinoma and large cell carcinoma. In comparison with small cell carcinoma, NSCLC cells have slower growth and division rates, and diffusion and metastasis occur relatively late. NSCLC accounts for ~80% of all lung cancers. At the time of diagnosis, ~75% of patients with NSCLC are in advanced stages and have a poor 5-year survival rate of ~16%. The majority of patients with NSCLC are elderly, and ~50% of patients with lung cancer are >65 years old (29). Early diagnosis of NSCLC is essentially based on sputum cytology examination, chest X-ray and other related examinations (30). Patients are conventionally treated by chemotherapy combined with surgery; however, the overall efficiency remains poor (31). With the major breakthrough and rapid development of the Human Genome Project, the diagnosis and treatment of lung tumors has reached the molecular level. Due to genetic engineering, novel discoveries have been made at the gene level, which has attracted the attention of the medical community (31).
ILF2 is a transcription factor that contains an internal ribosome entry site. ILF2 interacts with ILF3 to form a complex that affects the nuclear redistribution of mRNA, repairs non-homologous end-linked DNA damage, negatively regulates the processing of microRNA and affects the expression of downstream genes (32–34). The main biological function of ILF2 is the control of cell cycle and apoptosis. However, these biological roles are cell type-specific. For example, ILF2 is lowly expressed in the liver, heart, lung, skeletal muscle and spleen, whereas it is highly expressed in kidney, testis, thymus and brain (35). The results from the present study demonstrated that ILF2 high expression was associated with NSCLC cell detachment and survival.
Previous studies reported abnormal ILF2 expression in cervical and colorectal cancers (36,37). By analyzing Kaplan-Meier prognosis data of NSCLC, it was demonstrated that high ILF2 expression was associated with poor prognosis in the present study. A series of experiments were conducted to examine the specific functions of ILF2 in NSCLC cell lines here. The results demonstrated that ILF2 was highly expressed in NSCLC cells and reduced adhesion in cells, and promoted cell survival independently of anchorage. In addition, ILF2 achieved these functions by binding to the upstream regulatory region of the PTEN gene to inhibit its expression.
Although the present study was not the first to explore the function of ILF2 in NSCLC cells, novel features have been demonstrated. To the best of our knowledge, this study was the first to explore the association between the transcription factor ILF2 and the tumor suppressor gene PTEN in NSCLC cell lines. These results may aid scientists and clinicians to better understand NSCLC in order to provide novel molecular targets for diagnosis and treatment.
The present study demonstrated that high expression of ILF2 could cause weak cell adhesion to the extracellular matrix and anoikis resistance. These two phenomenons may be influenced by the ILF2/PTEN pathway. A previous study revealed that cells reduced adhesion and bypassed anoikis by down-regulating the integrin-signaling pathway (38). ILF2/PTEN pathway may also achieve these functions by affecting the integrin signaling pathway, which requires further investigation. Integrin expression and related signaling pathways will be examined in a future study.
Not applicable.
No funding was received.
The datasets used or analyzed during the present study are available from the corresponding author on reasonable request.
TL designed the present study, and prepared, edited and reviewed the manuscript. NL, HL and LFZ performed the experiments. NL, LPC and MYG acquired the data. NL, WKH and QZQ analyzed the data. QGM, JHZ and JZ performed the statistical analysis.
Not applicable.
Not applicable.
The authors declare that they have no competing interests.
|
NSCLC |
non-small cell lung cancer |
|
PTEN |
phosphatase and tensin homolog deleted on chromosome ten |
|
ILF2 |
interleukin enhancer-binding factor 2 |
|
ChIP |
chromatin immunoprecipitation |
|
ENCODE |
Encyclopedia of DNA Elements |
|
Fernandez LE, Gabri MR, Guthmann MD, Gomez RE, Gold S, Fainboim L, Gomez DE and Alonso DF: NGcGM3 ganglioside: A privileged target for cancer vaccines. Clin Dev Immunol. 2010:8143972010. View Article : Google Scholar : PubMed/NCBI | |
|
Ladanyi M and Pao W: Lung adenocarcinoma: Guiding EGFR-targeted therapy and beyond. Mod Pathol. 21 (Suppl 2):S16–S22. 2008. View Article : Google Scholar : PubMed/NCBI | |
|
Zhan P, Wang J, Lv XJ, Wang Q, Qiu LX, Lin XQ, Yu LK and Song Y: Prognostic value of vascular endothelial growth factor expression in patients with lung cancer: A systematic review with meta-analysis. J Thorac Oncol. 4:1094–1103. 2009. View Article : Google Scholar : PubMed/NCBI | |
|
Siegel RL, Miller KD and Jemal A: Cancer statistics, 2015. CA Cancer J Clin. 65:5–29. 2015. View Article : Google Scholar : PubMed/NCBI | |
|
Wyllie AH: ‘Where, O death, is thy sting?’ A brief review of apoptosis biology. Mol Neurobiol. 42:4–9. 2010. View Article : Google Scholar : PubMed/NCBI | |
|
Ruoslahti E and Reed JC: Anchorage dependence, integrins, and apoptosis. Cell. 77:477–478. 1994. View Article : Google Scholar : PubMed/NCBI | |
|
Cheng TL, Symons M and Jou TS: Regulation of anoikis by Cdc42 and Rac1. Exp Cell Res. 295:497–511. 2004. View Article : Google Scholar : PubMed/NCBI | |
|
Frankel A, Rosen K, Filmus J and Kerbel RS: Induction of anoikis and suppression of human ovarian tumor growth in vivo by down-regulation of Bcl-X(L). Cancer Res. 61:4837–4841. 2001.PubMed/NCBI | |
|
Yamada KM and Araki M: Tumor suppressor PTEN: Modulator of cell signaling, growth, migration and apoptosis. J Cell Sci. 114:2375–2382. 2001.PubMed/NCBI | |
|
Zhan M, Zhao H and Han ZC: Signalling mechanisms of anoikis. Histol Histopathol. 19:973–983. 2004.PubMed/NCBI | |
|
Huang Q, He X, Qiu X, Liu X, Sun G, Guo J, Ding Z, Yang L, Ban N, Tao T and Wang D: Expression of NF45 correlates with malignant grade in gliomas and plays a pivotal role in tumor growth. Tumour Biol. 35:10149–10157. 2014. View Article : Google Scholar : PubMed/NCBI | |
|
Ni T, Mao G, Xue Q, Liu Y, Chen B, Cui X, Lv L, Jia L, Wang Y and Ji L: Upregulated expression of ILF2 in non-small cell lung cancer is associated with tumor cell proliferation and poor prognosis. J Mol Histol. 46:325–335. 2015. View Article : Google Scholar : PubMed/NCBI | |
|
Ni S, Zhu J, Zhang J, Zhang S, Li M, Ni R, Liu J, Qiu H, Chen W, Wang H and Guo W: Expression and clinical role of NF45 as a novel cell cycle protein in esophageal squamous cell carcinoma (ESCC). Tumour Biole. 36:747–756. 2015. View Article : Google Scholar | |
|
Haselmann V, Kurz A, Bertsch U, Hübner S, Olempska-Müller M, Fritsch J, Häsler R, Pickl A, Fritsche H, Annewanter F, et al: Nuclear death receptor TRAIL-R2 inhibits maturation of let-7 and promotes proliferation of pancreatic and other tumor cells. Gastroenterology. 146:278–290. 2014. View Article : Google Scholar : PubMed/NCBI | |
|
Wan C, Gong C, Ji L, Liu X, Wang Y, Wang L, Shao M, Yang L, Fan S, Xiao Y, et al: NF45 overexpression is associated with poor prognosis and enhanced cell proliferation of pancreatic ductal adenocarcinoma. Mol Cell Biochem. 410:25–35. 2015. View Article : Google Scholar : PubMed/NCBI | |
|
Lee YY, McKinney KQ, Ghosh S, Iannitti DA, Martinie JB, Caballes FR, Russo MW, Ahrens WA, Lundgren DH, Han DK, et al: Subcellular tissue proteomics of hepatocellular carcinoma for molecular signature discovery. J Proteome Res. 10:5070–5083. 2011. View Article : Google Scholar : PubMed/NCBI | |
|
Li J, Yen C, Liaw D, Podsypanina K, Bose S, Wang SI, Puc J, Miliaresis C, Rodgers L, McCombie R, et al: PTEN, a putative protein tyrosine phosphatase gene mutated in human brain, breast, and prostate cancer. Science. 275:1943–1947. 1997. View Article : Google Scholar : PubMed/NCBI | |
|
Datta SR, Brunet A and Greenberg ME: Cellular survival: A play in three Akts. Genes Dev. 13:2905–2927. 1999. View Article : Google Scholar : PubMed/NCBI | |
|
Sulis ML and Parsons R: PTEN: From pathology to biology. Trends Cell Biol. 13:478–483. 2003. View Article : Google Scholar : PubMed/NCBI | |
|
Tamura M, Gu J, Matsumoto K, Aota S, Parsons R and Yamada KM: Inhibition of cell migration, spreading, and focal adhesions by tumor suppressor PTEN. Science. 280:1614–1617. 1998. View Article : Google Scholar : PubMed/NCBI | |
|
Zhong H, Chiles K, Feldser D, Laughner E, Hanrahan C, Georgescu MM, Simons JW and Semenza GL: Modulation of hypoxia-inducible factor 1alpha expression by the epidermal growth factor/phosphatidylinositol 3-kinase/PTEN/AKT/FRAP pathway in human prostate cancer cells: Implications for tumor angiogenesis and therapeutics. Cancer Res. 60:1541–1545. 2000.PubMed/NCBI | |
|
Li X, Xu Z, Du W, Zhang Z, Wei Y, Wang H, Zhu Z, Qin L, Wang L, Niu Q, et al: Aiolos promotes anchorage independence by silencing p66Shc transcription in cancer cells. Cancer Cell. 25:575–589. 2014. View Article : Google Scholar : PubMed/NCBI | |
|
Liu CY, Takemasa A, Liles WC, Goodman RB, Jonas M, Rosen H, Chi E, Winn RK, Harlan JM and Chuang PI: Broad-spectrum caspase inhibition paradoxically augments cell death in TNF-alpha-stimulated neutrophils. Blood. 101:295–304. 2003. View Article : Google Scholar : PubMed/NCBI | |
|
Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods. 25:402–408. 2001. View Article : Google Scholar : PubMed/NCBI | |
|
Liu Z and Garrard WT: Long-range interactions between three transcriptional enhancers, active Vkappa gene promoters, and a 3′ boundary sequence spanning 46 kilobases. Mol Cell Biol. 25:3220–3231. 2005. View Article : Google Scholar : PubMed/NCBI | |
|
Győrffy B, Surowiak P, Budczies J and Lánczky A: Online survival analysis software to assess the prognostic value of biomarkers using transcriptomic data in non-small-cell lung cancer. PLoS One. 8:e822412013. View Article : Google Scholar : PubMed/NCBI | |
|
Di Cristofano A and Pandolfi PP: The multiple roles of PTEN in tumor suppression. Cell. 100:387–390. 2000. View Article : Google Scholar : PubMed/NCBI | |
|
Shi L, Qiu D, Zhao G, Corthesy B, Lees-Miller S, Reeves WH and Kao PN: Dynamic binding of Ku80, Ku70 and NF90 to the IL-2 promoter in vivo in activated T-cells. Nucleic Acids Res. 35:2302–2310. 2007. View Article : Google Scholar : PubMed/NCBI | |
|
Reck M, Heigener DF, Mok T, Soria JC and Rabe KF: Management of non-small-cell lung cancer: Recent developments. Lancet. 382:709–719. 2013. View Article : Google Scholar : PubMed/NCBI | |
|
Goldstraw P, Ball D, Jett JR, Le Chevalier T, Lim E, Nicholson AG and Shepherd FA: Non-small-cell lung cancer. Lancet. 378:1727–1740. 2011. View Article : Google Scholar : PubMed/NCBI | |
|
Tan WL, Jain A, Takano A, Newell EW, Iyer NG, Lim WT, Tan EH, Zhai W, Hillmer AM, Tam WL and Tan DSW: Novel therapeutic targets on the horizon for lung cancer. Lancet Oncol. 17:e347–e362. 2016. View Article : Google Scholar : PubMed/NCBI | |
|
Karmakar S, Mahajan MC, Schulz V, Boyapaty G and Weissman SM: A multiprotein complex necessary for both transcription and DNA replication at the β-globin locus. EMBO J. 29:3260–3271. 2010. View Article : Google Scholar : PubMed/NCBI | |
|
Shamanna RA, Hoque M, Lewis-Antes A, Azzam EI, Lagunoff D, Pe'ery T and Mathews MB: The NF90/NF45 complex participates in DNA break repair via nonhomologous end joining. Mol Cell Biol. 31:4832–4843. 2011. View Article : Google Scholar : PubMed/NCBI | |
|
Volk N and Shomron N: Versatility of MicroRNA biogenesis. PLoS One. 6:e193912011. View Article : Google Scholar : PubMed/NCBI | |
|
Zhao G, Shi L, Qiu D, Hu H and Kao PN: NF45/ILF2 tissue expression, promoter analysis, and interleukin-2 transactivating function. Exp Cell Res. 305:312–323. 2005. View Article : Google Scholar : PubMed/NCBI | |
|
Shim C, Zhang W, Rhee CH and Lee JH: Profiling of differentially expressed genes in human primary cervical cancer by complementary DNA expression array. Clin Cancer Res. 4:3045–3050. 1998.PubMed/NCBI | |
|
Chung FH, Lee HH and Lee HC: ToP: A trend-of-disease- progression procedure works well for identifying cancer genes from multi-state cohort gene expression data for human colorectal cancer. PLoS One. 8:e656832013. View Article : Google Scholar : PubMed/NCBI | |
|
Overholtzer M, Mailleux AA, Mouneimne G, Normand G, Schnitt SJ, King RW, Cibas ES and Brugge JS: A nonapoptotic cell death process, entosis, that occurs by cell-in-cell invasion. Cell. 131:966–979. 2007. View Article : Google Scholar : PubMed/NCBI |