Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Oncology Reports
Join Editorial Board Propose a Special Issue
Print ISSN: 1021-335X Online ISSN: 1791-2431
Journal Cover
February-2015 Volume 33 Issue 2

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
February-2015 Volume 33 Issue 2

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

The V-val subtype Epstein-Barr virus nuclear antigen 1 promotes cell survival after serum withdrawal

  • Authors:
    • Mei Chao
    • Hsiao-Ning Wang
    • Yi Jin Lu
    • Yu-Sun Chang
    • Jau-Song Yu
  • View Affiliations / Copyright

    Affiliations: Division of Microbiology, Graduate Institute of Biomedical Sciences, Chang Gung University, Kwei-Shan, Tao-Yang 333, Taiwan R.O.C., Molecular Medicine Research Center, College of Medicine, Chang Gung University, Kwei-Shan, Tao-Yang 333, Taiwan R.O.C.
  • Pages: 958-966
    |
    Published online on: November 25, 2014
       https://doi.org/10.3892/or.2014.3625
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

Epstein-Barr virus (EBV) can establish latent infection and has been associated with various human cancers. Epstein-Barr nuclear antigen 1 (EBNA1) is the only viral protein that is expressed in all EBV-associated malignant tissues. The N- and C-terminal domains of EBNA1, which are connected by internal glycine/alanine-rich short repeat sequences of various sizes, show sequence divergence across EBV strains isolated from around the world. At least five subtypes have been described, according to the amino acid at residue 487: P-ala, P-thr, V-val, V-pro, and V-leu. Whether the variations of EBNA-1 contribute to the pathogenesis of EBV or simply reflect the geographical distribution of EBV remain to be investigated. Furthermore, the cell effects conferred by EBNA1 subtypes that differ from that of the B95.8 prototype, which belongs to the P-ala subtype, remain to be elucidated. In this study, PCR was amplified with the full-length V-val EBNA1 gene from the CG3 cell line, an EBV-carrying lymphoblastoid cell line derived from a Taiwanese chronic myeloid leukemia patient. Plasmids expressing His-tagged EBNA1 fusion proteins in E. coli were constructed and used to raise antibodies in rabbit. The V-val EBNA1 gene was then cloned into a eukaryotic expression vector and successfully expressed in the transfected cultured cells. Expression of V-val EBNA1 rendered 293 cells able to undergo serum‑independent cell proliferation, providing them with anti-apoptotic abilities, which are two characteristics of cancer cells. These data suggested that use of EBNA1 originally derived from tumor cells, rather than the more commonly utilized prototype, when investigating the potential role of EBNA1 in the oncogenesis of EBV-associated malignancies, is crucial.

Introduction

Epstein-Barr virus (EBV), a ubiquitous human γ herpes virus, establishes persistent latent infections and has been causally associated with a variety of B-cell and epithelial cell malignancies, including Burkitt’s lymphoma (BL), Hodgkin’s lymphoma, gastric carcinoma and nasopharyngeal carcinoma (NPC) (1). EBV depends on Epstein-Barr nuclear antigen 1 (EBNA1) to mediate critical processes in the viral life cycle, and EBNA1 is the only viral protein that has been identified in all EBV-associated malignant tissues. It is well-known that EBNA1 expression is necessary for maintaining EBV in latently proliferating cells, mediating synthesis of the EBV genome, non-randomly partitioning the virus to daughter cells (2–4) and regulating viral gene transcription (5–9). The effects of EBNA1 on the host cell remain to be elucidated (10,11), although it has been suggested that EBNA1: is critical for the continued survival of BL (12), may affect the function of p53 by competing for the USP7 ubiquitin-specific protease (13,14), promotes the development of B-cell lymphoma in transgenic mice (15), counteracts Nm23-H1-mediated suppression of cell migration (16,17), serves as a potential regulator of signaling pathways (18–21), and increases reactive oxygen species levels and genomic instability in BL cell lines (22,23). The aforementioned findings suggest that EBNA1 may play a direct role in promoting the tumorigenesis of EBV-associated malignancies.

The molecular weight of EBNA1 varies from 69 to 96 kDa, depending on the number of internal glycine-alanine repeats (24–26), which contribute to downregulating EBV-mediated immune responses by inhibiting antigen presentation (27). Sequence variations in EBNA1 relative to that of the prototypic B95.8 strain were first described in sequences N- and C-terminal to the internal repeat regions of EBNA1 proteins isolated from EBV-positive NPC samples obtained in Hong Kong (28). Subsequently, numerous EBNA1 sequences have been identified from healthy individuals and patients with various EBV-associated diseases in different geographic regions (29). Gutiérrez et al (30) classified EBNA1 into the P-ala, P-thr, V-val, V-leu and V-pro subtypes, which were termed according to the amino acid (aa) at position 487 in EBNA1 (numbered according to prototype B95.8 strain). Sub-variants of P-ala, P-thr and V-val, have also been characterized (31–33). Previously, it was shown that within a given geographic area, tumor-associated EBNA1 subtypes were also prevalent in the general population (34). For example, V-val EBNA1 was found exclusively in southeastern Chinese NPC samples, and was also the predominant subtype observed in this general population (32,33,35–37). However, most of the molecular studies on the biological functions of full-length EBNA1 have used the sequence from prototype B95.8, a strain originating from an infectious mononucleosis patient in Africa, and whose EBNA1 belongs to the P-ala subtype (30). Thus it is important to investigate whether any functional differences are associated with genetic variations in EBNA1, and the manner in which they affect risk of disease. Results of such an investigation may provide a better understanding of the molecular mechanisms underlying the associations between EBV-related disease and particular cell types and/or genetic backgrounds.

Consequently, we cloned the full-length EBNA1 gene from CG3 cells (38). This EBV-containing lymphoblastoid cell line was originally established from the bone marrow cells of a chronic myeloid leukemic patient from Taiwan, with V-val being the predominant EBNA1 subtype. As expected, the EBNA1 detected in CG3 cells belonged to the V-val subtype. Subsequently, we purified His-tagged, bacterially expressed N- and C-terminal CG3 EBNA1 fusion proteins and used them to raise EBNA1-reactive antibodies in rabbits. Additionally, we successfully expressed the full-length CG3 EBNA1 in eukaryotic cells, generating an experimental system that was subsequently used to elucidate the oncogenic potential of this V-val EBNA1 subtype.

Materials and methods

Cell lines

CG3 (38) is a spontaneous EBV-carrying lymphoblastoid cell line that was derived from a Taiwanese patient with juvenile chronic myeloid leukemia (kindly provided by Dr Y.S. Chang). B95.8 (39) is a marmoset lymphoid cell line that was EBV-immortalized with a virus originating from an infectious mononucleosis patient, sampled in Africa. Raji (40), P3HR1 (41) and Daudi (42) are EBV-containing human lymphoid cell lines harboring viruses from Burkitt’s lymphoma patients. The cells were maintained in RPMI-1640 supplemented with 10% fetal calf serum (FCS), at 37°C in a humidified 5% CO2 atmosphere. The 293 cell line (a human embryonal kidney cell line) (43) was grown in DMEM supplemented with 10% FCS. The 293-EBNA cells (i.e., 293 cells stably expressing B95.8 EBNA1; Invitrogen-Life Technologies, Carlsbad, CA, USA) were maintained in DMEM-10% FCS containing 250 μg/ml of Geneticin (G418; Gibco-Life Technologies, Carlsbad, CA, USA).

PCR amplification and sequence analysis of the EBNA1 gene from cultured cells

DNA was extracted from CG3 and 293-EBNA cells using a QIAamp DNA Mini kit (Qiagen, Valencia, CA, USA) according to the manufacturer’s instructions. The full-length EBNA1 gene and the sequence encoding its middle repeat region were PCR-amplified using the GC-RICH PCR System (Roche Molecular Biochemicals) according to the manufacturer’s instructions. The sequences of the utilized primers are shown in Table I, with the nucleotide numbering system used in this report being in accordance with that of Baer et al (44). For all PCR reactions discussed herein, the input DNAs were preheated at 95°C for 5 min prior to cycling, and the PCR products were subjected to a final extension for 10 min at 72°C. Briefly, 100 ng of DNA was combined with the provided reaction mixture (containing 0.5 M GC-RICH resolution solution) and subjected to PCR. To amplify the full-length EBNA1 gene, the F1/F2 primers were used along with the following reaction conditions: 30 cycles of 95°C for 1 min, 63°C for 2 min 30 sec and 72°C for 1 min. Nested PCR was required to successfully amplify the internal repeat sequences of EBNA1 (Fig. 1). Primer pairs GA1/GA2 and GA3/GA4 were used for the first and second round of PCR, respectively, under the aforementioned reaction conditions. The PCR products representing the full-length EBNA1 gene from CG3 and 293-EBNA cells were purified and cloned into a T-vector (pCRII-TOPO; Invitrogen) and three independent clones were sequenced (ABI377 DNA sequencing system; Perkin-Elmer/Applied Biosystems). From the clone, plasmids containing consensus sequences for pCRII-TOPO-CG3.1 and pCRII-TOPO-B95.8.1 were selected and used to generate EBNA1 eukaryotic expression vectors that expressed the CG3 and B95.8 EBNA1s, respectively (see below).

Figure 1

Strategy used to clone the EBNA1 gene. The structure of the EBNA1 gene (nt 107950-109872) is shown as the N- and C-terminal portions separated by the internal glycine/alanine repeat sequence. The positions of the utilized PCR primers are indicated by arrows. The bottom diagram summarizes the regions covered by the three His-tagged EBNA1 fusion proteins, which are indicated as hN (aa 1-90), hFC (aa 354-641) and hSC (aa 459-641). The His-tag is denoted by the dotted lines.

Table I

List of primers used for PCR amplification of EBNA 1 sequences.

Table I

List of primers used for PCR amplification of EBNA 1 sequences.

PrimersSequence (5′-3′)B95.8 coordinates
F1 CGTCCAGCAAAAAGGGGGACGAG107671-107693
F2 GCGGAGCTGAGTGACGTGACAAC110062-110040
GA1 CCATGGACGAGGACGGGGAAG108063-108083
GA2 GCTTGGGCCTTCTCCTGGGTCAT109290-109266
GA3 AGGACGAGGAGGCGGAAGACCAG108090-108112
GA4 TGCGGGGCCCTGCTCTATCG109266-109247
R1 CGCCTAGCATATGATGTCTGACGAGGGGCCA NdeI-107950-107967
R2 CCGGGATCCTTATCCTGTTCCACCGTGGGTC BamHI-108219-108202
R3 CGCCTAGCATATGAGGCGCAAAAAAGGAGGGTGG NdeI-109323-109344
R4 CCGGGATCCTTAATATACGAACACACCGGCGAC BamHI-109875-109855
R5 CGCCTAGCATATGCGGGGTAGAGGACGTGAAAGA NdeI-109009-109029
Expression and purification of recombinant EBNA1 proteins in E. coli

pCRII-TOPO-CG3.1 served as the template for PCR amplifying three fragments: the N fragment covering the N-terminus of EBNA1 (aa 1-90), and fragments FC and SC corresponding to two C-terminal regions downstream of the glycine-alanine repeat region (aa 354-641 and 459-641, respectively) (Fig. 1). The N, SC and FC fragments were amplified with primer pairs R1/R2, R3/R4 and R5/R4 (Table I and Fig. 1), respectively. For cloning purposes, restriction enzyme sites were included in the primers. The PCR products were then subjected to NdeI and BamHI double digestion followed by gel purification. The purified products were inserted in-frame at the C-terminus of the His-tag in pET-15b plasmids (Novagen) which had been pretreated with NdeI and BamHI. The resulting plasmids containing the N, FC and SC inserts were designated as pET15b-hN, pET15b-hFC and pET15b-hSC, respectively, and their encoded fusion proteins were referred to as hN, hFC and hSC, respectively. These plasmids were used to transform BL21(DE3)pLysS (Novagen), and the fusion proteins were induced and purified as per the manufacturer’s instructions. Briefly, bacteria were grown to an OD600 of 0.6, 1 mM IPTG was added, and the incubation was continued for 3 h via agitation. The bacterial pellet was collected by centrifugation at 2500 g for 15 min and the cells were lysed by freeze-thawing. The soluble recombinant EBNA1 proteins were purified with one-step metal chelation chromatography (Novagen). The purified hFC was then concentrated using Ultracel-3K (Millipore, Billerica, MA, USA). Equal amounts of the purified fractions were collected, resolved by SDS-PAGE and subjected to Coomassie blue staining. Western blot analysis, as previously described (45), was performed using an anti-His antibody (diluted 1:1,000; Santa Cruz Biotechnology, Inc., Santa Cruz, CA, USA).

Immunization of animals

The backs of New Zealand White rabbits were subcutaneously immunized with 300 μg of hN or hSC in 0.5 ml complete Freund’s adjuvant (v/v 1:1) on day 0, and with the same amount of the corresponding protein in incomplete Freund’s adjuvant (v/v 1:1) (Sigma-Aldrich) on day 20 and were bled on day 27. The obtained antisera were designated Ab-N and Ab-SC, respectively. The animal experimental protocol was reviewed and approved by the Chang Gung University Animal Ethics Committee. The antibody responses were examined by western blot analysis using purified recombinant proteins and extracts prepared from EBV-containing cell lines and EBNA1-transfected 293 cells.

Expression of EBNA1 from eukaryotic vectors

pCRII-TOPO-CG3.1 and pCRII-TOPO-B95.8.1 were digested with BamHI, filled in with Klenow (New England Biolabs, Beverly, MA, USA), and cleaved with XbaI to release the inserts of interest. Plasmid pCMV-EBNA (Clontech), which encoded EBNA1 of the B95.8 strain, was treated with PstI, filled in with Klenow, and digested with XbaI to remove the B95.8 EBNA1 gene, which served as the vector. The insert and vector were gel purified and ligated to generate the eukaryotic expression plasmids, pCMV-CG3EBNA1 and pCMV-B95.8EBNA1. These plasmids were transfected into 293 cells. Briefly, 5×105 cells/wel) were seeded in 6-well (35-mm diameter) plates, grown for 18 h (~60–70% confluency), and then transfected with 4 μg DNA and 10 μl Lipofectamine (Invitrogen), according to the manufacturer’s instructions. At 48 h post-transfection, the cell extracts were collected, resolved by 10% SDS-PAGE, and subjected to western blot analysis (45) with rabbit Ab-SC antibodies. Proteins extracted from 293-EBNA (Invitrogen) and CG3 cells were used as positive controls. To generate 293 cells stably expressing EBNA1 proteins of B95.8 or CG3 origin, or the drug-resistant gene alone (as a control), EBNA1 expression vector- and empty vector-transfected cells were selected in the presence of 500 μg/ml Geneticin (G418; Gibco) and then maintained in medium containing 250 μg/ml Geneticin.

Serum withdrawal and cell survival

Stably transfected 293 cells (2×105 cells/well) were seeded in 6-well plates. At 16 h post-seeding, the cells were washed twice with serum-free medium and then cultured in the absence and presence of FCS. Cell viability was determined at various time points using trypan blue exclusion. Proteins were also extracted at different time points and subjected to western blot analysis using antibodies against poly(ADP-ribose) polymerase (PARP) and actin (diluted 1:600 and 1:5,000, respectively; both from Millipore).

Results

The EBNA1 sequence in CG3 cells

Size polymorphisms and sequence variations have been reported in EBNA1 proteins from different EBV isolates. CG3 is an EBV-containing lymphoblastoid cell line established from a Taiwanese patient with chronic myeloid leukemia (38). To the best of our knowledge, no previous study has reported the size and sequence of its EBNA1 protein. Consequently, PCR was amplified with the full-length EBNA1 gene from CG3 cells. As shown in Fig. 1, PCR reactions using primers F1/F2 and nested primers GA1/GA2 and GA3/GA4 were performed to amplify the full-length EBNA1 gene and its middle domain, respectively. DNA extracted from B95.8 cells was amplified as a control. The full-length gene and its middle region from B95.8 cells were previously predicted to be 2392 and 1177 bp in length, respectively (44). We obtained PCR products consistent with those predicted sizes (Fig. 2A and 2B, lane 2). The PCR products representing the full-length gene and the middle region of EBNA1 from CG3 cells (Fig. 2A and B, lane 1) appeared to be ~150 bp longer than those from B95.8 cells (Fig. 2A and B, lane 2). These data are consistent with previous studies that the molecular mass polymorphisms of EBNA1 across different EBV isolates reflect different numbers of internal glycine-alanine repeats (24–26).

Figure 2

PCR-amplified products of (A) the full-length EBNA1 gene and (B) its middle repeat region, as resolved by 1 and 2% agarose gel electrophoresis, respectively, and visualized by ethidium bromide staining and UV transillumination. Lanes: 1, PCR products from CG3 cells; 2, PCR products from B95.8 cells; and M1 and M2, DNA size markers.

Sequence analysis revealed that the N- and C-terminal regions of the CG3 EBNA1 gene did not contain any insertion or deletion, but harbored a series of nucleotide changes relative to the B95.8 clone. The deduced amino acid sequences of the CG3 clone relative to the B95.8 EBNA1 sequence are shown in Fig. 3. Based on the amino acid at position 487 and the characterized sequence variations at other positions, we determined that the CG3 EBNA1 belongs to the V-val subtype. We identified 4 (aa 16, 18, 20 and 85) and 12 (aa 364, 410, 411, 418, 439, 487, 499, 502, 524, 528, 533 and 594) amino acid substitutions relative to the B95.8 sequence in the N- and C-terminal regions, respectively, of the CG3 EBNA1. By contrast, only three amino acid substitutions (aa 85, 364 and 410) were identified between the CG3 EBNA1 and the EBNA1 isolated from NPC patients of Hong Kong (28), which was the first reported V-val EBNA1.

Figure 3

Amino acid alignment of the N- and C-terminal regions of CG3 EBNA1 relative to the prototype B95.8 EBNA1 sequence. The conserved amino acids are indicated with dots. ‘HK’ is the conserved sequence detected in NPC samples from Hong Kong (28). The position of aa 487 is indicated with an arrow.

Isolation of EBNA1 fusion proteins and generation of rabbit anti-EBNA1 antibodies

Recombinant CG3 EBNA1 proteins covering aa 1-90, 354-641 and 459-641 were expressed as His-tagged N-terminal fusion proteins in E. coli, and were designated as hN-, hFC- and hSC-EBNA1, respectively (Fig. 1). SDS-PAGE and Coomassie blue staining were used to examine the EBNA1 fusion proteins before (Fig. 4A–C, lane C) and after (lanes 1–4) their purification by metal chelation chromatography. The sizes of the EBNA1 fusions were as expected, except that doublet bands were observed for hN (Fig. 4A, lanes 2 and 3). The molecular nature of these doublets remains unknown. As shown in Fig. 4D, fraction 2 of hN (lane 1), fraction 3 of hSC (lane 2), and concentrated pooled hFC (fractions 2 and 3, lane 3) were stained with Coomassie blue. These purified EBNA1 fusions were then analyzed by western blotting using an anti-His antibody (Fig. 4E).

Figure 4

Expression and purification of recombinant EBNA1s expressed in E. coli. The His-tagged EBNA1 fusion proteins, (A) hN-, (B) hFC- and (C) hSC-EBNA1, were expressed in E. coli and recovered by affinity purification. The purified proteins were separated by 15, 10, and 12.5% SDS-PAGE, respectively, and stained with Coomassie blue. Lanes: A and B, protein extracts obtained before and after IPTG induction; C and D, soluble and pellet fractions after induction; and 1-4, the purified fractions. (D and E) The purified proteins were separated by 12% SDS-PAGE followed by (D) Coomassie blue staining or (E) western blot analysis using an anti-His antibody. Lanes: 1, hN-EBNA1; 2, hSC-EBNA1; and 3, hFC-EBNA1. The mobilities of prestained protein markers (GeneTeks BioScience Inc., Taipei, Taiwan) are indicated on the left.

The purified hN and hSC fusion proteins were used to raise antibodies in rabbits, and the resulting antisera were designated as Ab-N and Ab-SC, respectively. As expected, our western blot analysis showed that Ab-N reacted with purified hN (although a significant background was observed; Fig. 5A), while Ab-SC detected hSC and hFC but not hN (Fig. 5B). We determiend the ability of Ab-SC to detect EBNA1 from cell lines carrying various EBNA1 subtypes. As reported in the present and other studies (46,47), the EBNA1 proteins in the B95.8, P3HR1, Daudi and CG3 cell lines correspond to the P-ala, V-leu, P-thr and V-val subtypes, respectively. The EBNA1 protein in Raji cells corresponds to the P-ala subtype, but has amino acid substitutions with respect to B95.8 EBNA1 (47). As shown in Fig. 5C, the Ab-SC antibody reacted with EBNA1 in all of the tested EBNA1-positive cells. As reported previously (26), the molecular weights of the EBNA1 proteins in Raji, B95.8, Daudi, and P3HR1 cells were 69, 79, 78, and 75 kDa, respectively. We obtained results consistent with those prior findings (Fig. 5C), and found that the CG3 EBNA1 was larger than the B95.8 EBNA1 in our western blot analysis (similar to the gene-based findings described earlier and shown in Fig. 2). Collectively, these results showed that our rabbit polyclonal anti-EBNA1 antibodies detected EBNA1 fusion proteins expressed in E. coli, and EBNA1 proteins of various subtypes in different EBV-associated cell lines.

Figure 5

Characterization of rabbit antibodies raised against EBNA1. Purified His-tagged hN, hSC and hFC-EBNA1 fusion proteins were subjected to western blot analysis using our (A) Ab-N (diluted 1:1,000) and (B) Ab-SC (diluted 1:2,000) antibodies. The mobilities of the EBNA1 fusion proteins are shown on the right. (C) Western blot analysis of the reactivity of the rabbit polyclonal Ab-SC antibody to lysates prepared from different EBV-positive cells. Protein samples were separated by 10% SDS-PAGE. (D) Expression of full-length V-val CG3 EBNA1 in transfected eukaryotic cells. EBNA1-expressing plasmids were used to transfect 293 cells. After 48 h, the cell lysates were resolved by 10% SDS-PAGE and the EBNA1 proteins were detected with our rabbit Ab-SC antibody. Cell lysates prepared from CG3 and B95.8 cells were used as size controls. The mobilities of the various EBNA1s are shown on the right, and the mobilities of prestained protein markers (GeneTeks BioScience Inc.) are indicated on the left.

Cloning and expression of the full-length CG3 V-val EBNA1 in cultured cells

Since most of the previous functional studies involved EBNA1 cloned from the B95.8 prototype (which belongs to the P-ala subtype), we subcloned the full-length V-val CG3 EBNA1 gene into a mammalian expression vector. The resulting plasmid, pCMV-CG3EBNA1, was transfected into 293 cells, and EBNA1 expression was examined by western blot analysis using our rabbit Ab-SC antibody (Fig. 5D). The electrophoretic mobility of the expressed CG3 EBNA1 was retarded as compared to that of B95.8 EBNA1, and the plasmid-expressed CG3 and B95.8 EBNA1 proteins were indistinguishable from those of the corresponding EBV-positive cells. These findings indicated that the full-length EBNA1 gene was successfully amplified from EBV-positive samples and expressed in the cultured cells, which in turn should facilitate studies on the functional differences among the different EBNA1 subtypes.

Expression of V-val CG3 EBNA1 supports serum-independent cell proliferation and blocks apoptosis

Growth factor-independent proliferation is considered to be a hallmark of cancer. To study the effect of CG3 EBNA1 on the cell proliferation and apoptosis of serum-starved cells, we generated 293 cells stably expressing CG3 EBNA1 (V-val subtype), B95.8 EBNA1 (P-ala subtype), or the drug-resistance gene alone (empty vector, control). Expression of CG3 EBNA1 (from two independent clones) and B95.8 EBNA1 was confirmed by western blot analysis using our Ab-SC antibody (Fig. 6A). The cells were then cultured in the absence of FCS, and cell viability was determined by trypan blue exclusion. As expected, 293 cell-expressing empty vector demonstrated loss of viability within three days of serum deprivation (Fig. 6B). Cells expressing B95.8 EBNA1 grew exponentially only for one day after serum withdrawal, and then plateaued through to the end of the experiment (day 5). As shown in Fig. 6B, however, the 293 cells expressing two independent clones of CG3 EBNA1 were able to proliferate under serum starvation throughout the experimental period. We also used western blotting to examine the status of PARP, a substrate cleaved by caspases during apoptosis, in 293 cells expressing empty vector, B95.8 EBNA1, and CG3 EBNA1 following serum withdrawal. As shown in Fig. 6C, cells expressing empty vector showed marginal induction of PARP cleavage after 63 h and significant PARP cleavage after 66 h of serum starvation. PARP cleavage was observed after 69 h of serum starvation in cells expressing B95.8 EBNA1. Of note, 293 cells expressing CG3 EBNA1 under serum starvation inhibited PARP cleavage at all of the tested time points. Taken together, these results suggested that CG3 EBNA1 blocked serum withdrawal-induced apoptosis and promoted cell proliferation.

Figure 6

Effects of EBNA1 on cell survival under serum starvation. (A) The CG3 and B95.8 EBNA1s were stably expressed in 293 cells, as confirmed by western blotting. (B) Growth kinetics of 293 cells stably expressing the CG3 and B95.8 EBNA1s under serum-free conditions. Control cells (V) expressed the drug-resistant gene (vector) alone. V, B, CG3-a and CG3-b indicate 293 cells stably expressing the empty vector, B95.8 EBNA1, and two clones of CG3 EBNA1, respectively. (C) Immunoblot detection of PARP cleavage in lysates from control cells (V) and those expressing the B95.8 or CG3-a EBNA1s following serum starvation for 63, 66 and 69 h.

Discussion

EBV has been associated with different malignancies in various geographic regions (1), and EBNA1, which is the only viral protein observed in all EBV-associated tumors, shows region-specific sequence variations (29,34). The B85.8 EBNA1, which belongs to the P-ala subtype, is the most commonly studied EBNA1. However, the V-val subtype predominates in Taiwan. Thus, we cloned and expressed a non-prototypic EBNA1 subtype from a CG3 cell line, an EBV-carrying lymphoblastoid cell line that was derived from a Taiwanese patient with juvenile chronic myeloid leukemia. The GC-rich middle region of the EBNA1-encoding gene, which encodes the glycine-alanine repeats, can complicate the PCR amplification of the EBNA1 gene (28). To clone the full-length V-val EBNA1 gene from CG3 cells, we therefore used commercial resolution buffer to improve the efficiency of the PCR reaction. Our data indicate that we successfully PCR amplified the full-length EBNA1 gene from CG3 cells. Using our protocol, therefore, the full-length EBNA1 genes of various subtypes may be readily amplified from EBV-positive samples, potentially facilitating studies of their functional differences (especially in the context of EBV-related disease).

Variations in the EBNA1 sequences relative to the prototype strain, B95.8, were first described in EBV isolates from NPC samples obtained in Hong Kong (28). These variations were subsequently classified into the V-val subtype, based on the system established by Gutiérrez et al (30). In the present study, we demonstrate that the EBNA1 protein expressed in the CG3 cell line, which is associated with chronic myeloid leukemia, also belongs to the V-val subtype. This finding is consistent with previous studies that V-val EBNA1 is the predominant subtype detected in healthy Taiwanese individuals and Taiwanese patients with EBV-associated diseases (32,37,47). Furthermore, our sequencing results revealed only minor changes in the EBNA1 sequence (one and two amino acid substitutions in the N- and C-terminal domains, respectively) relative to the EBNA1 sequences found in NPC samples from Hong Kong. In the future, larger-scale sequence analyses and functional analyses of samples collected from different tumors are required to elucidate the role of these sequence variations in the tissue tropism of EBV.

To further characterize EBNA1 and establish a good source of antigens and antibodies for use in functional studies and as diagnostic reagents, we subcloned the N- and C-terminal regions of the CG3 V-val EBNA1 into a bacterial expression vector to produce His-tagged fusion proteins, and then raised the corresponding antibodies in rabbits. The purified EBNA1 fusion proteins and rabbit polyclonal antibodies constitute specific and biologically safe reagents. They are good reagents for the diagnosis of EBV infection, the immunodetection of EBNA1 in western blot analysis, and potentially for a large-scale ELISA-based screening program that may provide diagnostic and epidemiological information on EBV-related diseases.

Most of the existing studies regarding the functional roles of EBNA1 in the tumorigenesis of EBV have used the cloned B95.8 EBNA1 (a P-ala EBNA1) or EBV-containing cell lines carrying EBNA1 of unknown subtypes. In the present study, we constructed a eukaryotic expression plasmid containing a V-val EBNA1 gene originally derived from chronic myeloid leukemia. We found that the expression of this V-val EBNA1 in 293 cells supported cell growth and inhibited apoptosis (two important characteristics for an oncogene) under serum starvation. This V-val EBNA1 expression plasmid provides a good experimental tool to determine, whether the V-val EBNA1 can promote oncogenesis in the absence of other EBV sequences, and whether the V-val EBNA1 and the P-ala prototype show functional differences in contributing to the development of EBV-associated malignancies.

Although NPC has been identified worldwide, its incidence varies among population groups, with the highest incidence observed in southern Chinese males (48). V-val EBNA1 is the only viral protein that has been observed in all NPC samples from southern China (28,33,36,37,49). Thus, future studies should be conducted to examine how this EBNA1 subtype may contribute to the pathogenesis of NPC in high-incidence areas. Since we successfully established a protocol for amplifying the full-length EBNA1 gene from EBV-positive samples, it should now be possible to clone and express the V-val EBNA1 from various NPC samples. Previous studies have indicated that some of the variations observed between the P-ala and V-val EBNA1s lie in the DNA-binding region (28,33,49). EBNA1 and FR derived from Asian isolates induced higher transcriptional activity than those from the B95.8 strain, as assessed using a luciferase reporter system (33,35). Findings of a previous study have indicated that the expression of V-val EBNA1 isolated from an NPC biopsy had no effect on 293 cell growth under normal growth conditions (49). However, the authors observed that the fluorescence from GFP reporter was more intense in 293 cells expressing a V-val-EBNA1-GFP plasmid compared with a P-ala-EBNA1-GFP plasmid after long-term culture. V-val and P-thr EBNA1s have been detected in NPC samples obtained from Beijing Hospital (31) and North Africa (28,30), whereas P-ala and P-thr (but not V-val) were detected in NPC samples from Denmark, which is an area of low NPC risk (31). The V-leu subtype has not been found in NPC patients, even in areas in which it is not a rare EBNA 1 subtype (30,46). Since NPC differs clinically and molecularly in different regions of the world (50), we conclude a possible association of V-val with undifferentiated NPC in southern China, and/or the possibility that yet-unidentified genetic polymorphisms in EBNA1 (e.g., the number of internal glycine-alanine repeats) may be important in the tumorigenesis of NPC.

The results of the present study suggest that V-val EBNA1 isolated from a chronic myeloid leukemia-derived cell line potentially contribute to regulating proliferation and anti-apoptosis in 293 cells. We also introduced a cloning strategy that may be used to compare the biological functions of fulllength EBNA1s isolated from specific populations, such as patients with EBV-associated disease as compared to healthy individuals from the same geographic region. Such investigations are likely to considerably improve our understanding of the polymorphic patterns of EBNA1 and their associations with malignancies in different geographic regions.

Acknowledgements

This study was supported by the Chang Gung Memorial Hospital (CMRPD32039, 160071-3, and 190111-2).

References

1 

Young LS and Murray PG: Epstein-Barr virus and oncogenesis: from latent genes to tumours. Oncogene. 22:5108–5121. 2003. View Article : Google Scholar : PubMed/NCBI

2 

Schepers A, Ritzi M, Bousset K, et al: Human origin recognition complex binds to the region of the latent origin of DNA replication of Epstein-Barr virus. EMBO J. 20:4588–4602. 2001. View Article : Google Scholar : PubMed/NCBI

3 

Sears J, Kolman J, Wahl GM and Aiyar A: Metaphase chromosome tethering is necessary for the DNA synthesis and maintenance of oriP plasmids but is insufficient for transcription activation by Epstein-Barr nuclear antigen 1. J Virol. 77:11767–11780. 2003. View Article : Google Scholar : PubMed/NCBI

4 

Nanbo A, Sugden A and Sugden B: The coupling of synthesis and partitioning of EBV’s plasmid replicon is revealed in live cells. EMBO J. 26:4252–4262. 2007. View Article : Google Scholar : PubMed/NCBI

5 

Sugden B and Warren N: A promoter of Epstein-Barr virus that can function during latent infection can be transactivated by EBNA-1, a viral protein required for viral DNA replication during latent infection. J Virol. 63:2644–2649. 1989.PubMed/NCBI

6 

Altmann M, Pich D, Ruiss R, Wang J, Sugden B and Hammerschmidt W: Transcriptional activation by EBV nuclear antigen 1 is essential for the expression of EBV’s transforming genes. Proc Natl Acad Sci USA. 103:14188–14193. 2006. View Article : Google Scholar

7 

Gahn TA and Sugden B: An EBNA-1-dependent enhancer acts from a distance of 10 kilobase pairs to increase expression of the Epstein-Barr virus LMP gene. J Virol. 69:2633–2636. 1995.PubMed/NCBI

8 

Sample J, Henson EB and Sample C: The Epstein-Barr virus nuclear protein 1 promoter active in type I latency is autoregulated. J Virol. 66:4654–4661. 1992.PubMed/NCBI

9 

Sung NS, Wilson J, Davenport M, Sista ND and Pagano JS: Reciprocal regulation of the Epstein-Barr virus BamHI-F promoter by EBNA-1 and an E2F transcription factor. Mol Cell Biol. 14:7144–7152. 1994.PubMed/NCBI

10 

Frappier L: Role of EBNA1 in NPC tumourigenesis. Semin Cancer Biol. 22:154–161. 2012. View Article : Google Scholar

11 

Westhoff Smith D and Sugden B: Potential cellular functions of Epstein-Barr nuclear antigen 1 (EBNA1) of Epstein-Barr virus. Viruses. 5:226–240. 2013. View Article : Google Scholar : PubMed/NCBI

12 

Kennedy G, Komano J and Sugden B: Epstein-Barr virus provides a survival factor to Burkitt’s lymphomas. Proc Natl Acad Sci USA. 100:14269–14274. 2003. View Article : Google Scholar

13 

Holowaty MN, Zeghouf M, Wu H, et al: Protein profiling with Epstein-Barr nuclear antigen-1 reveals an interaction with the herpesvirus-associated ubiquitin-specific protease HAUSP/USP7. J Biol Chem. 278:29987–29994. 2003. View Article : Google Scholar : PubMed/NCBI

14 

Holowaty MN, Sheng Y, Nguyen T, Arrowsmith C and Frappier L: Protein interaction domains of the ubiquitin-specific protease, USP7/HAUSP. J Biol Chem. 278:47753–47761. 2003. View Article : Google Scholar : PubMed/NCBI

15 

Wilson JB, Bell JL and Levine AJ: Expression of Epstein-Barr virus nuclear antigen-1 induces B cell neoplasia in transgenic mice. EMBO J. 15:3117–3126. 1996.PubMed/NCBI

16 

Murakami M, Lan K, Subramanian C and Robertson ES: Epstein-Barr virus nuclear antigen 1 interacts with Nm23-H1 in lymphoblastoid cell lines and inhibits its ability to suppress cell migration. J Virol. 79:1559–1568. 2005. View Article : Google Scholar : PubMed/NCBI

17 

Kaul R, Murakami M, Choudhuri T and Robertson ES: Epstein-Barr virus latent nuclear antigens can induce metastasis in a nude mouse model. J Virol. 81:10352–10361. 2007. View Article : Google Scholar : PubMed/NCBI

18 

O’Neil JD, Owen TJ, Wood VH, et al: Epstein-Barr virus-encoded EBNA1 modulates the AP-1 transcription factor pathway in nasopharyngeal carcinoma cells and enhances angiogenesis in vitro. J Gen Virol. 89:2833–2842. 2008. View Article : Google Scholar

19 

Wood VH, O’Neil JD, Wei W, Stewart SE, Dawson CW and Young LS: Epstein-Barr virus-encoded EBNA1 regulates cellular gene transcription and modulates the STAT1 and TGFbeta signaling pathways. Oncogene. 26:4135–4147. 2007. View Article : Google Scholar : PubMed/NCBI

20 

Flavell JR, Baumforth KR, Wood VH, et al: Down-regulation of the TGF-beta target gene, PTPRK, by the Epstein-Barr virus encoded EBNA1 contributes to the growth and survival of Hodgkin lymphoma cells. Blood. 111:292–301. 2008. View Article : Google Scholar

21 

Valentine R, Dawson CW, Hu C, et al: Epstein-Barr virus-encoded EBNA1 inhibits the canonical NF-kappaB pathway in carcinoma cells by inhibiting IKK phosphorylation. Mol Cancer. 9:12010. View Article : Google Scholar : PubMed/NCBI

22 

Gruhne B, Sompallae R, Marescotti D, Kamranvar SA, Gastaldello S and Masucci MG: The Epstein-Barr virus nuclear antigen-1 promotes genomic instability via induction of reactive oxygen species. Proc Natl Acad Sci USA. 106:2313–2318. 2009. View Article : Google Scholar : PubMed/NCBI

23 

Gruhne B, Sompallae R and Masucci MG: Three Epstein-Barr virus latency proteins independently promote genomic instability by inducing DNA damage, inhibiting DNA repair and inactivating cell cycle checkpoints. Oncogene. 28:3997–4008. 2009. View Article : Google Scholar : PubMed/NCBI

24 

Hennessy K and Kieff E: One of two Epstein-Barr virus nuclear antigens contains a glycine-alanine copolymer domain. Proc Natl Acad Sci USA. 80:5665–5669. 1983. View Article : Google Scholar : PubMed/NCBI

25 

Hennessy K, Heller M, van Santen V and Kieff E: Simple repeat array in Epstein-Barr virus DNA encodes part of the Epstein-Barr nuclear antigen. Science. 220:1396–1398. 1983. View Article : Google Scholar : PubMed/NCBI

26 

Allday MJ and MacGillivray AJ: Epstein-Barr virus nuclear antigen (EBNA): size polymorphism of EBNA 1. J Gen Virol. 66:1595–1600. 1985. View Article : Google Scholar : PubMed/NCBI

27 

Levitskaya J, Coram M, Levitsky V, et al: Inhibition of antigen processing by the internal repeat region of the Epstein-Barr virus nuclear antigen-1. Nature. 375:685–688. 1995. View Article : Google Scholar : PubMed/NCBI

28 

Snudden DK, Smith PR, Lai D, Ng MH and Griffin BE: Alterations in the structure of the EBV nuclear antigen, EBNA1, in epithelial cell tumours. Oncogene. 10:1545–1552. 1995.PubMed/NCBI

29 

Chang CM, Yu KJ, Mbulaiteye SM, Hildesheim A and Bhatia K: The extent of genetic diversity of Epstein-Barr virus and its geographic and disease patterns: a need for reappraisal. Virus Res. 143:209–221. 2009. View Article : Google Scholar : PubMed/NCBI

30 

Gutiérrez MI, Raj A, Spangler G, et al: Sequence variations in EBNA-1 may dictate restriction of tissue distribution of Epstein-Barr virus in normal and tumour cells. J Gen Virol. 78:1663–1670. 1997.PubMed/NCBI

31 

Sandvej K, Zhou XG and Hamilton-Dutoit S: EBNA-1 sequence variation in Danish and Chinese EBV-associated tumours: evidence for geographical polymorphism but not for tumour-specific subtype restriction. J Pathol. 191:127–131. 2000. View Article : Google Scholar : PubMed/NCBI

32 

Wang JT, Sheeng TS, Su IJ, Chen JY and Chen MR: EBNA-1 sequence variations reflect active EBV replication and disease status or quiescent latency in lymphocytes. J Med Virol. 69:417–425. 2003. View Article : Google Scholar : PubMed/NCBI

33 

Do NV, Ingemar E, Phi PT, et al: A major EBNA1 variant from Asian EBV isolates shows enhanced transcriptional activity compared to prototype B95.8. Virus Res. 132:15–24. 2008. View Article : Google Scholar

34 

Habeshaw G, Yao QY, Bell AI, Morton D and Rickinson AB: Epstein-Barr virus nuclear antigen 1 sequences in endemic and sporadic Burkitt’s lymphoma reflect virus strains prevalent in different geographic areas. J Virol. 73:965–975. 1999.PubMed/NCBI

35 

Mai SJ, Xie D, Huang YF, et al: The enhanced transcriptional activity of the V-val subtype of Epstein-Barr virus nuclear antigen 1 in epithelial cell lines. Oncol Rep. 23:1417–1424. 2010.PubMed/NCBI

36 

Zhang XS, Wang HH, Hu LF, et al: V-val subtype of Epstein-Barr virus nuclear antigen 1 preferentially exists in biopsies of nasopharyngeal carcinoma. Cancer Lett. 211:11–18. 2004. View Article : Google Scholar : PubMed/NCBI

37 

Wang WY, Chien YC, Jan JS, Chueh CM and Lin JC: Consistent sequence variation of Epstein-Barr virus nuclear antigen 1 in primary tumor and peripheral blood cells of patients with nasopharyngeal carcinoma. Clin Cancer Res. 8:2586–2590. 2002.PubMed/NCBI

38 

Chang YS, Shih LY, Peng CL, Chen SH and Liu ST: Characterization of two newly established EBV-containing lymphoblastoid cell lines from patients with myeloid leukemias. Leuk Res. 14:309–320. 1990. View Article : Google Scholar : PubMed/NCBI

39 

Miller G, Shope T, Lisco H, Stitt D and Lipman M: Epstein-Barr virus: transformation, cytopathic changes, and viral antigens in squirrel monkey and marmoset leukocytes. Proc Natl Acad Sci USA. 69:383–387. 1972. View Article : Google Scholar : PubMed/NCBI

40 

Pulvertaft JV: A study of malignant tumours in Nigeria by shortterm tissue culture. J Clin Pathol. 18:261–273. 1965. View Article : Google Scholar : PubMed/NCBI

41 

Hinuma Y and Grace JT Jr: Cloning of immunoglobulin-producing human leukemic and lymphoma cells in long-term cultures. Proc Soc Exp Biol Med. 124:107–111. 1967. View Article : Google Scholar : PubMed/NCBI

42 

Arrand JR, Walsh-Arrand JE and Rymo L: Cytoplasmic RNA from normal and malignant human cells shows homology to the DNAs of Epstein-Barr virus and human adenoviruses. EMBO J. 2:1673–1683. 1983.PubMed/NCBI

43 

Graham FL, Smiley J, Russell WC and Nairn R: Characteristics of a human cell line transformed by DNA from human adenovirus type 5. J Gen Virol. 36:59–74. 1977. View Article : Google Scholar : PubMed/NCBI

44 

Baer R, Bankier AT, Biggin MD, et al: DNA sequence and expression of the B95-8 Epstein-Barr virus genome. Nature. 310:207–211. 1984. View Article : Google Scholar : PubMed/NCBI

45 

Wang TC and Chao M: Molecular cloning and expression of the hepatitis delta virus genotype IIb genome. Biochem Biophys Res Commun. 303:357–363. 2003. View Article : Google Scholar : PubMed/NCBI

46 

Bhatia K, Raj A, Guitierrez MI, et al: Variation in the sequence of Epstein-Barr virus nuclear antigen 1 in normal peripheral blood lymphocytes and in Burkitt’s lymphomas. Oncogene. 13:177–181. 1996.PubMed/NCBI

47 

Chen MR, Tsai CH, Wu FF, Kan SH, Yang CS and Chen JY: The major immunogenic epitopes of Epstein-Barr virus (EBV) nuclear antigen 1 are encoded by sequence domains which vary among nasopharyngeal carcinoma biopsies and EBV-associated cell lines. J Gen Virol. 80:447–455. 1999.PubMed/NCBI

48 

Niedobitek G: Epstein-Barr virus infection in the pathogenesis of nasopharyngeal carcinoma. Mol Pathol. 53:248–254. 2000. View Article : Google Scholar : PubMed/NCBI

49 

Mai SJ, Ooka T, Li DJ, et al: Functional advantage of NPC-related V-val subtype of Epstein-Barr virus nuclear antigen 1 compared with prototype in epithelial cell line. Oncol Rep. 17:141–146. 2007.

50 

de Thé G: Nasopharyngeal carcinoma. Viral Infections of Humans, Epidemiology and Control. Evans AS and Kazslow RA: 4th edition. Plenum Medical Book Co; New York, NY: pp. 935–967. 1997, View Article : Google Scholar

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Chao M, Wang H, Lu YJ, Chang Y and Yu J: The V-val subtype Epstein-Barr virus nuclear antigen 1 promotes cell survival after serum withdrawal. Oncol Rep 33: 958-966, 2015.
APA
Chao, M., Wang, H., Lu, Y.J., Chang, Y., & Yu, J. (2015). The V-val subtype Epstein-Barr virus nuclear antigen 1 promotes cell survival after serum withdrawal. Oncology Reports, 33, 958-966. https://doi.org/10.3892/or.2014.3625
MLA
Chao, M., Wang, H., Lu, Y. J., Chang, Y., Yu, J."The V-val subtype Epstein-Barr virus nuclear antigen 1 promotes cell survival after serum withdrawal". Oncology Reports 33.2 (2015): 958-966.
Chicago
Chao, M., Wang, H., Lu, Y. J., Chang, Y., Yu, J."The V-val subtype Epstein-Barr virus nuclear antigen 1 promotes cell survival after serum withdrawal". Oncology Reports 33, no. 2 (2015): 958-966. https://doi.org/10.3892/or.2014.3625
Copy and paste a formatted citation
x
Spandidos Publications style
Chao M, Wang H, Lu YJ, Chang Y and Yu J: The V-val subtype Epstein-Barr virus nuclear antigen 1 promotes cell survival after serum withdrawal. Oncol Rep 33: 958-966, 2015.
APA
Chao, M., Wang, H., Lu, Y.J., Chang, Y., & Yu, J. (2015). The V-val subtype Epstein-Barr virus nuclear antigen 1 promotes cell survival after serum withdrawal. Oncology Reports, 33, 958-966. https://doi.org/10.3892/or.2014.3625
MLA
Chao, M., Wang, H., Lu, Y. J., Chang, Y., Yu, J."The V-val subtype Epstein-Barr virus nuclear antigen 1 promotes cell survival after serum withdrawal". Oncology Reports 33.2 (2015): 958-966.
Chicago
Chao, M., Wang, H., Lu, Y. J., Chang, Y., Yu, J."The V-val subtype Epstein-Barr virus nuclear antigen 1 promotes cell survival after serum withdrawal". Oncology Reports 33, no. 2 (2015): 958-966. https://doi.org/10.3892/or.2014.3625
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team