Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Oncology Reports
Join Editorial Board Propose a Special Issue
Print ISSN: 1021-335X Online ISSN: 1791-2431
Journal Cover
March 2013 Volume 29 Issue 3

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
March 2013 Volume 29 Issue 3

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Suppression of TPA-induced tumor cell invasion by sulfuretin via inhibition of NF-κB-dependent MMP-9 expression

  • Authors:
    • Jeong-Mi Kim
    • Eun-Mi Noh
    • Kang-Beom Kwon
    • Jong-Suk Kim
    • Yong-Ouk You
    • Jin-Ki Hwang
    • Bo-Mi Hwang
    • Min Seuk Kim
    • Seung-Jin Lee
    • Sung-Hoo Jung
    • Hyun-Jo Youn
    • Eun-Yong Chung
    • Young-Rae Lee
  • View Affiliations / Copyright

    Affiliations: Center for Metabolic Function Regulation, Wonkwang University School of Medicine, Iksan 570-749, Republic of Korea, Department of Biochemistry, Institute of Medical Science, Chonbuk National University Medical School, Jeonju 560-182, Republic of Korea, Department of Oral Biochemistry, School of Dentistry, Wonkwang University, Iksan 570-749, Republic of Korea, Laboratory of Oral Physiology, College of Dentistry, Wonkwang University, Iksan 570-749, Republic of Korea, Department of Pharmacy, College of Pharmacy, Ewha Womans University, Seoul 120-808, Republic of Korea, Division of Breast, Thyroid Surgery, Department of Surgery, Chonbuk National University Medical School, Jeonju 560-756, Republic of Korea, Department of Anesthesiology and Pain Medicine, Bucheon St. Mary's Hospital, The Catholic University of Korea, Bucheon 420-717, Republic of Korea
  • Pages: 1231-1237
    |
    Published online on: December 28, 2012
       https://doi.org/10.3892/or.2012.2218
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

Cell invasion is required for neoplastic metastasis. Matrix metalloproteinase-9 (MMP-9), which degrades the extracellular matrix, is a major component in the process of cancer cell invasion. Sulfuretin is one of the major flavonoids isolated from Rhus verniciflua. Sulfuretin has been used to reduce oxidative stress, platelet aggregation, the inflammatory response and mutagenesis. However, the effect of sulfuretin on breast cancer metastasis is unknown. In this study, we investigated the inhibitory effect of sulfuretin on 12-O-tetradecanoylphorbol-13-acetate (TPA)-induced MMP-9 expression and cell invasion in MCF-7 cells. Sulfuretin inhibited TPA-induced transcriptional activation of nuclear factor-κB (NF-κB). We demonstrated that sulfuretin mediated the inhibition of TPA-induced MMP-9 expression and that cell invasion in MCF-7 cells involved suppression of the NF-κB pathway. Therefore, inhibiting MMP-9 expression by sulfuretin may have therapeutic potential for controlling breast cancer invasiveness.

Introduction

Breast cancer is one of the leading causes of cancer-related death in women (1). Despite successful treatment of the primary malignancy, relapse and subsequent metastatic spread can still occur at distant sites in the body through the bloodstream or lymphatic channels, including bone, lung, liver, kidney, thyroid and brain (2). Invasion and metastasis are fundamental processes and are the major causes of morbidity and mortality in patients with breast cancer. These processes require degradation of the extracellular matrix (ECM), which provides biochemical and mechanical barriers to cancer cell movement (3). The ECM consists of type IV collagen, laminin, heparan sulfate proteoglycan, nidogen and fibronectin (4). Degradation of the ECM requires extracellular proteinases, of which the matrix metalloproteinases (MMPs) play a critical role in breast cancer. Among the MMP family, gelatinases A (72 kDa gelatinase, type IV collagenase, MMP-2) and B (92 kDa gelatinase, type IV collagenase, MMP-9) play critical roles in ECM degradation and cell migration, leading to tumor cell invasion in breast cancer (4,5).

MMP-9 is a key enzyme for degrading type IV collagen, which is a major component of the basement membrane. Elevated MMP-9 levels are functionally linked to elevated metastatic potential in many types of tumors, including brain (6), prostate (7), bladder (8), and breast (9,10). A variety of stimuli, including growth factors (e.g. fibroblast growth factor-2, epidermal growth factor and hepatocyte growth factor), cytokines (e.g., tumor necrosis factor-α), oncogenes (e.g., Ras) and 12-O-tetradecanoylphorbol-13-acetate (TPA) are involved in metastasis (11–14). Among these stimulators, TPA is a well-known selective activator of protein kinase C (11) and stimulates MMP-9 synthesis and secretion during MCF-7 cell invasion (9,10). Consequently, inhibiting MMP-9 expression and/or its upstream regulatory pathways is critical for treating malignant tumors, including breast carcinoma. NF-κB and AP-1 are transcription factors important in the regulation of MMP-9, as the MMP-9 gene promoter contains binding sites for both factors (15). Studies have shown that the mitogen-activated protein kinase (MAPK) signaling pathway is important for AP-1 activation, and that NF-κB activation requires I-κB kinase, ERK, JNK and p38 MAPK, depending on the cell type (14,16–18).

Sulfuretin is a major flavonoid isolated from the heartwood of Rhus verniciflua Stokes (RVS), which has been used to reduce oxidative stress (19), platelet aggregation (20), the inflammatory response (21) and mutagenesis (22). A recent study found that sulfuretin inhibits cytokine-induced β-cell damage and prevents streptozotocin-induced diabetes by suppressing the NF-κB pathway (23). Therefore, it was hypothesized that sulfuretin may have anticancer properties that inhibit cell invasion. In the present study, sulfuretin was evaluated for its potential activity against TPA-induced cell invasion and MMP-9 expression in MCF-7 cells, and the related molecular mechanisms were investigated. Our results demonstrated that sulfuretin suppresses TPA-induced MMP-9 expression by blocking NF-κB activation but not AP-1 activation.

Materials and methods

Cells and materials

MCF-7 cells were obtained from the American Type Culture Collection (Manassas, VA, USA). The cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10% fetal bovine serum (FBS) and 1% antibiotics at 37°C in a 5% CO2 incubator. Sulfuretin was purchased from Symrise GmbH & Co. (Holzminden, Germany). TPA, 3-(4,5-dimethyl-thiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) and anti-β-actin antibodies were obtained from Sigma (St. Louis, MO, USA). Antibodies for p38, p-p38, JNK, p-JNK, ERK and p-ERK were purchased from Cell Signaling Technology (Beverly, MA, USA). Antibodies for MMP-9, p50, p65, proliferating cell nuclear antigen (PCNA), and horseradish peroxidase (HRP)-conjugated IgG were purchased from Santa Cruz Biotechnology (Santa Cruz, CA, USA). α-32P-dCTP was obtained from Amersham (Buckinghamshire, UK). High glucose-containing DMEM, FBS, and phosphate-buffered saline (PBS) were obtained from Gibco-BRL (Gaithersburg, MD, USA).

Determination of cell viability

The effect of sulfuretin on MCF-7 cell viability was determined using an established MTT assay. Briefly, 3xl04 cells were seeded in wells and incubated at 37°C for 24 h to allow attachment. The attached cells were untreated or treated with 1, 5, 10, 30, and 50 μM sulfuretin for 24 h at 37°C. The cells were washed with PBS prior to adding MTT (0.5 mg/ml PBS) and incubated at 37°C for 30 min. Formazan crystals were dissolved with dimethyl sulfoxide (100 μl/well) and detected at 570 nm using a Model 3550 microplate reader (Bio-Rad, Richmond, CA, USA).

Western blot analysis

MCF-7 cells (5×105) were pretreated with 10 and 30 μM sulfuretin for 1 h and then incubated with TPA for 24 h at 37°C. Cells were lysed with ice-cold M-PER® Mammalian Protein Extraction reagent (Pierce Biotechnology, Rockford, IL, USA), and the protein concentration in the lysate was determined using the Bradford method (24). Samples (20 μg) were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis with 10% acrylamide and transferred to Hybond™ polyvinylidene fluoride membranes (GE Healthcare Life Sciences, Buckinghamshire, UK) using a western blot apparatus. Each membrane was blocked for 2 h with 2% bovine serum albumin or 5% skim milk and then incubated overnight at 4°C with 1 μg/ml of a 1:2000 dilution of primary antibody. HRP-conjugated IgG (1:2000 dilution) was used as the secondary antibody. Protein expression levels were determined by signal analysis using an image analyzer (Fuji-Film, Tokyo, Japan).

Gelatin zymography assay

Conditioned media were collected after a 24 h stimulation, mixed with non-reducing sample buffer, and electrophoresed on a polyacrylamide gel containing 0.1% (w/v) gelatin. The gel was washed at room temperature for 30 min with 2.5% Triton X-100 solution, and subsequently incubated at 37°C for 16 h in 5 mM CaCl2, 0.02% Brij and 50 mM Tris-HCl (pH 7.5). The gel was stained for 30 min with 0.25% (w/v) Coomassie Brilliant Blue in 40% (v/v) methanol/7% (v/v) acetic acid and photographed using an image analyzer (Fuji-Film). Proteolysis was imaged as the white zone in a dark blue field. Densitometric analysis was performed using Multi Gauge Image Analysis software (Fuji-Film).

Quantitative real-time polymerase chain reaction (PCR)

Total RNA was extracted from cells using a FastPure™ RNA kit (Takara, Shiga, Japan). The RNA concentration and purity were determined by absorbance at 260/280 nm. cDNA was synthesized from 1 μg total RNA using a PrimeScript™ RT Reagent kit (Takara). MMP-9 and glyceraldehyde 3-phosphate dehydrogenase (GAPDH) mRNA expression was determined by real-time PCR using the ABI PRISM 7900 Sequence Detection system and SYBR® Green (Applied Biosystems, Foster City, CA, USA). The primers were: MMP-9 (NM 004994) sense, CCTGGAGACCTGAGAACCAATCT; antisense, CCACCC GAGTGTAACCATAGC and GAPDH (NM 002046) sense, ATGGAAATCCCATCACCATCTT; antisense, CGCCCCAC TTGATTTTGG. All results were normalized to the GAPDH housekeeping gene to control for variation in mRNA concentrations. Relative quantification was performed using the comparative ΔΔCT method according to the manufacturer’s instructions.

Preparation of the nuclear extract

MCF-7 cells (2×106) were treated with sulfuretin in the presence or absence of TPA for 4 h. Cells were immediately washed twice, scraped into 1.5 ml of ice-cold PBS (pH 7.5), and pelleted at 1,500 × g for 3 min. Cytoplasmic and nuclear extracts were prepared from the cells using the NE-PER® Nuclear and Cytoplasmic Extraction reagent (Pierce Biotechnology).

Electrophoretic mobility shift assay (EMSA)

Activation of NF-κB and AP-1 was assessed with a gel mobility shift assay using nuclear extracts. An oligonucleotide containing the κ-chain (κB, 5′-AGTTGAGGGGACTTTCCCAGGC-3′) or AP-1 (5′-CGCTTGATGAGTCAGCCGGAA-3′) binding sites was synthesized and used as a probe for the gel retardation assay. The two complementary strands were annealed and labeled with [α-32P]dCTP. Labeled oligonucleotides (10,000 cpm), 10 μg of nuclear extract and binding buffer (10 mM Tris-HCl, pH 7.6, 500 mM KCl, 10 mM EDTA, 50% glycerol, 100 ng poly(dI·dC) and 1 mM dithiothreitol) were then incubated for 30 min at room temperature in a final volume of 20 μl. The reaction mixtures were analyzed by electrophoresis on 4% polyacrylamide gels in 0.5X Tris-borate buffer. The gels were dried and examined by autoradiography. Specific binding was controlled by competition with a 50-fold excess of cold κB and AP-1 oligonucleotide.

Invasion assay

The invasion assay was carried out in 24-well chambers (8-μm pore size) coated with 20 μl Matrigel-diluted DMEM. The Matrigel coating was rehydrated in 0.5 ml DMEM for 30 min immediately before the experiments. Cells (2×105) were added to the upper chamber with chemoattractant in the bottom well. Conditioned medium (0.5 ml) was added to the lower compartment of the invasion chamber, and the chambers were incubated for 24 h. After the incubation, cells on the upper side of the chamber were removed using cotton swabs, and cells that had migrated were fixed and stained with toluidine blue solution. Invading cells were counted in five random areas of the membrane using a light microscope. Data are the means ± standard errors from three individual experiments performed in triplicate.

Statistical analysis

The statistical analysis was performed using analysis of variance and Duncan’s test. Differences with a p<0.05 were considered statistically significant.

Results

Sulfuretin suppresses TPA-induced MMP-9 activation in MCF-7 cells

The chemical structure of sulfuretin is shown in Fig. 1A. To verify the effect of sulfuretin on cell viability, cells were seeded in 96-well culture plates at a density of 1×105 cells/well. The cytotoxic effect of sulfuretin on MCF-7 cells was analyzed using the MTT assay. Treatment of MCF-7 cells with the indicated concentrations of sulfuretin for 24 h did not result in any significant change in cell viability (Fig. 1B). Therefore, we performed the subsequent experiments using the optimal non-toxic concentrations (10 and 30 μM) of sulfuretin. Western blot analysis, real-time PCR and zymography were performed in MCF-7 cell-containing samples to investigate the effect of sulfuretin on TPA-induced MMP-9 expression. The western blot analysis revealed that sulfuretin treatment of MCF-7 cells blocked upregulation of TPA-induced MMP-9 protein expression (Fig. 2A). Real-time PCR revealed a TPA-induced increase in the MMP-9 level in MCF-7 cells, and that sulfuretin blocked TPA-induced MMP-9 upregulation in a dose-dependent manner (Fig. 2B). A zymography analysis was carried out to determine the effect of sulfuretin on TPA-induced MMP-9 secretion. The analysis demonstrated that treatment of MCF-7 cells with TPA increased MMP-9 secretion, while sulfuretin significantly diminished the TPA-induced MMP-9 secretion (Fig. 2C). These results were consistent with the potent sulfuretin-mediated inhibition of TPA-induced MMP-9 expression in MCF-7 cells.

Figure 1

Effect of sulfuretin on MCF-7 cell viability. (A) The chemical structure of sulfuretin. (B) Assessment of the cytotoxic effect of sulfuretin on MCF-7 cells. Cells were cultured to 70% confluence in 96-well plates, and various concentrations (1, 5, 10, 30, 50 μM) of sulfuretin were added to the cells for 24 h. An established MTT assay was used to detect cell viability. The optical density value of the control was considered as 100%. Each data point represents the mean ± standard error of three independent experiments.

Figure 2

Sulfuretin inhibits TPA-induced MMP-9 expression in MCF-7 cells. MCF-7 cell monolayers were treated with the indicated concentrations of sulfuretin in the presence of TPA for 24 h. (A) Cell lysates were analyzed by western blot analysis with the anti-MMP-9 antibody. The blot was reprobed with anti-β-actin to confirm equal loading. (B) MMP-9 mRNA levels were analyzed by real-time PCR, and GAPDH was used as an internal control. (C) Conditioned media were prepared and used for gelatin zymography. Each value represents the mean ± standard error of three independent experiments. *p<0.01 vs. TPA.

Sulfuretin inhibits TPA-induced NF-κB DNA binding activity but not the AP-1 and MAPK pathway

To clarify the mechanism involved in the sulfuretin-mediated inhibition of MMP-9 expression, the effects of sulfuretin on TPA-induced activation of NF-κB and AP-1 were evaluated using EMSA. As shown in Fig. 3A and B, TPA substantially increased NF-κB and AP-1 binding activity. Pretreatment with sulfuretin inhibited TPA-stimulated NF-κB binding activity but not that of AP-1. These results were consistent with the view that sulfuretin specifically blocks NF-κB activation in MCF-7 cells. In the western blot analysis, TPA stimulated the phosphorylation of IKKκβ and IκBα in the cytoplasm and, thereby, the nuclear translocation of NF-κB subunits p50 and p65. In the case of AP-1, c-Jun expression was considerably augmented, while c-Fos expression was only negligibly induced in the TPA-treated cells. Based on our results, the increased p-IKKαβ, p-IκBα and translocation of p65 and p50 as a result of TPA stimulation was significantly suppressed by sulfuretin treatment (Fig. 3D and E). We confirmed that TPA induced the phosphorylation of c-Jun, a major subunit of AP-1, and sulfuretin had no effect on c-Jun phosphorylation (Fig. 3E). The effect of sulfuretin on TPA-induced phosphorylation and activation of MAPKs was investigated to determine the inhibitory effect of sulfuretin on MAPK. Sulfuretin had no effect on MAPK phosphorylation 30 min after TPA treatment (Fig. 3C). These results suggest that the regulation of TPA-induced MMP-9 expression by sulfuretin does not involve the MAPK pathway.

Figure 3

Sulfuretin inhibits TPA-induced NF-λB DNA binding activity but not AP-1 DNA binding activity and the MAPK pathway in MCF-7 cells. (A and B) Cells were treated with sulfuretin in the presence of TPA, and nuclear extracts were prepared following a 4-h incubation. Nuclear factor (NF)-λB and activating protein-1 (AP-1) DNA binding was analyzed by electrophoretic mobility shift assay (EMSA). (C) Cells were pretreated with TPA for 30 min in the presence or absence of sulfuretin. Cell lysates were prepared for western blotting with specific p-p38, p38, p-JNK, JNK, p-ERK and ERK antibodies. (D and E) Western blotting was performed to determine the nuclear levels of NF-λB (p50 and p65) and AP-1 (p-c-Jun) subunits as well as the cytoplasmic levels of the NF-λB subunits IλBα and p-IκBα.

Effect of sulfuretin on TPA-induced MCF-7 cell invasion in vitro

Upregulation of MMP-9 expression contributes to the increased invasiveness of cancer cells (25,26). An in vitro invasion assay was used to investigate the inhibitory effects of sulfuretin on the invasive ability of MCF-7 cells. Treatment with TPA increased MCF-7 cell invasion when compared with that in untreated control cells, as determined by a Matrigel invasion assay. Incubating MCF-7 cells with TPA resulted in a 10-fold increase in cell invasiveness. However, treatment with sulfuretin diminished TPA-induced cell invasion by 65% (Fig. 4).

Figure 4

Effect of sulfuretin on TPA-induced Matrigel invasion in MCF-7 cells. Cells were seeded onto the upper chamber, and drugs were placed in the well. After a 24-h incubation, cells on the bottom of the filter were fixed, stained and counted. Each value represents the mean ± standard error of three independent experiments. *p<0.01 vs. TPA.

Discussion

Studies involved in the development of effective anti-invasive strategies have focused mainly on the utilization of natural bioactive agents in MCF-7 cells. In the present study, we isolated sulfuretin from the heartwood of Rhus verniciflua Stokes (RVS) and examined its effects on TPA-induced MMP-9 expression and cellular invasion in MCF-7 cells. RVS exerts a remarkable spectrum of biological activities affecting basic cellular functions, and the identification of sulfuretin as an active principle agent has been demonstrated (19,22,23,27–34). In previous reports, sulfuretin exerted anticancer and antiproliferative effects in various types of cells (28,30). Additionally and consistent with these results, our previous observations indicated that sulfuretin inhibits MMP expression and inflammatory responses by interfering with the transcriptional activation of NF-κB (23,27,35). However, no study has reported on the anti-invasive effects of sulfuretin in MCF-7 cells. Thus, we designed this study to estimate the anti-invasive potential of sulfuretin and to explore the molecular mechanisms underlying its activity.

Metastasis is the primary cause of breast cancer mortality. Tumor metastasis is a multistep process by which a subset of individual cancer cells disseminates from a primary tumor to distant secondary organs or tissues. This process involves cell proliferation, ECM degradation, cell migration and tumor growth at metastatic sites (10,36). Tumor cell invasion is an early step in the metastatic cascade, representing the beginning of the transition from the benign stage to malignancy. Tumor invasion is morphologically associated with a distorted edge of the primary tumor where individual or cohorts of tumor cells actively invade the ECM surrounding the primary tumor (37). MMP-9 has been regarded as a major critical molecule during tumor invasion and metastasis. MMP-9 activation is particularly associated with tumor progression and invasion, including that in mammary tumors (38). Inflammatory cytokines, growth factors and phorbol esters stimulate MMP-9 by activating different intracellular-signaling pathways in breast cancer cells (39–41). The inhibitory effect on MMP-9 expression is important for developing a therapeutic experimental model of tumor metastasis.

NF-κB and AP-1 are transcription factors important in regulating MMP-9, as the MMP-9 gene promoter contains NF-κB and AP-1 binding sites (15). AP-1, which belongs to the bZIP group of DNA-binding proteins, associates to form a variety of homodimers and heterodimers through a combination of signaling events, leading to increased activity of proteins that directly potentiate Jun and Fos family members or activate transcription factors that regulate c-jun and c-fos expression (42–45). NF-κB comprises a family of inducible transcription factors that regulate host inflammatory and immune responses (46). Diverse signal transduction cascades mediate stimulation of the NF-κB pathway (46). NF-κB and AP-1 elements are centrally involved in TPA-mediated MMP-9 gene induction (36,47). Additionally, the MAPK signaling pathway is important for NF-κB activation, which requires I-κB kinase depending on cell type (14,16–18,48). However, our results showed that sulfuretin inhibited activation of NF-κB but not MAPK or AP-1 in MCF-7 cells. This result suggests that sulfuretin inhibited TPA-induced MMP-9 expression through the NF-κB pathway.

These experiments confirmed that TPA-stimulated cell invasion was suppressed by sulfuretin. Data obtained from the Matrigel invasion assay showed that sulfuretin inhibited the TPA-induced invasive potential of MCF-7 cells (Fig. 4). These data suggest that the inhibition cell invasion caused by sulfuretin was correlated with inhibition of MMP-9 expression and the NF-κB signaling pathway.

In conclusion, our results demonstrated that sulfuretin is a potent inhibitor of TPA-induced MMP-9 expression, and that it strongly blocked the NF-κB signaling pathway in breast carcinoma cells. This is the first study to show that sulfuretin suppresses TPA-stimulated cancer cell invasion by inhibiting MMP-9 expression. We also detailed the molecular mechanisms of the NF-κB pathway in breast cancer cells responsible for this inhibitory effect. Thus, sulfuretin may be a potential candidate for preventing breast tumor invasion and metastasis in vivo.

Acknowledgements

This study was supported by a National Research Foundation of Korea (NRF) grant funded by the Korea Government (MEST) (no. 2011-0030716), Republic of Korea.

References

1 

Jemal A, Murray T, Ward E, et al: Cancer statistics, 2005. CA Cancer J Clin. 55:10–30. 2005. View Article : Google Scholar

2 

Friedel G, Pastorino U, Ginsberg RJ, et al: Results of lung metastasectomy from breast cancer: prognostic criteria on the basis of 467 cases of the International Registry of Lung Metastases. Eur J Cardiothorac Surg. 22:335–344. 2002. View Article : Google Scholar

3 

Woessner JF Jr: Matrix metalloproteinases and their inhibitors in connective tissue remodeling. FASEB J. 5:2145–2154. 1991.PubMed/NCBI

4 

Nakajima M, Welch DR, Belloni PN and Nicolson GL: Degradation of basement membrane type IV collagen and lung subendothelial matrix by rat mammary adenocarcinoma cell clones of differing metastatic potentials. Cancer Res. 47:4869–4876. 1987.PubMed/NCBI

5 

Egeblad M and Werb Z: New functions for the matrix metalloproteinases in cancer progression. Nat Rev Cancer. 2:161–174. 2002. View Article : Google Scholar : PubMed/NCBI

6 

Saito N, Hatori T, Murata N, et al: A double three-step theory of brain metastasis in mice: the role of the pia mater and matrix metalloproteinases. Neuropathol Appl Neurobiol. 33:288–298. 2007. View Article : Google Scholar : PubMed/NCBI

7 

Castellano G, Malaponte G, Mazzarino MC, et al: Activation of the osteopontin/matrix metalloproteinase-9 pathway correlates with prostate cancer progression. Clin Cancer Res. 14:7470–7480. 2008. View Article : Google Scholar : PubMed/NCBI

8 

Kanayama H: Matrix metalloproteinases and bladder cancer. J Med Invest. 48:31–43. 2001.PubMed/NCBI

9 

Lin CW, Hou WC, Shen SC, et al: Quercetin inhibition of tumor invasion via suppressing PKC delta/ERK/AP-1-dependent matrix metalloproteinase-9 activation in breast carcinoma cells. Carcinogenesis. 29:1807–1815. 2008. View Article : Google Scholar : PubMed/NCBI

10 

Lee SO, Jeong YJ, Kim M, Kim CH and Lee IS: Suppression of PMA-induced tumor cell invasion by capillarisin via the inhibition of NF-kappaB-dependent MMP-9 expression. Biochem Biophys Res Commun. 366:1019–1024. 2008. View Article : Google Scholar : PubMed/NCBI

11 

Newton AC: Regulation of protein kinase C. Curr Opin Cell Biol. 9:161–167. 1997. View Article : Google Scholar : PubMed/NCBI

12 

Zeigler ME, Chi Y, Schmidt T and Varani J: Role of ERK and JNK pathways in regulating cell motility and matrix metalloproteinase 9 production in growth factor-stimulated human epidermal keratinocytes. J Cell Physiol. 180:271–284. 1999. View Article : Google Scholar : PubMed/NCBI

13 

Hozumi A, Nishimura Y, Nishiuma T, Kotani Y and Yokoyama M: Induction of MMP-9 in normal human bronchial epithelial cells by TNF-alpha via NF-kappa B-mediated pathway. Am J Physiol Lung Cell Mol Physiol. 281:L1444–L1452. 2001.PubMed/NCBI

14 

Weng CJ, Chau CF, Hsieh YS, Yang SF and Yen GC: Lucidenic acid inhibits PMA-induced invasion of human hepatoma cells through inactivating MAPK/ERK signal transduction pathway and reducing binding activities of NF-kappaB and AP-1. Carcinogenesis. 29:147–156. 2008. View Article : Google Scholar

15 

Eberhardt W, Huwiler A, Beck KF, Walpen S and Pfeilschifter J: Amplification of IL-1 beta-induced matrix metalloproteinase-9 expression by superoxide in rat glomerular mesangial cells is mediated by increased activities of NF-kappa B and activating protein-1 and involves activation of the mitogen-activated protein kinase pathways. J Immunol. 165:5788–5797. 2000.

16 

Yao J, Xiong S, Klos K, et al: Multiple signaling pathways involved in activation of matrix metalloproteinase-9 (MMP-9) by heregulin-beta1 in human breast cancer cells. Oncogene. 20:8066–8074. 2001. View Article : Google Scholar : PubMed/NCBI

17 

Karin M: The regulation of AP-1 activity by mitogen-activated protein kinases. J Biol Chem. 270:16483–16486. 1995. View Article : Google Scholar : PubMed/NCBI

18 

Madrid LV, Mayo MW, Reuther JY and Baldwin AS Jr: Akt stimulates the transactivation potential of the RelA/p65 subunit of NF-kappaB through utilization of the IkappaB kinase and activation of the mitogen-activated protein kinase p38. J Biol Chem. 276:18934–18940. 2001. View Article : Google Scholar : PubMed/NCBI

19 

Lee JC, Lim KT and Jang YS: Identification of Rhus verniciflua Stokes compounds that exhibit free radical scavenging and anti-apoptotic properties. Biochim Biophys Acta. 1570:181–191. 2002.

20 

Jeon WK, Lee JH, Kim HK, et al: Anti-platelet effects of bioactive compounds isolated from the bark of Rhus verniciflua Stokes. J Ethnopharmacol. 106:62–69. 2006. View Article : Google Scholar : PubMed/NCBI

21 

Jung CH, Kim JH, Hong MH, et al: Phenolic-rich fraction from Rhus verniciflua Stokes (RVS) suppress inflammatory response via NF-kappaB and JNK pathway in lipopolysaccharide-induced RAW 264.7 macrophages. J Ethnopharmacol. 110:490–497. 2007.

22 

Park KY, Jung GO, Lee KT, et al: Antimutagenic activity of flavonoids from the heartwood of Rhus verniciflua. J Ethnopharmacol. 90:73–79. 2004. View Article : Google Scholar : PubMed/NCBI

23 

Song MY, Jeong GS, Kwon KB, et al: Sulfuretin protects against cytokine-induced beta-cell damage and prevents streptozotocin-induced diabetes. Exp Mol Med. 42:628–638. 2010. View Article : Google Scholar : PubMed/NCBI

24 

Bradford MM: A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem. 72:248–254. 1976. View Article : Google Scholar : PubMed/NCBI

25 

Chambers AF and Matrisian LM: Changing views of the role of matrix metalloproteinases in metastasis. J Natl Cancer Inst. 89:1260–1270. 1997. View Article : Google Scholar : PubMed/NCBI

26 

Stetler-Stevenson WG, Hewitt R and Corcoran M: Matrix metalloproteinases and tumor invasion: from correlation and causality to the clinic. Semin Cancer Biol. 7:147–154. 1996. View Article : Google Scholar : PubMed/NCBI

27 

Song MY, Jeong GS, Lee HS, et al: Sulfuretin attenuates allergic airway inflammation in mice. Biochem Biophys Res Commun. 400:83–88. 2010. View Article : Google Scholar : PubMed/NCBI

28 

Jang HS, Kook SH, Son YO, et al: Flavonoids purified from Rhus verniciflua Stokes actively inhibit cell growth and induce apoptosis in human osteosarcoma cells. Biochim Biophys Acta. 1726:309–316. 2005.PubMed/NCBI

29 

Jang DS, Park EJ, Hawthorne ME, et al: Potential cancer chemopreventive constituents of the seeds of Dipteryx odorata (tonka bean). J Nat Prod. 66:583–587. 2003. View Article : Google Scholar : PubMed/NCBI

30 

Lee JC, Lee KY, Kim J, et al: Extract from Rhus verniciflua Stokes is capable of inhibiting the growth of human lymphoma cells. Food Chem Toxicol. 42:1383–1388. 2004.

31 

Son YO, Lee KY, Lee JC, et al: Selective antiproliferative and apoptotic effects of flavonoids purified from Rhus verniciflua Stokes on normal versus transformed hepatic cell lines. Toxicol Lett. 155:115–125. 2005. View Article : Google Scholar : PubMed/NCBI

32 

Ko JH, Lee SJ and Lim KT: 36 kDa glycoprotein isolated from Rhus verniciflua Stokes fruit has a protective activity to glucose/glucose oxidase-induced apoptosis in NIH/3T3 cells. Toxicol In Vitro. 19:353–363. 2005.

33 

Lim KT, Hu C and Kitts DD: Antioxidant activity of a Rhus verniciflua Stokes ethanol extract. Food Chem Toxicol. 39:229–237. 2001.

34 

Choi J, Yoon BJ, Han YN, et al: Antirheumatoid arthritis effect of Rhus verniciflua and of the active component, sulfuretin. Planta Med. 69:899–904. 2003. View Article : Google Scholar

35 

Lee YR, Hwang JK, Koh HW, et al: Sulfuretin, a major flavonoid isolated from Rhus verniciflua, ameliorates experimental arthritis in mice. Life Sci. 90:799–807. 2012. View Article : Google Scholar : PubMed/NCBI

36 

Chung TW, Moon SK, Chang YC, et al: Novel and therapeutic effect of caffeic acid and caffeic acid phenyl ester on hepatocarcinoma cells: complete regression of hepatoma growth and metastasis by dual mechanism. FASEB J. 18:1670–1681. 2004. View Article : Google Scholar : PubMed/NCBI

37 

Deryugina EI and Quigley JP: Matrix metalloproteinases and tumor metastasis. Cancer Metastasis Rev. 25:9–34. 2006. View Article : Google Scholar

38 

Scorilas A, Karameris A, Arnogiannaki N, et al: Overexpression of matrix-metalloproteinase-9 in human breast cancer: a potential favourable indicator in node-negative patients. Br J Cancer. 84:1488–1496. 2001. View Article : Google Scholar : PubMed/NCBI

39 

Cho HJ, Kang JH, Kwak JY, et al: Ascofuranone suppresses PMA-mediated matrix metalloproteinase-9 gene activation through the Ras/Raf/MEK/ERK- and Ap1-dependent mechanisms. Carcinogenesis. 28:1104–1110. 2007. View Article : Google Scholar : PubMed/NCBI

40 

Kajanne R, Miettinen P, Mehlem A, et al: EGF-R regulates MMP function in fibroblasts through MAPK and AP-1 pathways. J Cell Physiol. 212:489–497. 2007. View Article : Google Scholar : PubMed/NCBI

41 

Srivastava AK, Qin X, Wedhas N, et al: Tumor necrosis factor-alpha augments matrix metalloproteinase-9 production in skeletal muscle cells through the activation of transforming growth factor-beta-activated kinase 1 (TAK1)-dependent signaling pathway. J Biol Chem. 282:35113–35124. 2007. View Article : Google Scholar

42 

Frigo DE, Tang Y, Beckman BS, et al: Mechanism of AP-1-mediated gene expression by select organochlorines through the p38 MAPK pathway. Carcinogenesis. 25:249–261. 2004. View Article : Google Scholar : PubMed/NCBI

43 

Shaulian E and Karin M: AP-1 in cell proliferation and survival. Oncogene. 20:2390–2400. 2001. View Article : Google Scholar : PubMed/NCBI

44 

Yokoo T and Kitamura M: Dual regulation of IL-1 beta-mediated matrix metalloproteinase-9 expression in mesangial cells by NF-kappa B and AP-1. Am J Physiol. 270:F123–F130. 1996.PubMed/NCBI

45 

Lungu G, Covaleda L, Mendes O, Martini-Stoica H and Stoica G: FGF-1-induced matrix metalloproteinase-9 expression in breast cancer cells is mediated by increased activities of NF-kappaB and activating protein-1. Mol Carcinog. 47:424–435. 2008. View Article : Google Scholar : PubMed/NCBI

46 

Yamamoto Y and Gaynor RB: Therapeutic potential of inhibition of the NF-kappaB pathway in the treatment of inflammation and cancer. J Clin Invest. 107:135–142. 2001. View Article : Google Scholar : PubMed/NCBI

47 

Hong S, Park KK, Magae J, et al: Ascochlorin inhibits matrix metalloproteinase-9 expression by suppressing activator protein-1-mediated gene expression through the ERK1/2 signaling pathway: inhibitory effects of ascochlorin on the invasion of renal carcinoma cells. J Biol Chem. 280:25202–25209. 2005. View Article : Google Scholar

48 

Ruhul Amin AR, Senga T, Oo ML, Thant AA and Hamaguchi M: Secretion of matrix metalloproteinase-9 by the proinflammatory cytokine, IL-1beta: a role for the dual signalling pathways, Akt and Erk. Genes Cells. 8:515–523. 2003.PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Kim J, Noh E, Kwon K, Kim J, You Y, Hwang J, Hwang B, Kim M, Lee S, Jung S, Jung S, et al: Suppression of TPA-induced tumor cell invasion by sulfuretin via inhibition of NF-κB-dependent MMP-9 expression. Oncol Rep 29: 1231-1237, 2013.
APA
Kim, J., Noh, E., Kwon, K., Kim, J., You, Y., Hwang, J. ... Lee, Y. (2013). Suppression of TPA-induced tumor cell invasion by sulfuretin via inhibition of NF-κB-dependent MMP-9 expression. Oncology Reports, 29, 1231-1237. https://doi.org/10.3892/or.2012.2218
MLA
Kim, J., Noh, E., Kwon, K., Kim, J., You, Y., Hwang, J., Hwang, B., Kim, M., Lee, S., Jung, S., Youn, H., Chung, E., Lee, Y."Suppression of TPA-induced tumor cell invasion by sulfuretin via inhibition of NF-κB-dependent MMP-9 expression". Oncology Reports 29.3 (2013): 1231-1237.
Chicago
Kim, J., Noh, E., Kwon, K., Kim, J., You, Y., Hwang, J., Hwang, B., Kim, M., Lee, S., Jung, S., Youn, H., Chung, E., Lee, Y."Suppression of TPA-induced tumor cell invasion by sulfuretin via inhibition of NF-κB-dependent MMP-9 expression". Oncology Reports 29, no. 3 (2013): 1231-1237. https://doi.org/10.3892/or.2012.2218
Copy and paste a formatted citation
x
Spandidos Publications style
Kim J, Noh E, Kwon K, Kim J, You Y, Hwang J, Hwang B, Kim M, Lee S, Jung S, Jung S, et al: Suppression of TPA-induced tumor cell invasion by sulfuretin via inhibition of NF-κB-dependent MMP-9 expression. Oncol Rep 29: 1231-1237, 2013.
APA
Kim, J., Noh, E., Kwon, K., Kim, J., You, Y., Hwang, J. ... Lee, Y. (2013). Suppression of TPA-induced tumor cell invasion by sulfuretin via inhibition of NF-κB-dependent MMP-9 expression. Oncology Reports, 29, 1231-1237. https://doi.org/10.3892/or.2012.2218
MLA
Kim, J., Noh, E., Kwon, K., Kim, J., You, Y., Hwang, J., Hwang, B., Kim, M., Lee, S., Jung, S., Youn, H., Chung, E., Lee, Y."Suppression of TPA-induced tumor cell invasion by sulfuretin via inhibition of NF-κB-dependent MMP-9 expression". Oncology Reports 29.3 (2013): 1231-1237.
Chicago
Kim, J., Noh, E., Kwon, K., Kim, J., You, Y., Hwang, J., Hwang, B., Kim, M., Lee, S., Jung, S., Youn, H., Chung, E., Lee, Y."Suppression of TPA-induced tumor cell invasion by sulfuretin via inhibition of NF-κB-dependent MMP-9 expression". Oncology Reports 29, no. 3 (2013): 1231-1237. https://doi.org/10.3892/or.2012.2218
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team