Open Access

CEACAM6 promotes cholangiocarcinoma migration and invasion by inducing epithelial‑mesenchymal transition through inhibition of the SRC/PI3K/AKT signaling pathway

  • Authors:
    • Chen Liu
    • Min Wang
    • Haitao Lv
    • Bing Liu
    • Xueqiang Ya
    • Weihong Zhao
    • Wenbin Wang
  • View Affiliations

  • Published online on: December 3, 2021     https://doi.org/10.3892/ol.2021.13157
  • Article Number: 39
  • Copyright: © Liu et al. This is an open access article distributed under the terms of Creative Commons Attribution License.

Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )


Abstract

The immunoglobulin superfamily member carcinoembryonic antigen‑related cell adhesion molecule 6 (CEACAM6) is overexpressed in a wide variety of human cancer types, and is associated with tumor invasion and migration. The aim of the present study was to determine the role of CEACAM6 in cholangiocarcinoma (CCA) invasion and migration in vitro. The results showed that CEACAM6 was highly expressed in CCA tissues, and that the expression level of CEACAM6 was negatively associated with the degree of differentiation of CCA. Silencing CEACAM6 inhibited cell viability, invasion and migration but promoted cell apoptosis in a human CCA cell line (RBE). In addition, CEACAM6 knockdown decreased the expression of an antiapoptotic protein (Bcl‑2), an interstitial cell marker (N‑cadherin), extracellular matrix proteins (MMP‑2 and MMP‑9), a transcription factor helix protein (Twist‑related protein 1), an intermediate tumor cell scaffold marker (vimentin), a protein involved in tumor nutrient vascular formation (VEGFA) and a tumorigenesis factor (intercellular cell adhesion molecule‑1), but increased the expression of pro‑apoptotic proteins (Bax, and cleaved caspases‑3, ‑8 and ‑9) and an epithelial cell marker protein (E‑cadherin). Furthermore, CEACAM6‑small interfering RNA reduced the expression of the SRC/PI3K/AKT signaling transduction pathway. Taken together, these results suggested that CEACAM6 may be an epithelial‑mesenchymal transition biomarker and a potential therapeutic target in human CCA.

Introduction

Cholangiocarcinoma (CCA) has been reported to be the second most common hepatic malignancy after hepatocellular carcinoma (HCC), and its incidence has gradually increased worldwide (12). CCA is a relatively infrequent malignancy arising from epithelial cells lining the biliary tree, and is classified anatomically as intrahepatic (iCCA), perihilar (pCCA) or distal (3). The incidence of iCCA has increased globally over the past few decades. According to the mortality rates reported in the World Health Organization database, the age-standardized mortality rates for iCCA have increased in almost all countries across all continents (4). Surgery is the preferred treatment option for a minority of patients with early-stage CCA (~35%). However, the currently available systemic therapies are of limited effectiveness for patients with advanced-stage or unresectable CCA, due to its absence of clinical symptoms and anatomical location of difficult access (5). Therefore, it is urgent to explore novel markers and molecules for CCA therapy.

Epithelial-mesenchymal transition (EMT) is associated with tumor invasion and migration, and is defined as a reversible dynamic process in which epithelial cells lose their phenotypic characteristics and adopt mesenchymal cell structural and functional features (6,7). These changes involve downregulation of E-cadherin and β-catenin, which are two main phenotypic characteristic components of epithelial cells, as well as upregulation of proteins involved in the mesenchymal phenotype (N-cadherin, α-smooth muscle actin, vimentin, fibronectin and MMPs), which occur via EMT-inducing transcription factors. The EMT-inducing transcription factor comprise three families: Snail, zinc finger E-box-binding homeobox and Twist-related proteins (TWIST) (8).

EMT is involved in human physiological and pathological processes, including embryonic and organ development, organ fibrosis, wound healing, and cancer progression (9,10), and is accompanied by marked changes in cellular morphology, enhanced migratory and invasive capabilities, as well as loss and remodeling of cell-cell interactions and cell-matrix adhesion (11). Thus, EMT may be an important mechanism involved in the progression of CCA, and EMT biomarkers may provide new insights into the progression and migration of CCA. In addition, the activities of cellular (c)-SRC kinase, and PI3K and AKT, which are potentially located downstream of c-SRC, are hallmarks for malignant transformation and progression.

Carcinoembryonic antigen-related cell adhesion molecule 6 (CEACAM6), a member of the CEACAM family, is normally expressed on the surface of myeloid and epithelial cells, while aberrant CEACAM6 expression leads to the development of human malignancies (1214). Previous studies have reported that CEACAM6 is overexpressed in several epithelial carcinomas, including colon, breast and non-small cell lung cancer, as well as iCCA (15,16). CEACAM6 mediates cell-cell adhesion, which is required for guiding cells to their correct location during embryonic development, and for the integration of single cells into functional tissues and organs (17). However, overexpression of CEACAM6 has been shown to alter tissue architecture in several carcinoma cell lines (18). In addition, overexpression of CEACAM6 reduces cell apoptosis, indicating that CEACAM6 plays a key role in promoting the aberrant growth of adherent cells (19). Previous studies have shown that CEACAM6 induces EMT, and mediates invasion and migration in pancreatic and gastric cancer, and its clinical importance in colorectal cancer has also been reported (20,21). However, the physiological function of CEACAM6, and its potential involvement in tumor formation and progression in CCA have not been fully elucidated to date.

The present study demonstrated that CEACAM6 is an important regulator of CCA EMT, as well as of cell migration and invasion in vitro, which suggests that CEACAM6 may be an important target for the treatment of human CCA.

Materials and methods

Tissues and cell line

Primary CCA tissues and matched adjacent paracancerous tissues (distance, 1 cm) were surgically obtained from 27 patients with CCA 20 males and 7 females with an age range of 56–78 years (mean age, 66.4 years), including 9 cases of highly differentiated CCA and 18 cases of less differentiated CCA) at The Second Hospital of Hebei Medical University (Shijiazhuang, China) from January 2016 to December 2017. Ethics approval (approval no. 2014018) was obtained from The Second Hospital of Hebei Medical University and all samples were collected with written informed consent from the patients.

RBE cells (Qiao Xinzhou Biotechnology Co., Ltd.) were cultured at 37°C with 5% CO2 in DMEM (Thermo Fisher Scientific, Inc.) containing 10% fetal bovine serum (FBS; Biological Industries; Sartorius AG) and 1% penicillin and streptomycin (Sigma-Aldrich; Merck KGaA). Cells in the logarithmic growth phase were used for experiments.

Reverse transcription-quantitative PCR (RT-qPCR)

Total RNA was extracted from CCA and paracancerous tissue and RBE cells using TRIzol® reagent (Invitrogen; Thermo Fisher Scientific, Inc.), and first-strand cDNA was synthesized using PrimeScript™ RT Reagent kit (Takara Biotechnology Co., Ltd.). qPCR was performed in triplicate with SYBRII qPCR Master Mix (Takara Biotechnology Co., Ltd.) according to the manufacturer's protocol using GAPDH as a control. RT was performed at 37°C for 15 min and 85°C for 5 min. Thermocycling conditions were as follows: Initial denaturation at 95°C for 30 sec, followed by 40 cycles of 95°C for 5 sec and 60°C for 31 sec. The relative mRNA levels of the target genes were calculated with the 2−ΔΔCq method (22). The primer sequences used in qPCR are listed in Table I.

Table I.

Primer sequences for quantitative PCR.

Table I.

Primer sequences for quantitative PCR.

GeneForward (5′-3′)Reverse (3′-5′)
MMP-2 CCAACTACAACTTCTTCCCTCG TCACATCGCTCCAGACTTG
MMP-9 ACGCAGACATCGTCATCCA AGGGACCACAACTCGTCATC
ICAM-1 GTCATCATCACTGTGGTAGCAG GGCTTGTGTGTTCGGTTTC
E-cadherin GTGGTCAAAGAGCCCTTACTG CGTTACGAGTCACTTCAGGC
N-cadherin TCATTGCCATCCTGCTCTG CATCCATACCACAAACATCAGC
Vimentin AAATGGCTCGTCACCTTCG AGAAATCCTGCTCTCCTCGC
TWIST1 GGAGTCCGCAGTCTTACGA CTTGAGGGTCTGAATCTTGCT
Bcl-2 TGTGTGGAGAGCGTCAACC TGGATCCAGGTGTGCAGGT
Bax TTTCTGACGGCAACTTCAAC AGTCCAATGTCCAGCCCAT
Caspase 3 ACTGGACTGTGGCATTGAGAC TTGTCGGCATACTGTTTCAGC
Caspase 8 TGTTGGAGGAAAGCAATCTG CTGCCTGGTGTCTGAAGTTC
Caspase 9 GCAGATTTGGCTTACATCCTG ACGGCAGAAGTTCACATTGT
CEACAM6 CACTATTGAATCCACGCCG TTGCCATCCACTCTTTCG
VEGFA CTTGCCTTGCTGCTCTACCT TGATGATTCTGCCCTCCTCCT
c-SRC GAGGAGCCCATTTACATCG CTTGAGAAAGTCCAGCAAACTC
PI3K GCCTGCTCTGTAGTGGTAGATG GGAGGTGTGTTGGTAATGTAGC
AKT TACGAGATGATGTGCGGTC TCTTGAGCAGCCCTGAAAG

[i] ICAM-1, intercellular cell adhesion molecule-1; TWIST1, Twist-related protein 1; c-SRC, cellular SRC; CEACAM6, carcinoembryonic antigen-related cell adhesion molecule 6.

Western blotting

Western blotting was performed as previously described (18). Briefly, total protein was extracted from RBE (5×106) cells, CCA tissues and paracancerous tissues with cold RIPA buffer containing protease and phosphatase inhibitors (all Beijing Solarbio Science and Technology Co., Ltd.), followed by quantification of protein concentration using the BCA assay. Protein samples (30 µg/lane) were heated to 100°C for 10 min in SDS-PAGE loading buffer (Thermo Fisher Scientific, Inc.) and separated on 10% SDS-PAGE. The separated proteins were transferred at 200 mA to a PVDF membrane (MilliporeSigma) for 2 h at 4°C. After blocking the membrane with TBS containing 5% skimmed milk for 1.5 h at room temperature, the membranes were incubated with primary antibodies at 4°C overnight. The primary antibodies used were as follows: β-actin (rabbit monoclonal; 1:2,000; Abcam), Bax (rabbit monoclonal; 1:500; Abcam), Bcl2 (rabbit monoclonal antibody, dilution: 1:500; Abcam), cleaved caspase-3 (rabbit monoclonal antibody dilution: 1:500; Abcam), cleaved caspase-8 (rabbit polyclonal antibody, dilution: 1:500; Abcam), cleaved caspase-9 (rabbit polyclonal; 1:500; Abcam), MMP2 (rabbit polyclonal antibody, dilution: 1:500; Abcam), MMP9 (rabbit polyclonal antibody, dilution: 1:500; Abcam), ICAM-1 (rabbit polyclonal antibody, dilution: 1:500; Abcam); VEGFA (rabbit polyclonal; 1:500; Abcam); E-cadherin (rabbit polyclonal; 1:500; Abcam); N-cadherin (rabbit polyclonal antibody, dilution: 1:500; Abcam); TWIST (mouse monoclonal antibody, dilution: 1:500, Santa Cruz Biotechnology, Inc.); Vimentin (mouse monoclonal antibody, dilution: 1:500; Santa Cruz Biotechnology, Inc.); CSRC (rabbit monoclonal; 1:500; Abcam); p-CSRC (rabbit monoclonal antibody, dilution: 1:500; Abcam); PI3K, p-PI3K, AKT, p-AKT (rabbit monoclonal antibody, dilution: 1:500; Cell Signaling Technology, Inc.). Appropriate horseradish peroxidase-conjugated secondary antibody (goat anti-rabbit IgG, dilution: 1:5,000 and goat anti-mouse IgG, dilution: 1:3,000) at 25°C for 1 h. The bands were detected using SuperECL Plus detection reagents (LI-COR Biosciences) and quantified with a Bio-Rad ChemiDoc imaging system (Bio-Rad Laboratories, Inc.) using β-actin as an internal control.

Cell transfection

RBE cells (30–40% confluence) were transfected with Lipofectamine® RNAiMAX Reagent (Thermo Fisher Scientific, Inc.) and 20 nM small interfering RNA (siRNA) (Guangzhou RiboBio Co., Ltd.) according to the manufacturer's instructions for 4 h at 37°C. The sequences of all specific and control siRNAs are as follows: siRNA-1 CCUCUACAAAGAGGUGGACAGAGAATT; siRNA-2 CCAUGGUGAGAAAUUGACGACUUCATT; siRNA-3 CACCACUGCCAAGCUCACUAUUGAATT and control, CCUCUUACCUCAGUUACAAUUUAUATT. Three separate CEACAM6-specific siRNA sequences were used, and an unrelated control siRNA sequence was transfected using the same protocol, which had no effect on CEACAM6 expression. Non-transfected cells were also used as a negative control; these were treated with serum-free DMEM for 4 h at 37°C. Knockdown of CEACAM6 expression was confirmed at 48 h by western blotting.

Cell viability determination

The viability of RBE cells was determined using a Cell Counting Kit (CCK)-8 assay (Abcam) according to the manufacturer's instructions. Briefly, transfected cells (2×103) in 96-well plates were incubated for 24 h at 37°C and 5% CO2. CCK-8 reagent (10 µl) was added for 1 h at 37°C and optical density was measured at 460 nm.

Cell apoptosis analysis

RBE cells (80–90% confluence) transfected with siRNAs for 48 h were washed twice with PBS (both 30 sec at room temperature) and then resuspended in staining buffer containing 0.025 mg/ml Annexin V-FITC and 1 mg/ml propidium iodide (Shanghai Yisheng Biotechnology Co., Ltd.). Double staining was performed for 10 min at room temperature in the dark, and the number of apoptotic cells was then determined by flow cytometry using a BD FACSCanto™ ІІ flow cytometer (BD Biosciences). The software used for data analysis is FlowJo (7.6.1; FlowJo, LLC.).

In vitro invasion assay

Cell invasion assays were performed using Transwell inserts (Corning, Inc.) coated with Matrigel (37°C for 1 h) were performed as previously described (23). Briefly, RBE cells (1×105) in 0.2 ml serum-free DMEM were placed in the upper chamber, and the lower chamber was loaded with 0.5 ml medium containing 15% FBS. Cells that migrated to the lower surface of the filters were stained with 0.005% crystal violet solution for 40 min at room temperature, and cells in five fields of view were counted after 24 h of incubation at 37°C and 5% CO2 using light microscope. Three wells were examined for each cell type and condition, and the experiments were conducted in triplicate.

Wound healing assay

RBE cells (6×105) were seeded in 6-well plates. When cells reached 90% confluency, a 100-µl pipette tip was used to scratch the serum-starved cell monolayer (time 0 h). Images of migrating cells during the closure of the wounded region were captured at 0 and 24 h using light microscope (magnification, ×10).

Statistical analysis

All statistical analyses were conducted using SPSS version 19.0 (IBM, Corp.). Data are presented as the mean ± standard error of the mean of three independent repeats. Comparisons of the means of different groups were performed by using two-way mixed ANOVA or one-way ANOVA. Pairwise comparisons with homogeneity of variance were performed using the post hoc Tukey's honestly significant difference and Student-Newman-Keuls tests. P<0.05 was considered to indicate a statistically significant difference.

Results

CEACAM6 is overexpressed in CCA tissues, and its expression level is negatively associated with tumor differentiation degree

As shown in Fig. 1, CEACAM6 was overexpressed in highly differentiated and less differentiated CCA tissues compared with its expression levels in highly differentiated and less differentiated paracancerous tissues (P<0.05). Furthermore, lesser differentiation degrees of CCA tissues resulted in higher CEACAM6 expression levels (P<0.05).

Silencing CEACAM6 inhibits cell and promotes cell apoptosis in RBE cells

After determining that CEACAM6 was highly expressed in CCA tissues, the role of CEACAM6 in the invasion and migration of RBE cells was next verified. siRNA transfection was used to silence the expression of CEACAM6. The results of Fig. 2A-D show that CEACAM6-siRNA-2 exhibited the best knockdown efficiency after 48 h. Thus, CEACAM6-siRNA-2 was utilized in subsequent experiments. As shown in Fig. 2E, CEACAM6-siRNA-2 significantly decreased RBE cell viability by ~50 compared with that of the control group (P<0.05). In addition, Fig. 2F shows that the percentage of apoptotic cells increased after transfection of CEACAM6-siRNA-2 (34.4%) compared with that of the scramble (scr)-siRNA group (13.8%; P<0.05).

CEACAM6 knockdown inhibits the invasion and migration of RBE cells

As shown in Fig. 3A and C, the invasion ability of RBE cells was decreased after transfection with CEACAM6-siRNA-2. Similar results were obtained regarding the migration ability of RBE cells, which was also declined upon CEACA-siRNA-2 transfection, as shown in Fig. 3B and D (P<0.05).

CEACAM6 silencing increases anti-apoptotic protein expression and decreases pro-apoptotic protein expression

Since the percentage of apoptotic cells increased after transfection with CEACAM6-siRNA-2, the present study next investigated whether the mRNA and protein expression levels of apoptosis-related proteins were consistent with the aforementioned findings. The results showed that the mRNA and protein levels of anti-apoptotic Bcl-2 decreased, while those of pro-apoptotic Bax increased after transfection with CEACAM6-siRNA-2.

The caspase family is composed of a class of proteolytic enzymes that mediate apoptosis and are activated during cell apoptosis. Caspases-3, −8 and −9 are major members of the caspase family. The results showed that the protein of cleaved caspases-3, −8 and −9 and mRNA levels of caspases-3, −8 and −9 were significantly upregulated after transfection with CEACAM6-siRNA-2 (Fig. 4A-G).

CEACAM6 silencing decreases EMT marker expression in RBE cells

There are four types of EMT markers (epithelial and interstitial cell, transcription factor and cytoskeleton); of them, the epithelial cell marker E-cadherin and the interstitial cell marker N-cadherin are the most studied. In the present study, E-cadherin expression was significantly increased, while N-cadherin expression was significantly decreased after CEACAM6-siRNA-2 transfection.

MMPs are a group of zinc ion (Zn2+)-dependent endopeptidases that degrade extracellular matrix (ECM) and then induce pathological processes, such as tumor cell invasion and migration. MMP-2 and MMP-9 are important MMPs, and the protein and mRNA expression levels of these endopeptidases were reduced after siRNA transfection.

The TWIST transcription factor enhances EMT by inhibiting E-cadherin expression and enhancing tumor cell migration and invasion. The protein and mRNA expression of TWIST decreased after transfection with CEACAM6-siRNA-2.

Vimentin is an intermediate filament protein in mesenchymal cells that regulates protein-protein interactions, such as those involving cytoskeletal proteins and cell adhesion molecules, which may participate in cell invasion, migration and signal transduction. After transfection with CEACAM6-siRNA-2, the expression level of this tumor-promoting molecule decreased.

Furthermore, tumor angiogenesis is associated with VEGFA overexpression in human iCCA and pCCA (24). In the present study, the protein and mRNA levels of VEGFA and tumorigenesis-promoting ICAM-1 decreased when CEACAM6-siRNA-2 was transfected into RBE cells. The aforementioned results are shown in Fig. 4H-R.

CEACAM6 silencing decreases the expression of members of the SRC/PI3K/AKT signal transduction pathway in RBE cells

The present study demonstrated that there was no significant difference in the relative mRNA levels of molecules involved in the SRC/PI3K/AKT signal transduction pathway when CEACAM6 was knocked down (Fig. 5A). However, when CEACAM6-siRNA-2 was added to the cells, the levels of phosphorylated molecules involved in the SRC/PI3K/AKT signal transduction pathway was reduced (Fig. 5B-E).

Discussion

CCA is the second most common type of primary liver cancer in human patients after HCC (5). The incidence and mortality rates of iCCA are increasing worldwide. Despite advances in the detection and treatment of metastatic CCA, mortality from this disease remains high due to its limited early-stage cytological and pathological diagnoses as well as limited effective treatments (1). Therefore, it is important to explore treatment methods based on specific markers and targets.

CEACAM6 is a member of the immunoglobulin superfamily, which is overexpressed in several human cancer types, including colorectal, pancreatic, lung and breast cancer (20,25,26). A previous report has revealed that CEACAM6 expression is associated with adverse pathological features and prognosis in pancreatic cancer (14). In agreement with those findings, the present study demonstrated that CEACAM6 was highly expressed in CCA tissues and was negatively associated with the differentiation degree of CCA, suggesting that CEACAM6 may be involved in the development and progression of CCA. The present study demonstrated that CEACAM6 was highly expressed in CCA tissue and was negatively associated with degree of differentiation.

CEACAM6 is oncogenic, as it inhibits cell differentiation, causes loss of cell polarity, and promotes cell adhesion, invasion and metastasis (27). These oncogenic properties are inhibited by an anti-CEACAM6 antibody in breast, pancreatic and colorectal cancer (28). Similarly, the present in vitro results revealed that the invasion and migration of RBE cells decreased after CEACAM6-siRNA-2 transfection.

Apoptosis, or programmed cell death, is an essential physiological process that plays a critical role in development and tissue homeostasis (29). The caspase cascade plays vital roles in the induction, transduction and amplification of intracellular apoptotic signals. The present results showed that the protein and mRNA expression levels of cleaved caspases-3, −8 and −9 increased after transfection with CEACAM6-siRNA-2.

EMT has gained increased attention in the past years regarding metastatic dissemination (9). The present study demonstrated that CEACAM6 was an important regulator of EMT biomarkers in CCA. However, there may be other mechanisms involved in CCA progression, such as the role played by circulating tumor cells or that of exosomes released by different tumor cell types (30,31), which suggests the need for further studies. Furthermore, a previous study has shown that the function of CEACAM6 is dependent on the c-SRC signaling pathway in pancreatic cancer (32).

In conclusion, the present study has demonstrated that CEACAM6 is significantly overexpressed in CCA tissues, which indicates that CEACAM6 could be utilized as a potential tumor EMT biomarker. Understanding the clinical significance of CEACAM6 expression and its oncogenic mechanism may eventually lead to the identification of a novel therapeutic target for human CCA treatment.

Acknowledgements

Not applicable.

Funding

The present study was supported by the Hebei Science and Technology Plan 2015 (grant no. 152377768D).

Availability of data and materials

All data generated or analyzed during this study are included in this published article.

Authors' contributions

CL performed the experiments and acquired data. MW analyzed and processed data, and wrote and revised the manuscript. HL, BL, XY and WZ analyzed and interpretated data. HL, BL, XY and WZ confirm the authenticity of all the raw data. WW designed the experiments and gave final approval of the version to be published. All authors read and approved the final version of the manuscript.

Ethics approval and consent to participate

Ethics approval was from The Second Hospital of Hebei Medical University. Written informed consent was obtained from all patients.

Patient consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

References

1 

Bridgewater J, Galle PR, Khan SA, Llovet JM, Park JW, Patel T, Pawlik TM and Gores GJ: Guidelines for the diagnosis and management of intrahepatic cholangiocarcinoma. J Hepatol. 60:1268–1289. 2014. View Article : Google Scholar : PubMed/NCBI

2 

Saha SK, Zhu AX, Fuchs CS and Brooks GA: Forty-year trends in cholangiocarcinoma incidence in the U.S.: Intrahepatic disease on the rise. Oncologist. 21:594–599. 2016. View Article : Google Scholar : PubMed/NCBI

3 

Kayhanian H, Smyth EC and Braconi C: Emerging molecular targets and therapy for cholangiocarcinoma. World J Gastrointest Oncol. 9:268–280. 2017. View Article : Google Scholar : PubMed/NCBI

4 

Khan SA, Taylor-Robinson SD, Toledano MB, Beck A, Elliott P and Thomas HC: Changing international trends in mortality rates for liver, biliary and pancreatic tumours. J Hepatol. 37:806–813. 2002. View Article : Google Scholar : PubMed/NCBI

5 

Rizvi S, Khan SA, Hallemeier CL, Kelley RK and Gores GJ: Cholangiocarcinoma-evolving concepts and therapeutic strategies. Nat Rev Clin Oncol. 15:95–111. 2018. View Article : Google Scholar : PubMed/NCBI

6 

Battaglia S, Benzoubir N, Nobilet S, Charneau P, Samuel D, Zignego AL, Atfi A, Brechot C and Bourgeade MF: Liver cancer-derived hepatitis C virus core proteins shift TGF-beta responses from tumor suppression to epithelial-mesenchymal transition. PLoS One. 4:e43552009. View Article : Google Scholar : PubMed/NCBI

7 

Vaquero J, Guedj N, Claperon A, Nguyen Ho-Bouldoires TH, Paradis V and Fouassier L: Epithelial-mesenchymal transition in cholangiocarcinoma: From clinical evidence to regulatory networks. J Hepatol. 66:424–441. 2017. View Article : Google Scholar : PubMed/NCBI

8 

Puisieux A, Brabletz T and Caramel J: Oncogenic roles of EMT-inducing transcription factors. Nat Cell Biol. 16:488–494. 2014. View Article : Google Scholar : PubMed/NCBI

9 

Zhu JY, Zhou F, Yu L and Zhang J: Epithelial-mesenchymal transition of small airway epithelium in patients receiving lung tumor surgery with normal lung function and chronic obstructive pulmonary disease. Zhonghua Yi Xue Za Zhi. 99:2681–2686. 2019.(In Chinese). PubMed/NCBI

10 

Baum B, Settleman J and Quinlan MP: Transitions between epithelial and mesenchymal states in development and disease. Semin Cell Dev Biol. 19:294–308. 2008. View Article : Google Scholar : PubMed/NCBI

11 

Zeisberg M and Neilson EG: Biomarkers for epithelial-mesenchymal transitions. J Clin Invest. 119:1429–1437. 2009. View Article : Google Scholar : PubMed/NCBI

12 

Rizeq B, Zakaria Z and Ouhtit A: Towards understanding the mechanisms of actions of carcinoembryonic antigen-related cell adhesion molecule 6 in cancer progression. Cancer Sci. 109:33–42. 2018. View Article : Google Scholar : PubMed/NCBI

13 

Yamanka T, Kuroki M, Matsuo Y and Matsuoka Y: Analysis of heterophilic cell adhesion mediated by CD66b and CD66c using their soluble recombinant proteins. Biochem Biophys Res Commun. 219:842–847. 1996. View Article : Google Scholar : PubMed/NCBI

14 

Ieta K, Tanaka F, Utsunomiya T, Kuwano H and Mori M: CEACAM6 gene expression in intrahepatic cholangiocarcinoma. Br J Cancer. 95:532–540. 2006. View Article : Google Scholar : PubMed/NCBI

15 

Rose JB, Correa-Gallego C, Li Y, Nelson J, Alseidi A, Helton WS, Allen PJ, D'Angelica MI, DeMatteo RP, Fong Y, et al: The role of biliary carcinoembryonic antigen-related cellular adhesion molecule 6 (CEACAM6) as a biomarker in cholangiocarcinoma. PLoS One. 11:e01501952016. View Article : Google Scholar : PubMed/NCBI

16 

Farina A, Dumonceau JM, Antinori P, Annessi-Ramseyer I, Frossard JL, Hochstrasser DF, Delhaye M and Lescuyer P: Bile carcinoembryonic cell adhesion molecule 6 (CEAM6) as a biomarker of malignant biliary stenoses. Biochim Biophys Acta. 1844:1018–1025. 2014. View Article : Google Scholar : PubMed/NCBI

17 

Kuespert K, Pils S and Hauck CR: CEACAMs: Their role in physiology and pathophysiology. Curr Opin Cell Biol. 18:565–571. 2006. View Article : Google Scholar : PubMed/NCBI

18 

Ilantzis C, DeMarte L, Screaton RA and Stanners CP: Deregulated expression of the human tumor marker CEA and CEA family member CEACAM6 disrupts tissue architecture and blocks colonocyte differentiation. Neoplasia. 4:151–163. 2002. View Article : Google Scholar : PubMed/NCBI

19 

Ordonez C, Screaton RA, Ilantzis C and Stanners CP: Human carcinoembryonic antigen functions as a general inhibitor of anoikis. Cancer Res. 60:3419–3424. 2000.PubMed/NCBI

20 

Duxbury MS, Ito H, Zinner MJ, Ashley SW and Whang EE: CEACAM6 gene silencing impairs anoikis resistance and in vivo metastatic ability of pancreatic adenocarcinoma cells. Oncogene. 23:465–473. 2004. View Article : Google Scholar : PubMed/NCBI

21 

Chen J, Li Q, An Y, Lv N, Xue X, Wei J, Jiang K, Wu J, Gao W, Qian Z, et al: CEACAM6 induces epithelial-mesenchymal transition and mediates invasion and metastasis in pancreatic cancer. Int J Oncol. 43:877–885. 2013. View Article : Google Scholar : PubMed/NCBI

22 

Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(−Delta Delta C(T)) method. Methods. 25:402–408. 2001. View Article : Google Scholar : PubMed/NCBI

23 

Zhang Y, Zang M, Li J, Ji J, Zhang J, Liu X, Qu Y, Su L, Li C, Yu Y, et al: CEACAM6 promotes tumor migration, invasion, and metastasis in gastric cancer. Acta Biochim Biophys Sin (Shanghai). 46:283–290. 2014. View Article : Google Scholar : PubMed/NCBI

24 

Mancarella S, Serino G, Dituri F, Cigliano A, Ribback S, Wang J, Chen X, Calvisi DF and Giannelli G: Crenigacestat, a selective NOTCH1 inhibitor, reduces intrahepatic cholangiocarcinoma progression by blocking VEGFA/DLL4/MMP13 axis. Cell Death Differ. 27:2330–2343. 2020. View Article : Google Scholar : PubMed/NCBI

25 

Kim KS, Kim JT, Lee SJ, Kang MA, Choe IS, Kang YH, Kim SY, Yeom YI, Lee YH, Kim JH, et al: Overexpression and clinical significance of carcinoembryonic antigen-related cell adhesion molecule 6 in colorectal cancer. Clin Chim Acta. 415:12–19. 2013. View Article : Google Scholar : PubMed/NCBI

26 

Lewis-Wambi JS, Cunliffe HE, Kim HR, Willis AL and Jordan VC: Overexpression of CEACAM6 promotes migration and invasion of oestrogen-deprived breast cancer cells. Eur J Cancer. 44:1770–1779. 2008. View Article : Google Scholar : PubMed/NCBI

27 

Kobayashi M, Miki Y, Ebina M, Abe K, Mori K, Narumi S, Suzuki T, Sato I, Maemondo M, Endo C, et al: Carcinoembryonic antigen-related cell adhesion molecules as surrogate markers for EGFR inhibitor sensitivity in human lung adenocarcinoma. Br J Cancer. 107:1745–1753. 2012. View Article : Google Scholar : PubMed/NCBI

28 

Zang M, Zhang B, Zhang Y, Li J, Su L, Zhu Z, Gu Q, Liu B and Yan M: CEACAM6 promotes gastric cancer invasion and metastasis by inducing epithelial-mesenchymal transition via PI3K/AKT signaling pathway. PLos One. 9:e1129082014. View Article : Google Scholar : PubMed/NCBI

29 

Fan TJ, Han LH, Cong RS and Liang J: Caspase family proteases and apoptosis. Acta Biochim Biophys Sin (Shanghai). 37:719–727. 2005. View Article : Google Scholar : PubMed/NCBI

30 

Makler A and Asghar W: Exosomal biomarkers for cancer diagnosis and patient monitoring. Expert Rev Mol Diagn. 20:387–400. 2020. View Article : Google Scholar : PubMed/NCBI

31 

Deng Z, Wu J, Xu S, Chen F, Zhang Z, Jin A and Wang J: Exosomes-microRNAs interacted with gastric cancer and its microenvironment: A mini literature review. Biomark Med. 14:141–150. 2020. View Article : Google Scholar : PubMed/NCBI

32 

Duxbury MS, Ito H, Ashley SW and Whang EE: c-Src-dependent cross-talk between CEACAM6 and alphavbeta3 integrin enhances pancreatic adenocarcinoma cell adhesion to extracellular matrix components. Biochem Biophys Res Commun. 317:133–141. 2004. View Article : Google Scholar : PubMed/NCBI

Related Articles

Journal Cover

January-2022
Volume 23 Issue 1

Print ISSN: 1792-1074
Online ISSN:1792-1082

Sign up for eToc alerts

Recommend to Library

Copy and paste a formatted citation
x
Spandidos Publications style
Liu C, Wang M, Lv H, Liu B, Ya X, Zhao W and Wang W: CEACAM6 promotes cholangiocarcinoma migration and invasion by inducing epithelial‑mesenchymal transition through inhibition of the SRC/PI3K/AKT signaling pathway. Oncol Lett 23: 39, 2022.
APA
Liu, C., Wang, M., Lv, H., Liu, B., Ya, X., Zhao, W., & Wang, W. (2022). CEACAM6 promotes cholangiocarcinoma migration and invasion by inducing epithelial‑mesenchymal transition through inhibition of the SRC/PI3K/AKT signaling pathway. Oncology Letters, 23, 39. https://doi.org/10.3892/ol.2021.13157
MLA
Liu, C., Wang, M., Lv, H., Liu, B., Ya, X., Zhao, W., Wang, W."CEACAM6 promotes cholangiocarcinoma migration and invasion by inducing epithelial‑mesenchymal transition through inhibition of the SRC/PI3K/AKT signaling pathway". Oncology Letters 23.1 (2022): 39.
Chicago
Liu, C., Wang, M., Lv, H., Liu, B., Ya, X., Zhao, W., Wang, W."CEACAM6 promotes cholangiocarcinoma migration and invasion by inducing epithelial‑mesenchymal transition through inhibition of the SRC/PI3K/AKT signaling pathway". Oncology Letters 23, no. 1 (2022): 39. https://doi.org/10.3892/ol.2021.13157