Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Oncology Letters
Join Editorial Board Propose a Special Issue
Print ISSN: 1792-1074 Online ISSN: 1792-1082
Journal Cover
September-2025 Volume 30 Issue 3

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
September-2025 Volume 30 Issue 3

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML

  • Supplementary Files
    • Supplementary_Data.xlsx
Article Open Access

Transcriptomic analyses unveil the mechanism of saikosaponin A in inhibiting human neuroblastoma SK‑N‑AS cells

  • Authors:
    • Ning Gao
    • Jialin Sun
    • Wei Zhao
    • Lihui Duan
    • Hongyao Cai
    • Bo Liu
    • Yupeng Cheng
  • View Affiliations / Copyright

    Affiliations: Key Laboratory of Basic and Application Research of Beiyao, Heilongjiang University of Chinese Medicine, Ministry of Education, Harbin, Heilongjiang 150040, P.R. China, Department of Medicine, Heilongjiang Minzu College, Harbin, Heilongjiang 150066, P.R. China, School of Pharmaceutical Engineering, Heilongjiang Agricultural Reclamation Vocational College, Harbin, Heilongjiang 150025, P.R. China
    Copyright: © Gao et al. This is an open access article distributed under the terms of Creative Commons Attribution License.
  • Article Number: 419
    |
    Published online on: July 2, 2025
       https://doi.org/10.3892/ol.2025.15165
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

Neuroblastoma (NB) is the most common pediatric malignant neoplasm. Saikosaponin A (SSa), a compound with potential therapeutic effects against this disease, inhibits the proliferation, metastasis and invasion of NB cells. However, its molecular mechanism remains elusive. The present study examined changes in gene expression in SK‑N‑AS NB cells after SSa administration using RNA sequencing. Subsequently, Gene Ontology (GO), Kyoto Encyclopedia of Genes and Genomes (KEGG) and Search Tool for the Retrieval of Interacting Genes/Proteins were used to analyze the differentially expressed genes between the treatment and control groups. Quantitative PCR technology confirmed the expression of the identified critical genes. The results identified multiple significant biological processes, including 717 GO terms and 55 KEGG pathways, constructing a 96‑gene protein‑protein interaction network, with FN1 as the most relevant player in anti‑NB mechanisms. The activities of SSa against NB were closely related to the regulations of the following genes: IL24, EGR1, RET, MDK, PDGFRA, HGF, VCAM1, SLIT3, CD34, FN1, COL1A1 and NCAM1. Additionally, the PI3K‑Akt signaling pathway was downregulated in the KEGG enriched results. Therefore, the results of the present study improves the critical understanding of the anti‑NB mechanism of SSa and lays a foundation for its clinical application against NB.

Introduction

Neuroblastoma (NB) is a type of cancer of the sympathetic nervous system characterized by extracranial solid tumors that arise from neural crest cells, and accounts for ~15% of cancer-related deaths in children (1,2). The median age at diagnosis is low (~18 months) with a notable number of cases occurring in infants (<1 year old for 40% of all NB cases) (3,4). Furthermore, over half of patients with NB are classified as high-risk, which results in a low 5-year survival rate (<50%) (3,4). The current major treatments for NB include spontaneous tumor regression, surgery, chemotherapy, radiotherapy and immunotherapy. Although therapy advancements have notably raised survival rates, the prognosis varies by the risk level (3,5–7). Furthermore, relapse, drug resistance and long-term side effects remain significant challenges for the treatment and recovery of these patients (8,9). Therefore, exploring new therapeutic drugs is of great clinical and scientific significance.

Multiple bioactivities have been reported for saikosaponin A (SSa), an oleanane-type saponin derived from Bupleurum chinensis DC. These include antitumor properties, anti-inflammatory effects and liver protection (10,11). Previous studies have shown that the antitumor activities of SSa, including suppressing cell proliferation, inducing apoptosis and inhibiting metastasis and angiogenesis, span various cell types including liver, colon, breast and pancreatic cancer cells (12). Specifically, in human hepatoma cell lines, SSa exhibits an antiproliferative effect (13,14). Such an effect in the HepG2 cell line is correlated with ERK activation and the upregulation of certain genes (15,16). In human colon carcinoma cells, SSa induces apoptosis by activating caspase-4, followed by activating sequential caspase-2 and −8 (17,18). In breast cancer cells, SSa inhibits proliferation and induces apoptosis (19,20). In both in vitro and in vivo conditions, SSa suppresses the activation of Akt and STAT3, decreases the levels of glycolysis and blocks the energy supply (21). In pancreatic cancer, SSa inhibits proliferation and induces apoptosis, which may be related to the inactivation of the EGFR/PI3K/Akt pathway (22).

A study has shown that SSa inhibits the proliferation of NB cells by enhancing apoptosis (23). SSa decreases the expression of Bcl-2 and increases the expression of Bax while activating proteins such as caspase-9, caspase-7 and poly (ADP-ribose) polymerase (23). Furthermore, SSa stops NB cells from invading and migrating by blocking certain signals (such as VEGFR2, Src and Akt) and by regulating proteins connected with epithelial-mesenchymal transition (EMT) (23). However, the molecular mechanism of SSa against NB cell remains unclear. In the present study, human NB SK-N-AS cells were treated with SSa and the transcriptome expression profiles of these cells were analyzed using RNA-sequencing (seq) combined with bioinformatic methods. The differentially expressed genes (DEGs) were then verified by reverse transcription-quantitative PCR (RT-qPCR).

Materials and methods

Cell culture

The human SK-N-AS NB cell line was purchased from Heilongjiang Jiufeng Bioengineering Co., Ltd. The human SH-SY5Y NB cell line was purchased from Haixing Biosciences Co., Ltd. (Suzhou, China) and was authenticated by STR profiling. The human MO3.13 oligodendrocytic cell line (normal cells) was purchased from Cyagen Biosciences, Inc. These cells were initially cultured in Dulbecco's Modified Eagle Medium (DMEM; Gibco; Thermo Fisher Scientific, Inc.) containing 10% fetal bovine serum [FBS; Cellmax Cell Technology (Beijing) Co., Ltd.] and 1% penicillin-streptomycin (Gibco; Thermo Fisher Scientific, Inc.) in an incubator maintained at 37°C with a humidified environment of 5% CO2 and 95% air. Afterwards, cells were transferred every 2–3 days depending on their density, and experiments began once they achieved 80–90% confluency.

Cell viability assay

Cell viability was measured using the MTT assay following the protocol by Cheng and Ying (23). In brief, a cell suspension (SK-N-AS/SH-SY5Y/MO13.3) in DMEM containing 10% FBS (106 cells/ml) was inoculated into 96-well plates with 100 µl per well and cultured at 37°C for 24 h with 5% CO2 and 95% air. The cells were then treated with SSa (purity: HPLC ≥98%, Baoji Herbest Bio-Tech Co., Ltd.) at various concentrations [0 µM (control), 5, 10, 15, 20 and 25 µM] for 24 h. Following the treatment, 10 µl of MTT solution (5 mg/ml) was pipetted into each well, allowing the cells to incubate for an additional 4 h at 37°C. The medium was discarded and 100 µl of DMSO was added to each well to dissolve the purple formazan while the absorbance was measured at 490 nm using a Microplate Reader (RT-6000; Rayto Life and Analytical Sciences Co., Ltd.). Cell viability was calculated as follows: Cell viability=[OD490 (SSa)/OD490 (control)] ×100%.

Transwell migration and invasion assay

The methods were performed following the protocol by Cheng and Ying (23). In brief, SK-N-AS cells were digested and suspended in serum-free DMEM containing SSA (0 or 5 µM) at a final concentration of 106 cells/ml. For the invasion assay, 50 µl diluted Matrigel (Matrigel and serum-free DMEM were prepared at a ratio of 1:3 at 4°C) was added to the upper Transwell chamber (24-well; pore size, 8 µm; Corning, Inc.) and incubated at 37°C for 5 h. Subsequently, DMEM containing 20% FBS was added to the lower Transwell chamber. Subsequently, 100 µl of SK-N-AS cell suspension was plated in the upper chamber and incubated at 37°C for 24 h. The cells that invaded into the lower surface of the Transwell membrane were fixed with 100% methanol (room temperature for 30 min) and stained with 0.1% crystal violet (room temperature for 20 min). Stained cells were observed by fluorescence inverted microscopy (Leica Microsystems GmbH). A total of five random fields were imaged to calculate the relative invasion rates based on the ratio of the number of invaded cells in the SSa group to the control group. For the migration assay, all the steps were the same as in the invasion assay but without the addition of Matrigel.

RNA isolation and sequencing

To isolate RNA, ~4 ml of SK-N-AS cells (106 cells/ml) were seeded into a T25 flask. The cells were cultured for ~2 days at standard conditions (37°C for 48 h in humidified atmosphere of 5% CO2 and 95% air) before being divided into two groups and treated for another 24 h: Those receiving SSa treatment (n=3) were incubated in FBS-free DMEM containing 15 µM SSa, and those in the control group did not receive any substance addition (n=3). Post-treatment, total RNA extraction from the SN-K-AS cells was performed using TRIzol Reagent (Invitrogen; Thermo Fisher Scientific, Inc.). NanoDrop spectrophotometer-based measurements (Thermo Fisher Scientific, Inc.) confirmed the concentration and purity levels alongside LabChip GX Touch HT Nucleic Acid analysis (PerkinElmer, Inc.).

The collected RNA samples (a total of 6, 3 for SSa treatment and 3 for control) were then transported to Wuhan Boyue Zhihe Biotechnology Co., Ltd., where library construction and sequencing tasks employing KAPA Stranded RNA-Seq Kit protocols plus multiplexing primer guidance were undertaken. In brief, mRNA was enriched by oligo(dT) beads and sequencing results were obtained using NovaSeq™ 6000 systems (Illumina, Inc.).

Data analysis

Raw data (raw reads) were filtered into clean data (clean reads) using Trimmomatic v0.36 (24). This involved removing reads with adapters, reads containing ploy-N and low-quality reads from the raw data. Clean data were then aligned to the human reference genome (http://asia.ensembl.org/Homo_sapiens/Info/Index) using Hisat 2 (25). The number of perfect clean tags for each gene was calculated and normalized as fragments per kilo bases per million mapped reads using featureCounts v1.5.0 (26). DEGs were identified using the DESeq R package (1.10.1) (27), with the following criteria: Fold-change ≥1.5 or ≤0.667 and adjusted P<0.05 (28).

Gene Ontology (GO) enrichment analysis was conducted by Database for Annotation, Visualization, & Integrated Discovery (DAVID) to reveal the biological function of DEGs (29,30). Kyoto Encyclopedia of Genes and Genomes (KEGG) was utilized to analyze the metabolic and signaling pathways inherent in the DEGs; enrichment and network construction were performed by Metascape 3.5 (31,32). Protein-protein interaction (PPI) networks of putative proteins encoded by DEGs were constructed with STRING 12.0 (33).

Validation by RT-qPCR

Total RNA was isolated from SK-N-AS cells using the SV Total RNA Isolation System (Promega Corporation), then reverse transcribed into cDNA using the GoScript™ kit (Promega Corporation) according to the manufacturer's protocol. qPCR was employed to assess DEG expression using the LineGene 9620 qPCR system (Hangzhou Bioer Co., Ltd.) following the GoTaq® qPCR protocol (Promega Corporation). The primer sequences for amplifying the DEGs are listed in Table I. Relative gene expression level was calculated based on the 2−∆∆Cq method, with GAPDH as the internal control gene (34).

Table I.

Primer sequences used in reverse transcription-quantitative PCR.

Table I.

Primer sequences used in reverse transcription-quantitative PCR.

GeneForward primer (5′-3′)Reverse primer (5′-3′)
IL24 TTGCCTGGGTTTTACCCTGC AAGGCTTCCCACAGTTTCTGG
EGR1 GGTCAGTGGCCTAGTGAGC GTGCCGCTGAGTAAATGGGA
RET AAAGTGGCATTGGGCCTCTAC GCAGGGCATGGACGTACAG
MDK CGCGGTCGCCAAAAAGAAAG TACTTGCAGTCGGCTCCAAAC
PDGFRA TTGAAGGCAGGCACATTTACA GCGACAAGGTATAATGGCAGAAT
HGF GCTATCGGGGTAAAGACCTACA CGTAGCGTACCTCTGGATTGC
VCAM1 CAGTAAGGCAGGCTGTAAAAGA TGGAGCTGGTAGACCCTCG
SLIT3 GTCAGCGTCATCGAGAGAGG TTCGGCGTGCTCTGGAAAAG
CD34 ACCAGAGCTATTCCCAAAAGACC TGCGGCGATTCATCAGGAAAT
FN1 CGGTGGCTGTCAGTCAAAG AAACCTCGGCTTCCTCCATAA
COL1A1 GTGCGATGACGTGATCTGTGA CGGTGGTTTCTTGGTCGGT
NCAM1 GGCATTTACAAGTGTGTGGTTAC TTGGCGCATTCTTGAACATGA
GAPDH GGAGCGAGATCCCTCCAAAAT GGCTGTTGTCATACTTCTCATGG
Statistical analysis

Data are presented as mean ± standard deviation. Student's unpaired t-test and one-way analysis of variance with Dunnett's post hoc test were applied for the statistical analyses of the cell viability and qPCR results. Fisher's exact test was used for bioinformatic analysis. P<0.05 was considered to indicate a statistically significant difference. Statistical analysis was performed using SPSS 26.0 (IBM Corp.).

Results

Inhibitory effect of SSa on human NB cells

As depicted in Fig. 1A and B, after 24 h, SSa reduced the viability of human SK-N-AS and SH-SY5Y NB cells in a dose-dependent manner. The half maximal inhibitory concentration values for SSa in SK-N-AS and SH-SY5Y cells after 24 h were 14.5 and 15.8 µM, respectively. SSa had no inhibitory effect on normal MO3.13 cells at doses <25 µM (Fig. 1C). This indicated that SSa was cytotoxic to SK-N-AS and SH-SY5Y cells and was non-toxic to normal cells at the effective doses, which aligned with the results of a previous study (23). In subsequent experiments, 15 µM was selected for transcriptomic analysis.

Viability of cells treated with
various concentrations of SSa for 24 h. (A) Viability of the human
SK-N-AS NB cell line treated with SSa. (B) Viability of the human
SH-SY5Y NB cell line treated with SSa. (C) Viability of the human
MO3.13 oligodendrocytic cell line (normal cells) treated with SSa.
Data are displayed as the mean ± SD, n=6. *P<0.05, **P<0.01
vs. the 0 µM SSa group. NB, neuroblastoma; SSa, saikosaponin A.

Figure 1.

Viability of cells treated with various concentrations of SSa for 24 h. (A) Viability of the human SK-N-AS NB cell line treated with SSa. (B) Viability of the human SH-SY5Y NB cell line treated with SSa. (C) Viability of the human MO3.13 oligodendrocytic cell line (normal cells) treated with SSa. Data are displayed as the mean ± SD, n=6. *P<0.05, **P<0.01 vs. the 0 µM SSa group. NB, neuroblastoma; SSa, saikosaponin A.

Inhibitory effect of SSa on the migration and invasion of SK-N-AS cells

Transwell assays were performed to verify the inhibitory effect of SSa on the migration and invasion of SK-N-AS cells. To prevent interference from the inhibitory effect of SSa on SK-N-AS cell viability, a concentration of SSa (5 µM) was used in these assays. As shown in Fig. 2, SSa significantly inhibited the migration and invasion of SK-N-AS cells, consistent with previous literature (23).

Invasion and migration of SK-N-AS
cells treated with SSa for 24 h. (A) Transwell invasion assay
images (magnification, ×200) and the relative invasion rate of
SK-N-AS cells treated with SSa (0 and 5 µM). (B) Transwell
migration assay image (migration, ×200) and the relative migration
rate of SK-N-AS cells treated with SSa (0 and 5 µM). Data are
displayed as mean ± SD, n=3. *P<0.05 vs. the 0 µM SSa group.
SSa, saikosaponin A.

Figure 2.

Invasion and migration of SK-N-AS cells treated with SSa for 24 h. (A) Transwell invasion assay images (magnification, ×200) and the relative invasion rate of SK-N-AS cells treated with SSa (0 and 5 µM). (B) Transwell migration assay image (migration, ×200) and the relative migration rate of SK-N-AS cells treated with SSa (0 and 5 µM). Data are displayed as mean ± SD, n=3. *P<0.05 vs. the 0 µM SSa group. SSa, saikosaponin A.

DEGs of SK-N-AS cells in the treatment and control groups

RNA-Seq was carried out to analyze the transcriptomic profile of the SK-A-AS cell samples, producing means of 42.5 million and 46.9 million clean reads for the control group and SSa treatment group, respectively. The overall mapped rates of clean reads to the human reference genome in all samples ranged from 92.41 to 94.68% (Table II). Compared with the control group, there were 297 DEGs in the SSa treatment group; among these genes, 23 were upregulated while 274 were downregulated (Table SI). The volcano plot in Fig. 3A illustrates the DEGs between the SSa treatment and control groups; genes were arranged based on their log2 fold change value along the x-axis and their-log10 adjusted P-value along the y-axis. A hierarchical clustered heatmap was created to visualize the gene expression relationship patterns between the samples. The 3 samples from each group were clustered on the same branch, indicating that SSa treatment significantly changed the gene expression patterns in SK-N-AS cells (Fig. 3B).

Analysis of the DEGs between the SSa
treatment and control groups. (A) Volcano plot shows the expression
level of each gene. The x-axis represents the log2
fold-change of the gene expression and the y-axis the
represents-log10 P adj value. The red spots represent
significantly upregulated DEGs and the blue spots represent
significantly downregulated DEGs in the SSa treatment group
compared with the control group. (B) Heatmap shows the gene
expression pattern of each sample. The rows correspond to genes and
the columns correspond to samples. DEGs, differentially expressed
genes; SSa, saikosaponin A.

Figure 3.

Analysis of the DEGs between the SSa treatment and control groups. (A) Volcano plot shows the expression level of each gene. The x-axis represents the log2 fold-change of the gene expression and the y-axis the represents-log10 P adj value. The red spots represent significantly upregulated DEGs and the blue spots represent significantly downregulated DEGs in the SSa treatment group compared with the control group. (B) Heatmap shows the gene expression pattern of each sample. The rows correspond to genes and the columns correspond to samples. DEGs, differentially expressed genes; SSa, saikosaponin A.

Table II.

Alignment statistics of the reads aligned to the human reference genome.

Table II.

Alignment statistics of the reads aligned to the human reference genome.

SampleTotal clean readsTotal mapped readsUniquely mapped readsTotal mapped rate (%)
Control 141,986,28039,101,79336,821,95293.13
Control 239,422,62036,429,58034,329,29792.41
Control 346,085,67242,722,11240,263,78692.70
SSa 142,659,78639,484,61937,215,34992.56
SSa 239,815,27037,695,40135,546,19194.68
SSa 358,333,58854,581,16751,362,19093.57

[i] SSa, saikosaponin A.

GO enrichment results of the DEGs

GO annotation enrichment analyses within the DEGs were assessed to determine the significant biological function changes. A total of 717 GO terms were enriched including 610 biological processes, 59 cellular components and 48 molecular functions. In the biological process category, ‘cell adhesion’ (GO: 0007155), ‘biological adhesion’ (GO: 0022610), ‘neurogenesis’ (GO: 0022008), ‘extracellular matrix organization’ (GO: 0030198) and ‘extracellular structure organization’ (GO: 0043062) were the top five significantly enriched processes. Biological processes related to the antitumor activity of SSa on human NB cells were also enriched, such as ‘apoptotic process’ (GO: 0006915), ‘angiogenesis’ (GO: 0001525) and ‘epithelial to mesenchymal transition’ (GO: 0001837). In the molecular function category, ‘extracellular matrix structural component’ (GO: 0005201), ‘integrin binding’ (GO: 0005178), ‘glycosaminoglycan binding’ (GO: 0005539), ‘receptor binding’ (GO: 0005102) and ‘heparin binding’ (GO: 0008201) represented the major functions encompassed by the DEGs. Moreover, in the cellular component category, the DEGs primarily contributed to ‘extracellular matrix’ (GO: 0031012), ‘extracellular region’ (GO: 0005576), ‘extracellular region part’ (GO: 0044421), ‘cell surface’ (GO: 0009986) and ‘extracellular space’ (GO: 0005615). Fig. 4 illustrates the top 20 GO terms within each category.

Enrichment results of the Gene
Ontology terms associated with differentially expressed genes
between the saikosaponin A treatment and control group.

Figure 4.

Enrichment results of the Gene Ontology terms associated with differentially expressed genes between the saikosaponin A treatment and control group.

KEGG pathway enrichment results of the DEGs

The metabolic and signaling pathways contributing to SSa inhibition of SK-N-AS cells were also analyzed using the KEGG database. The results showed that the DEGs were enriched in 55 KEGG pathways (Table SII). Pathways related to the invasion and migration of cancerous cells were significantly enriched, such as ‘ECM-receptor interaction’ (hsa04512), ‘Focal adhesion’ (hsa04510) and ‘Cell adhesion molecules’ (hsa04514). In addition, 14 pathways belonged to signal transduction and 7 pathways were related to cancer. The signaling pathways included ‘PI3K-Akt signaling pathway’ (hsa04151), ‘TNF signaling pathway’ (hsa04668) and ‘Apelin signaling pathway’ (hsa04371). Cancer-related pathways included Metabolism of central carbon in cancer (hsa05230), ‘Proteoglycans in cancer’ (hsa05205) and Non-small cell lung cancer (hsa05223). Other pathways mainly encompassed human disease and metabolic pathways. The top 20 significantly enriched pathways are shown in Fig. 5A, with connections among the enriched pathways shown as a network in Fig. 5B.

Enrichment results of the Kyoto
Encyclopedia of Genes and Genomes pathway analysis involving
differentially expressed genes between the saikosaponin A treatment
and control groups. (A) Bubble diagram of the top 20 significantly
enriched pathways. (B) Network diagram illustrating the connections
among the enriched pathways.

Figure 5.

Enrichment results of the Kyoto Encyclopedia of Genes and Genomes pathway analysis involving differentially expressed genes between the saikosaponin A treatment and control groups. (A) Bubble diagram of the top 20 significantly enriched pathways. (B) Network diagram illustrating the connections among the enriched pathways.

PPI networks based on the products of the DEGs

The list of gene symbols was submitted to the STRING database to construct the PPI network of putative proteins encoded by the DEGs, with ‘organisms’ set to Homo sapiens and the ‘minimum required interaction score’ set to high confidence. As shown in Fig. 6, the largest network contained 98 nodes and 201 edges, while 139 isolated nodes without any connections were hidden. Genes such as FN1, COL1A1, DDX58, PTPRC, THBS1, CCL2, IFIH1, IL1B, MX1 and VCAM1 ranked among the 10 most-connected genes and acted as hubs in the network. A total of 29 clusters were obtained based on Markov clustering, with the largest cluster containing 21 genes whose functions mainly referred to cell adhesion (hsa04512, hsa04514, hsa04510, GO:0007155, GO:0030155 and GO:0016477).

Protein-protein interaction network
of differentially expressed genes between the saikosaponin A
treatment and control groups, with the four largest clusters based
on the Markov clustering shown on the right.

Figure 6.

Protein-protein interaction network of differentially expressed genes between the saikosaponin A treatment and control groups, with the four largest clusters based on the Markov clustering shown on the right.

Confirmation of transcriptomic sequencing with qPCR

To verify the transcriptomic sequencing results, genes related to the SSa inhibition of SK-N-AS cells were determined by qPCR. These genes included IL24, EGR1, RET, MDK, PDGFRA, HGF, VCAM1, SLIT3, CD34, FN1, COL1A1 and NCAM1. In the group treated with SSa, certain gene expression levels increased (IL24 and EGR1) or decreased (RET, MDK, PDGFRA, HGF, VCAM1, SLIT3, CD34, FN1, COL1A1 and NCAM1) significantly compared with the control group (Fig. 7). Therefore, the RNA-seq and qPCR data were consistent.

Relative expression levels of
candidate genes validated by reverse transcription-quantitative
PCR. Data is shown as mean ± SD, n=6 for all groups. **P<0.01
vs. control group. SSa, saikosaponin A.

Figure 7.

Relative expression levels of candidate genes validated by reverse transcription-quantitative PCR. Data is shown as mean ± SD, n=6 for all groups. **P<0.01 vs. control group. SSa, saikosaponin A.

Discussion

SSa is one of the main active components of Bupleurum chinensis DC (10,11). In the present study, the antitumor activity of SSa on human NB cells (SK-N-AS and SH-SY5Y) and the absence of SSa inhibition on normal cells (MO3.13) was verified at the effective concentrations, indicating its safety. The inhibitory effects of SSa on SK-N-AS migration and invasion were also confirmed by Transwell assay. Furthermore, RNA-seq was performed in conjunction with bioinformatics analysis, which revealed the molecular mechanism underlying the antitumor effects of SSa against NB at the mRNA level. As shown in the GO enrichment results, DEGs involved in apoptosis were enriched under the GO term GO:0006915 (apoptosis). The RNA-seq results alongside the qPCR verification indicated that the upregulated genes were IL24 and EGR1 and the downregulated genes were RET and MDK, which was consistent with the apoptosis pathway detected following GO enrichment, as indicated in previous studies (35–39). These results suggested that SSa may be an inhibitor of RET and MDK expression, and hence against NB. Notably, RET has been shown to be expressed in numerous NB cells (40), and its activation inhibits apoptosis in NB cells (38). RET inhibition is a promising antitumor therapeutic strategy and drugs targeting RET have shown promising effects in NB (41,42). As to MDK, some therapeutic strategies aimed at inhibiting MDK expression have also shown promising antitumor effects (43–45). In NB, increased MDK levels are correlated with an unfavorable prognosis, and reducing MDK expression may serve as an effective strategy for NB treatment (39).

In the present study, DEGs linked to angiogenesis were enriched under the GO term GO:0001525 (angiogenesis). The RNA-seq results alongside the qPCR verification indicated that the downregulated genes were PDGFRA, HGF, VCAM1, SLIT3 and CD34 after SSa treatment, which was consistent with the angiogenesis pathway detected in the GO enrichment, as suggested in previous studies (46–50). SSa could inhibit angiogenesis in NB by targeting the PDGFRA and HGF genes (and thus HGF/c-MET signaling). Notably, upregulation of PDGFRA has been observed in a number of malignancies and is associated with poor prognosis (51,52). Additionally, HGF promotes angiogenesis in NB and reports suggest that inhibiting the HGF/c-MET signaling pathway may have therapeutic effects against neuroblastoma (47,53). Meanwhile, VCAM1 and SLIT3 may be proangiogenic factors (48,54), and CD34 has been used as a marker in immunohistochemistry to assess angiogenesis in tumors (50,55). However, the roles of VCAM1, SLIT3 and CD34 in the tumorigenesis of NB are currently unknown. In addition, the PI3K-Akt signaling pathway was downregulated according to the KEGG enrichment results obtained in the present study. This pathway influences angiogenesis by activating multiple angiogenic factors and its activation involves both PDGFRA and HGF (56,57). These findings suggest that SSa may suppress angiogenesis by inhibiting the PI3K-Akt signaling pathway, consistent with previous reports (22,23). The results of the present study also showed that after SSa treatment, the ECM-receptor interaction (hsa04512) in NB cells was the most significantly enriched KEGG pathway, which is closely linked to angiogenesis (GO:0001525). This ECM-receptor interaction pathway participates in the regulation of EMT progression, which is critical for metastasis (58). The expression levels of the FN1, COL1A1 and NCAM1 genes are all related to the EMT process (59–61).

In the present study, the PPI network results showed that the proteins in the extracellular matrix (FN1 and COL1A1) were the most connected proteins. Meanwhile, the RNA-seq results alongside the qPCR verification showed that the corresponding FN1 and COL1A1 genes were both downregulated in the treatment group. These results suggest that SSa could inhibit the metastasis-related EMT process by targeting FN1 and COL1A1. The PPI network analysis also demonstrated that the largest protein cluster primarily encompassed cell adhesion. Consistently, the RNA-seq results alongside the qPCR verification showed that after SSa treatment, the cell adhesion molecule gene, NCAM1, was downregulated in NB cells. Therefore, SSa could inhibit the metastasis-related EMT process by suppressing the expression of NCAM1. Notably, the FN1 and COL1A1 proteins (and the corresponding genes) could be potential targets for cancer treatment (62–64), with NCAM1 more specifically for NB (65,66).

There are certain limitations of the present study. The present study only focused on the impact of SSa on SK-N-AS cells. Given the varying genetic makeup of different NB cells (2), further research is needed to determine whether the findings can be generalized to other NB cells. The present study elucidated the mechanism of SSa against NB at the transcriptional level. However, examination at the protein level is equally crucial for the determining the antitumor activity of the drug. Taking the aforementioned PI3K-Akt signaling pathway as an example, in addition to expression levels, the phosphorylation status of core proteins also plays a vital role in pathway activation. Therefore, further investigation is warranted to gain deeper insights into the molecular mechanisms underlying the anti-neuroblastoma effects of SSa. Additionally, subsequent animal studies should be performed to facilitate the clinical translation of SSA for neuroblastoma treatment.

In conclusion, the results of the present study showed that SSa significantly inhibited the viability, migration and invasion of SK-N-AS NB cells within 24 h. SSa likely induced apoptosis in SK-N-AS cells by upregulating IL24 and EGR1 and downregulating RET and MDK expression. SSa may have anti-angiogenesis effects through downregulating PDGFRA, HGF, VCAM1, SLIT3 and CD34. SSa may suppress metastasis by inhibiting EMT through downregulating FN1 (central hub), COL1A1 and NCAM1 expression as well as downregulating the PI3K-Akt signaling pathway. Therefore, the present study provided an in-depth comprehension of the molecular processes and signal transduction pathways driving the effects of SSa against NB through RNA-seq and bioinformatics analyses. However, the specific role of the relevant genes in the anti-NB process of SSa and the direct target of SSa still needs further investigation. These findings suggest that SSa can be a potential therapeutic agent for NB.

Supplementary Material

Supporting Data

Acknowledgements

Not applicable.

Funding

This work was supported by the National Natural Science Foundation of China (grant nos. 81503271 and 81573539), University Nursing Program for Young Scholars with Creative Talents in Heilongjiang Province (grant no. UNPYSCT-2017217) and the Heilongjiang Touyan Innovation Team Program [grant no. (2019) No. 5].

Availability of data and materials

The RNA-seq data generated in the present study may be found in the Sequence Read Archive database under accession no. PRJNA1158969 or at the following URL: https://www.ncbi.nlm.nih.gov/bioproject/PRJNA1158969. All other data generated in the present study may be requested from the corresponding author.

Authors' contributions

NG was responsible for study design and contributed to data interpretation. WZ, LD and HC performed the experiments. JS, BL and YC analyzed the data and modified the manuscript. BL and YC confirm the authenticity of all the raw data. All authors read and approved the final version of the manuscript.

Ethics approval and consent to participate

Not applicable.

Patient consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

References

1 

Zafar A, Wang W, Liu G, Xian W, McKeon F, Zhou J and Zhang R: Targeting the p53-MDM2 pathway for neuroblastoma therapy: Rays of hope. Cancer Lett. 496:16–29. 2021. View Article : Google Scholar : PubMed/NCBI

2 

Bansal M, Gupta A and Ding HF: MYCN and metabolic reprogramming in neuroblastoma. Cancers (Basel). 14:41132022. View Article : Google Scholar : PubMed/NCBI

3 

Zafar A, Wang W, Liu G, Wang X, Xian W, McKeon F, Foster J, Zhou J and Zhang R: Molecular targeting therapies for neuroblastoma: Progress and challenges. Med Res Rev. 41:961–1021. 2021. View Article : Google Scholar : PubMed/NCBI

4 

Lundberg KI, Treis D and Johnsen JI: Neuroblastoma heterogeneity, plasticity, and emerging therapies. Curr Oncol Rep. 24:1053–1062. 2022. View Article : Google Scholar : PubMed/NCBI

5 

Lin L, Miao L, Lin H, Cheng J, Li M, Zhuo Z and He J: Targeting RAS in neuroblastoma: Is it possible? Pharmacol Ther. 236:1080542022. View Article : Google Scholar : PubMed/NCBI

6 

Qiu B and Matthay KK: Advancing therapy for neuroblastoma. Nat Rev Clin Oncol. 19:515–533. 2022. View Article : Google Scholar : PubMed/NCBI

7 

Whittle SB, Smith V, Doherty E, Zhao S, McCarty S and Zage PE: Overview and recent advances in the treatment of neuroblastoma. Expert Rev Anticancer Ther. 17:369–386. 2017. View Article : Google Scholar : PubMed/NCBI

8 

Rivera Z, Escutia C, Madonna MB and Gupta KH: Biological insight and recent advancement in the treatment of neuroblastoma. Int J Mol Sci. 24:84702023. View Article : Google Scholar : PubMed/NCBI

9 

Gao J, Fosbrook C, Gibson J, Underwood TJ, Gray JC and Walters ZS: Review: Targeting EZH2 in neuroblastoma. Cancer Treat Rev. 119:1026002023. View Article : Google Scholar : PubMed/NCBI

10 

Li X, Li X, Huang N, Liu R and Sun R: A comprehensive review and perspectives on pharmacology and toxicology of saikosaponins. Phytomedicine. 50:73–87. 2018. View Article : Google Scholar : PubMed/NCBI

11 

Li XQ, Song YN, Wang SJ, Rahman K, Zhu JY and Zhang H: Saikosaponins: A review of pharmacological effects. J Asian Nat Prod Res. 20:399–411. 2018. View Article : Google Scholar : PubMed/NCBI

12 

Xiao LX, Zhou HN and Jiao ZY: Present and future prospects of the anti-cancer activities of saikosaponins. Curr Cancer Drug Targets. 23:2–14. 2022.PubMed/NCBI

13 

Motoo Y and Sawabu N: Antitumor effects of saikosaponins, baicalin and baicalein on human hepatoma cell lines. Cancer Lett. 86:91–95. 1994. View Article : Google Scholar : PubMed/NCBI

14 

Qian L, Murakami T, Kimura Y, Takahashi M and Okita K: Saikosaponin A-induced cell death of a human hepatoma cell line (HuH-7): The significance of the ‘sub-G1 peak’ in a DNA histo. Pathol Int. 45:207–214. 1995. View Article : Google Scholar : PubMed/NCBI

15 

Wen-Sheng W: ERK signaling pathway is involved in p15INK4b/p16INK4a expression and HepG2 growth inhibition triggered by TPA and saikosaponin A. Oncogene. 22:955–963. 2003. View Article : Google Scholar : PubMed/NCBI

16 

Wu WS and Hsu HY: Involvement of p-15(INK4b) and p-16(INK4a) gene expression in saikosaponin a and TPA-induced growth inhibition of HepG2 cells. Biochem Biophys Res Commun. 285:183–187. 2001. View Article : Google Scholar : PubMed/NCBI

17 

Kang SJ, Lee YJ, Kang SG, Cho S, Yoon W, Lim JH, Min SH, Lee TH and Kim BM: Caspase-4 is essential for saikosaponin a-induced apoptosis acting upstream of caspase-2 and γ-H2AX in colon cancer cells. Oncotarget. 8:100433–100448. 2017. View Article : Google Scholar : PubMed/NCBI

18 

Kim BM and Hong SH: Sequential caspase-2 and caspase-8 activation is essential for saikosaponin a-induced apoptosis of human colon carcinoma cell lines. Apoptosis. 16:184–197. 2011. View Article : Google Scholar : PubMed/NCBI

19 

Chen JC, Chang NW, Chung JG and Chen KC: Saikosaponin-A induces apoptotic mechanism in human breast MDA-MB-231 and MCF-7 cancer cells. Am J Chin Med. 31:363–377. 2003. View Article : Google Scholar : PubMed/NCBI

20 

Zhao X, Liu J, Ge S, Chen C, Li S, Wu X, Feng X, Wang Y and Cai D: Saikosaponin A inhibits breast cancer by regulating Th1/Th2 balance. Front Pharmacol. 10:6242019. View Article : Google Scholar : PubMed/NCBI

21 

Zhang Y, Dai K, Xu D, Fan H, Ji N, Wang D, Zhao Y and Liu R: Saikosaponin A alleviates glycolysis of breast cancer cells through repression of Akt/STAT3 pathway. Chem Biol Drug Des. 102:115–125. 2023. View Article : Google Scholar : PubMed/NCBI

22 

Shi C, Sun L, Fang R, Zheng S, Yu M and Li Q: Saikosaponin-A exhibits antipancreatic cancer activity by targeting the EGFR/PI3K/Akt pathway. Curr Pharm Biotechnol. 24:579–588. 2023. View Article : Google Scholar : PubMed/NCBI

23 

Cheng T and Ying M: Antitumor effect of Saikosaponin A on human neuroblastoma cells. Biomed Res Int. 2021:58455542021. View Article : Google Scholar : PubMed/NCBI

24 

Bolger AM, Lohse M and Usadel B: Trimmomatic: A flexible trimmer for illumina sequence data. Bioinformatics. 30:2114–2120. 2014. View Article : Google Scholar : PubMed/NCBI

25 

Kim D, Paggi JM, Park C, Bennett C and Salzberg SL: Graph-based genome alignment and genotyping with HISAT2 and HISAT-genotype. Nat Biotechnol. 37:907–915. 2019. View Article : Google Scholar : PubMed/NCBI

26 

Liao Y, Smyth GK and Shi W: featureCounts: An efficient general purpose program for assigning sequence reads to genomic features. Bioinformatics. 30:923–930. 2014. View Article : Google Scholar : PubMed/NCBI

27 

Anders S and Huber W: Differential expression analysis for sequence count data. Genome Biol. 11:R1062010. View Article : Google Scholar : PubMed/NCBI

28 

Robinson MD, McCarthy DJ and Smyth GK: EdgeR: A Bioconductor package for differential expression analysis of digital gene expression data. Bioinformatics. 26:139–140. 2010. View Article : Google Scholar : PubMed/NCBI

29 

Gene Ontology Consortium, . Aleksander SA, Balhoff J, Carbon S, Cherry JM, Drabkin HJ, Ebert D, Feuermann M, Gaudet P, Harris NL, et al: The gene ontology knowledgebase in 2023. Genetics. 224:iyad0312023. View Article : Google Scholar : PubMed/NCBI

30 

Sherman BT, Hao M, Qiu J, Jiao X, Baseler MW, Lane HC, Imamichi T and Chang W: DAVID: A web server for functional enrichment analysis and functional annotation of gene lists (2021 update). Nucleic Acids Res. 50:W216–W221. 2022. View Article : Google Scholar : PubMed/NCBI

31 

Kanehisa M, Furumichi M, Sato Y, Kawashima M and Ishiguro-Watanabe M: KEGG for taxonomy-based analysis of pathways and genomes. Nucleic Acids Res. 51:D587–D592. 2023. View Article : Google Scholar : PubMed/NCBI

32 

Zhou Y, Zhou B, Pache L, Chang M, Khodabakhshi AH, Tanaseichuk O, Benner C and Chanda SK: Metascape provides a biologist-oriented resource for the analysis of systems-level datasets. Nat Commun. 10:15232019. View Article : Google Scholar : PubMed/NCBI

33 

Szklarczyk D, Gable AL, Lyon D, Junge A, Wyder S, Huerta-Cepas J, Simonovic M, Doncheva NT, Morris JH, Bork P, et al: STRING v11: Protein-protein association networks with increased coverage, supporting functional discovery in genome-wide experimental datasets. Nucleic Acids Res. 47:D607–D613. 2019. View Article : Google Scholar : PubMed/NCBI

34 

Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(−Delta Delta C(T)) method. Methods. 25:402–408. 2001. View Article : Google Scholar : PubMed/NCBI

35 

Pignatelli M, Luna-Medina R, Pérez-Rendón A, Santos A and Perez-Castillo A: The transcription factor early growth response factor-1 (EGR-1) promotes apoptosis of neuroblastoma cells. Biochem J. 373:739–746. 2003. View Article : Google Scholar : PubMed/NCBI

36 

Cibelli G, Policastro V, Rössler OG and Thiel G: Nitric oxide-induced programmed cell death in human neuroblastoma cells is accompanied by the synthesis of Egr-1, a zinc finger transcription factor. J Neurosci Res. 67:450–460. 2002. View Article : Google Scholar : PubMed/NCBI

37 

Li Y, Zhang H, Zhu X, Feng D, Gong J and Han T: Interleukin-24 induces neuroblastoma SH-SY5Y cell differentiation, growth inhibition, and apoptosis by promoting ROS production. J Interferon Cytokine Res. 33:709–714. 2013. View Article : Google Scholar : PubMed/NCBI

38 

Skinner MA, Lackey KE and Freemerman AJ: RET activation inhibits doxorubicin-induced apoptosis in SK-N-MC cells. Anticancer Res. 28:2019–2025. 2008.PubMed/NCBI

39 

Kishida S and Kadomatsu K: Involvement of midkine in neuroblastoma tumourigenesis. Br J Pharmacol. 171:896–904. 2014. View Article : Google Scholar : PubMed/NCBI

40 

Futami H and Sakai R: RET protein promotes non-adherent growth of NB-39-nu neuroblastoma cell line. Cancer Sci. 100:1034–1039. 2009. View Article : Google Scholar : PubMed/NCBI

41 

Steen EA, Basilaia M, Kim W, Getz T, Gustafson JL and Zage PE: Targeting the RET tyrosine kinase in neuroblastoma: A review and application of a novel selective drug design strategy. Biochem Pharmacol. 216:1157512023. View Article : Google Scholar : PubMed/NCBI

42 

Ishida M, Ichihara M, Mii S, Jijiwa M, Asai N, Enomoto A, Kato T, Majima A, Ping J, Murakumo Y and Takahashi M: Sprouty2 regulates growth and differentiation of human neuroblastoma cells through RET tyrosine kinase. Cancer Sci. 98:815–821. 2007. View Article : Google Scholar : PubMed/NCBI

43 

Erdogan S, Doganlar ZB, Doganlar O, Turkekul K and Serttas R: Inhibition of midkine suppresses prostate cancer CD133+ stem cell growth and migration. Am J Med Sci. 354:299–309. 2017. View Article : Google Scholar : PubMed/NCBI

44 

Hao H, Maeda Y, Fukazawa T, Yamatsuji T, Takaoka M, Bao XH, Matsuoka J, Okui T, Shimo T, Takigawa N, et al: Inhibition of the growth factor MDK/midkine by a novel small molecule compound to treat non-small cell lung cancer. PLoS One. 8:e710932013. View Article : Google Scholar : PubMed/NCBI

45 

Han X, Li M, Xu J, Fu J, Wang X, Wang J, Xia T, Wang S and Ma G: miR-1275 targets MDK/AKT signaling to inhibit breast cancer chemoresistance by lessening the properties of cancer stem cells. Int J Biol Sci. 19:89–103. 2023. View Article : Google Scholar : PubMed/NCBI

46 

Hou Y, Du W, Wu Q, Chai X, Wang Y, Mi Y, Tian Y, Tang M, Li J and Yan D: PDGFRA exhibits potential as an indicator of angiogenesis within the tumor microenvironment and is up-regulated in BLCA. Microvasc Res. 151:1046142024. View Article : Google Scholar : PubMed/NCBI

47 

Daudigeos-Dubus E, LeDret L, Bawa O, Opolon P, Vievard A, Villa I, Bosq J, Vassal G and Geoerger B: Dual inhibition using cabozantinib overcomes HGF/MET signaling mediated resistance to pan-VEGFR inhibition in orthotopic and metastatic neuroblastoma tumors. Int J Oncol. 50:203–211. 2017. View Article : Google Scholar : PubMed/NCBI

48 

Xiang X, Pathak JL, Wu W, Li J, Huang W, Wu Q, Xin M, Wu Y, Huang Y, Ge L and Zeng S: Human serum-derived exosomes modulate macrophage inflammation to promote VCAM1-mediated angiogenesis and bone regeneration. J Cell Mol Med. 27:1131–1143. 2023. View Article : Google Scholar : PubMed/NCBI

49 

Yallowitz AR, Shim JH, Xu R and Greenblatt MB: An angiogenic approach to osteoanabolic therapy targeting the SHN3-SLIT3 pathway. Bone. 172:1167612023. View Article : Google Scholar : PubMed/NCBI

50 

Sasano H and Suzuki T: Pathological evaluation of angiogenesis in human tumor. Biomed Pharmacother. 59 (Suppl 2):S334–S336. 2005. View Article : Google Scholar : PubMed/NCBI

51 

Lin LH, Lin JS, Yang CC, Cheng HW, Chang KW and Liu CJ: Overexpression of platelet-derived growth factor and its receptor are correlated with oral tumorigenesis and poor prognosis in oral squamous cell carcinoma. Int J Mol Sci. 21:23602020. View Article : Google Scholar : PubMed/NCBI

52 

Wei T, Zhang LN, Lv Y, Ma XY, Zhi L, Liu C, Ma F and Zhang XF: Overexpression of platelet-derived growth factor receptor alpha promotes tumor progression and indicates poor prognosis in hepatocellular carcinoma. Oncotarget. 5:10307–10317. 2014. View Article : Google Scholar : PubMed/NCBI

53 

Hecht M, Papoutsi M, Tran HD, Wilting J and Schweigerer L: Hepatocyte growth factor/c-Met signaling promotes the progression of experimental human neuroblastomas. Cancer Res. 64:6109–6118. 2004. View Article : Google Scholar : PubMed/NCBI

54 

Paul JD, Coulombe KLK, Toth PT, Zhang Y, Marsboom G, Bindokas VP, Smith DW, Murry CE and Rehman J: SLIT3-ROBO4 activation promotes vascular network formation in human engineered tissue and angiogenesis in vivo. J Mol Cell Cardiol. 64:124–131. 2013. View Article : Google Scholar : PubMed/NCBI

55 

Liu H and Zhao KY: Application of CD34 expression combined with three-phase dynamic contrast-enhanced computed tomography scanning in preoperative staging of gastric cancer. World J Gastrointest Surg. 15:2513–2524. 2023. View Article : Google Scholar : PubMed/NCBI

56 

Mei Y, Wang Z, Zhang L, Zhang Y, Li X, Liu H, Ye J and You H: Regulation of neuroblastoma differentiation by forkhead transcription factors FOXO1/3/4 through the receptor tyrosine kinase PDGFRA. Proc Natl Acad Sci USA. 109:4898–4903. 2012. View Article : Google Scholar : PubMed/NCBI

57 

Moosavi F, Giovannetti E, Peters GJ and Firuzi O: Combination of HGF/MET-targeting agents and other therapeutic strategies in cancer. Crit Rev Oncol Hematol. 160:1032342021. View Article : Google Scholar : PubMed/NCBI

58 

An Q, Liu T, Wang MY, Yang YJ, Zhang ZD, Lin ZJ and Yang B: CircKRT7-miR-29a-3p-COL1A1 axis promotes ovarian cancer cell progression. Onco Targets Ther. 13:8963–8976. 2020. View Article : Google Scholar : PubMed/NCBI

59 

Dehghan MH, Ashrafi MR, Hedayati M, Shivaee S and Rajabi S: Oral contraceptive steroids promote papillary thyroid cancer metastasis by targeting angiogenesis and epithelial-mesenchymal transition. Int J Mol Cell Med. 10:219–226. 2021.PubMed/NCBI

60 

Li X, Sun X, Kan C, Chen B, Qu N, Hou N, Liu Y and Han F: COL1A1: A novel oncogenic gene and therapeutic target in malignancies. Pathol Res Pract. 236:1540132022. View Article : Google Scholar : PubMed/NCBI

61 

Li J, Yang R, Yang H, Chen S, Wang L, Li M, Yang S, Feng Z and Bi J: NCAM regulates the proliferation, apoptosis, autophagy, EMT, and migration of human melanoma cells via the Src/Akt/mTOR/cofilin signaling pathway. J Cell Biochem. 121:1192–1204. 2020. View Article : Google Scholar : PubMed/NCBI

62 

Zhou Y, Cao G, Cai H, Huang H and Zhu X: The effect and clinical significance of FN1 expression on biological functions of gastric cancer cells. Cell Mol Biol (Noisy-le-grand). 66:191–198. 2020. View Article : Google Scholar : PubMed/NCBI

63 

Cao M, Xiao D and Ding X: The anti-tumor effect of ursolic acid on papillary thyroid carcinoma via suppressing fibronectin-1. Biosci Biotechnol Biochem. 84:2415–2424. 2020. View Article : Google Scholar : PubMed/NCBI

64 

Ding Y, Zhang M, Hu S, Zhang C, Zhou Y, Han M, Li J, Li F, Ni H, Fang S and Chen Q: MiRNA-766-3p inhibits gastric cancer via targeting COL1A1 and regulating PI3K/AKT signaling pathway. J Cancer. 15:990–998. 2024. View Article : Google Scholar : PubMed/NCBI

65 

Markovsky E, Eldar-Boock A, Ben-Shushan D, Baabur-Cohen H, Yeini E, Pisarevsky E, Many A, Aviel-Ronen S, Barshack I and Satchi-Fainaro R: Targeting NCAM-expressing neuroblastoma with polymeric precision nanomedicine. J Control Release. 249:162–172. 2017. View Article : Google Scholar : PubMed/NCBI

66 

Heinly BE and Grant CN: Cell adhesion molecules in neuroblastoma: Complex roles, therapeutic potential. Front Oncol. 12:7821862022. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Gao N, Sun J, Zhao W, Duan L, Cai H, Liu B and Cheng Y: Transcriptomic analyses unveil the mechanism of saikosaponin A in inhibiting human neuroblastoma SK‑N‑AS cells. Oncol Lett 30: 419, 2025.
APA
Gao, N., Sun, J., Zhao, W., Duan, L., Cai, H., Liu, B., & Cheng, Y. (2025). Transcriptomic analyses unveil the mechanism of saikosaponin A in inhibiting human neuroblastoma SK‑N‑AS cells. Oncology Letters, 30, 419. https://doi.org/10.3892/ol.2025.15165
MLA
Gao, N., Sun, J., Zhao, W., Duan, L., Cai, H., Liu, B., Cheng, Y."Transcriptomic analyses unveil the mechanism of saikosaponin A in inhibiting human neuroblastoma SK‑N‑AS cells". Oncology Letters 30.3 (2025): 419.
Chicago
Gao, N., Sun, J., Zhao, W., Duan, L., Cai, H., Liu, B., Cheng, Y."Transcriptomic analyses unveil the mechanism of saikosaponin A in inhibiting human neuroblastoma SK‑N‑AS cells". Oncology Letters 30, no. 3 (2025): 419. https://doi.org/10.3892/ol.2025.15165
Copy and paste a formatted citation
x
Spandidos Publications style
Gao N, Sun J, Zhao W, Duan L, Cai H, Liu B and Cheng Y: Transcriptomic analyses unveil the mechanism of saikosaponin A in inhibiting human neuroblastoma SK‑N‑AS cells. Oncol Lett 30: 419, 2025.
APA
Gao, N., Sun, J., Zhao, W., Duan, L., Cai, H., Liu, B., & Cheng, Y. (2025). Transcriptomic analyses unveil the mechanism of saikosaponin A in inhibiting human neuroblastoma SK‑N‑AS cells. Oncology Letters, 30, 419. https://doi.org/10.3892/ol.2025.15165
MLA
Gao, N., Sun, J., Zhao, W., Duan, L., Cai, H., Liu, B., Cheng, Y."Transcriptomic analyses unveil the mechanism of saikosaponin A in inhibiting human neuroblastoma SK‑N‑AS cells". Oncology Letters 30.3 (2025): 419.
Chicago
Gao, N., Sun, J., Zhao, W., Duan, L., Cai, H., Liu, B., Cheng, Y."Transcriptomic analyses unveil the mechanism of saikosaponin A in inhibiting human neuroblastoma SK‑N‑AS cells". Oncology Letters 30, no. 3 (2025): 419. https://doi.org/10.3892/ol.2025.15165
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team