Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Oncology Reports
Join Editorial Board Propose a Special Issue
Print ISSN: 1021-335X Online ISSN: 1791-2431
Journal Cover
October-2015 Volume 34 Issue 4

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
October-2015 Volume 34 Issue 4

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article Open Access

Impact of reduced levels of APE1 transcripts on the survival of patients with urothelial carcinoma of the bladder

  • Authors:
    • Mariana Chantre-Justino
    • Gilda Alves
    • Constança Britto
    • Angélica Cardoso
    • Luciano Scherrer
    • Aline dos Santos Moreira
    • Raul Quirino
    • Antonio Ornellas
    • Alvaro Leitão
    • Claudia Lage
  • View Affiliations / Copyright

    Affiliations: Carlos Chagas Filho Institute of Biophysics, Rio de Janeiro Federal University, Rio de Janeiro, Brazil, Research Coordination, National Institute of Cancer (INCA), Rio de Janeiro, Brazil, Molecular Biology and Endemic Diseases Laboratory, Oswaldo Cruz Foundation (FIOCRUZ), Rio de Janeiro, Brazil, Brazilian Society of Clinical Oncology, Belo Horizonte, Minas Gerais, Brazil, DNA Sequencing Platform, PDTIS/FIOCRUZ, Rio de Janeiro, Brazil, Department of Urology, National Institute of Cancer, Rio de Janeiro, Brazil
    Copyright: © Chantre-Justino et al. This is an open access article distributed under the terms of Creative Commons Attribution License.
  • Pages: 1667-1674
    |
    Published online on: July 24, 2015
       https://doi.org/10.3892/or.2015.4151
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

Molecular evidence indicates that alterations in genes involved in the maintenance of genome stability may be related to susceptibility to bladder carcinoma. Our goal was to evaluate the prognostic role of base excision repair (BER) genes in a cohort of patients diagnosed with primary urothelial carcinoma of the bladder (UCB). The levels of all APE1, XRCC1 and POLB transcripts were detected by quantitative real-time PCR (qPCR) technique in tumor samples from 52 patients undergoing transurethral resection (TUR) for primary UCB at the Department of Urology, Brazilian National Cancer Institute, Rio de Janeiro. Increased levels of APE1, XRCC1 and POLB transcripts were significantly associated with high-grade tumors when compared to these levels in low-grade tumors (p<0.01) and could be attributed to different mechanisms of transcriptional regulation as a response to tumorigenesis and oxidative stress. By analyzing the collected data in the present study, regardless of pathological grade or stage, univariate analysis revealed that the reduced levels of APE1 transcripts were significantly associated with cancer-specific mortality (p=0.032). Furthermore, the variant genotype (TG/GG) of the APE1 T1349G polymorphism was observed in 75% of a subset of patients who concomitantly experienced reduced levels of the APE1 transcript and death and/or recurrence events. Taken together, our data reinforce the idea that human DNA repair mechanisms must be finely regulated in order to avoid instability leading to tumorigenesis and poor clinical outcomes in UCB patients.

Introduction

Urothelial carcinoma of the bladder (UCB) is the second most common genitourinary tumor in men, significantly increasing worldwide cancer statistics. The overall survival rate for bladder cancer recorded for a five-year follow-up period is ~78% (1). It is a heterogeneous neoplasm of unpredictable clinical course. Approximately 75% of cases are classified as non-muscle invasive bladder cancer (NMIBC; pTa/pT1 stage) at initial diagnosis. The remaining 25% of cases consist of tumors displaying the ability of muscular invasion and are classified as muscle invasive bladder cancer (MIBC; pT2–pT4 stage). Genetic studies suggest that the events of initiation, promotion, and progression of UCB can be described by a model based on two distinct molecular alteration patterns showing divergent clinical behavior (2–4). Tobacco smoking and occupational exposure to aromatic amines are considered well-established exogenous risk factors for UCB (5). Furthermore, genetic and epigenetic alterations also contribute to UCB risk (6–9). Thus, interaction between environmental exposure and genetic susceptibility can greatly increase DNA damage and thus trigger urothelial precancerous events; therefore, the prompt elimination of such damage counteracts malignant transformation (10).

DNA repair mechanisms are multistep processes essential for maintaining genomic stability. Distinct DNA repair pathways recognize different types of DNA damage (11,12). The base excision repair (BER) pathway plays a critical role by removing nucleobase modifications by oxidation, alkylation, deamination, and also backbone single-strand DNA (ssDNA) breaks (13). A BER malfunction could thus lead to accumulation of DNA lesions with a direct impact on the risk of tumorigenesis, including UCB (14). The enzyme APE1 has a mainframe role in BER by correcting apurinic/apyrimidinic (AP) sites, which are pre-mutagenic lesions able to stall DNA replication forks. Besides its role in DNA repair, APE1 is also a transcriptional regulator of gene expression (15). The protein XRCC1 plays a crucial role in BER. Although no direct catalytic activity has been observed for XRCC1, it operates as a scaffold protein for other BER enzymes (16,17). DNA polymerase β (Pol β), a member of the X family DNA polymerases, is the major polymerase in BER due to its dRP-lyase activity and the main gap-filling enzyme (18).

Several molecular markers have been investigated to improve UCB diagnosis and to provide potential therapeutic targets. Gene expression profiling has been used as a strategy to identify molecular subtypes, which could refine the classification of bladder tumors (19–21). However, to date, no analyzed marker has appeared conclusive for clinical practice. The aim of the present study was to investigate whether variations in the levels of transcripts APE1, XRCC1 and POLB could influence the clinical outcomes of patients diagnosed with primary UCB. The analyses were performed by quantitative real-time PCR (qPCR) methodology (22). Our findings suggest a significant correlation between the reduced levels of APE1 transcripts and the poor survival of UCB patients.

Materials and methods

Patient database

Fifty-two patients diagnosed with primary UCB submitted to transurethral resection (TUR) at the Department of Urology, Brazilian National Cancer Institute, Rio de Janeiro, between 2004 and 2009 were eligible for this study. After TUR, fresh tissue samples were immediately stored in liquid nitrogen until further analysis. This project was approved by the Ethics Committee of the Brazilian National Cancer Institute. At recruitment, informed consent was obtained from each eligible subject. Patient records were accessed to collect the following information: date of registration at the hospital, age at diagnosis, gender, pathological grade and stage, recurrence, and disease-specific mortality (DSM).

The specimens obtained were classified as 25 low-grade papillary urothelial carcinoma and 27 high-grade papillary urothelial carcinoma. Pathological staging consisted of 42 NMIBC specimens (Ta/T1 stage) and 10 MIBC specimens (T2–T4 stage). The study group included 43 men and 9 women with a mean age of 68 years (range 48 to 92). Median follow-up was 55.5 months (range 2 to 101 months). Disease recurred in 51.9% of all patients (range 1 to 33 months) and 23.1% died (range 3 to 95 months) of UCB. Table I shows the major clinicopathologic characteristics of the UCB patients in this study.

Table I

Characteristics of the investigated UCB patients.

Table I

Characteristics of the investigated UCB patients.

CharacteristicsData
No. of patients with primary tumor diagnosis52
Mean age (years)68
Gender, n (%)
 Female9 (17)
 Male43 (83)
Grade, n (%)
 Low-grade (LG)25 (48)
 High-grade (HG)27 (52)
Stage, n (%)
 Ta/T142 (81)
 T2–T410 (19)
Follow-up (months)55.5
Disease-specific mortality (DSM), n (%)
 Low-grade (LG)5 (20)
 High-grade (HG)7 (26)
 Ta/T17 (17)
 T2–T45 (50)
Recurrence, n (%)
 Low-grade (LG)12 (48)
 High-grade (HG)15 (55.6)
 Ta/T119 (45.2)
 T2–T48 (80)
RNA isolation and cDNA synthesis

Total RNA was isolated from tissue samples using TRIzol® reagent according to the manufacturer's instructions (Invitrogen, Carlsbad, CA, USA). After the extraction process, all samples were treated with DNase I (RNase-free) [Uniscience, New England Biolabs (NEB), Ipswich, MA, USA] to remove any residual DNA from the previous step. RNA quality was evaluated using 1% agarose gel electrophoresis in 1X TBE buffer (Tris-borate-EDTA in DEPC water). Subsequently, RNA quantification was performed on the NanoDrop spectrophotometer (Thermo Scientific, Waltham, MA, USA) and the 260/280 nm ratio was measured to obtain RNA purity. Total RNA (1 µg) was converted by reverse transcription to cDNA using the SuperScript™ II reverse transcriptase and random primers (both from Invitrogen), according to the manufacturer's instructions. Following cDNA synthesis, the samples were stored at −20°C.

Quantitative real-time PCR analysis

The relative expression of target transcripts was compared with cDNA pools from non-cancerous tissues adjacent to the tumor, which were used as reference samples. Quantitative real-time PCR (qPCR) reactions were performed with 100 ng cDNA samples in uniplex reactions by using a mix of Platinum® SYBR®-Green qPCR SuperMix-UDG (Invitrogen) in Platform Applied Biosystems (ABI PRISM® 7000 sequence detection system; Applied Biosystems, Foster City, CA, USA). Details regarding GenBank accession numbers, primer sequences, Tm values, and amplicon length are listed in Table II. The GAPDH gene was used as reference and its expression level was measured in all samples individually to normalize APE1, XRCC1 and POLB expression. The relative quantification of the results obtained by qPCR was based on the comparative Ct method (2−ΔΔCt).

Table II

GenBank accession no., primer sequences, amplicon length and the expected Tm value for the qPCR assays.

Table II

GenBank accession no., primer sequences, amplicon length and the expected Tm value for the qPCR assays.

GeneGenBank accession no.Forward primer (5′→3′)Reverse primer (5′→3′)Amplicon length (bp)TM value(°C)
APE1NM_001641 CAATACTGGTCAGCTCCTTCGG TCATGCTCCTCATCGCCTATG12783
XRCC1NM_006297 GACACTTACCGAAAATGGCGG GCCATCATTCCCAATGTCCA11183
POLBNM_002690 CAATGAGTACACCATCCGTCCC GTTCCCGGTATTTCCACTGGA11081
GAPDHNM_001256799 GCAAATTCCATGGCACCGT TCGCCCCACTTGATTTTGG10682

[i] APE1, apurinic/apyrimidinic (AP) endonuclease; XRCC1: X-ray repair cross-complementing protein 1; POLB, DNA polymerase β; GAPDH, glyceraldehyde-3-phosphate dehydrogenase.

The qPCR conditions were conducted as follows: 1 cycle at 50°C (5 min) and 94°C (3 min) for enzyme activation, followed by 40 cycles at 94°C (45 sec), 50°C (30 sec), 72°C (30 sec), and a subsequent final extension at 72°C (5 min). Net gene expression for each patient was then compared, as a panel, for low- and high-grade bladder tumors.

Genotyping

Genotyping assays to evaluate the APE1 T1349G polymorphism were performed by sequencing cDNA samples. The PCR amplification was carried out in the Veriti® Thermal Cycler (Applied Biosystems) by using the primers 5′-GCTTCGAGCCTGGATTAAGAA-3′ (forward) and 5′-GGCCTGCATTAGGTACATATGCT-3′ (reverse) to amplify the target fragment of APE1. PCR conditions were 94°C (10 min), followed by 40 cycles of 94°C (45 sec), 50°C (30 sec), and 72°C (30 sec), and subsequent final extension at 72°C (5 min). PCR products were purified by using GFX PCR DNA and Gel Band Purification kit (GE Healthcare Life Sciences, Chalfont, UK), according to the manufacturer's instructions. The cDNA sequencing was carried out on the Sequencer 3130 Genetic Analyzer (Applied Biosystems) and the results were analyzed with the Sequencher Program (Gene Codes Corporation, Ann Arbor, MI, USA) using the reference sequence from NCBI (NM_001244249.1).

Statistical analyses

Contingency tables were used to associate UCB tumor grade (low-grade vs. high-grade) and stage (pTa/pT1 vs. pT2-pT4) with clinical outcomes of recurrence and DSM. The Fisher's exact test was adopted to test the statistical significance of the association between these parameters. Statistical analysis was carried out with statistical program R (v.2.15.1). The association between tumor grade and stage with expression profile was evaluated by non-parametric Mann-Whitney test with SPSS software (v.17.0). The optimal cut-off point for sensitivity and specificity of the transcripts was estimated by receiver operating characteristic (ROC) curves. Univariable recurrence and survival probabilities were estimated by using the Kaplan-Meier method. Univariable and multivariable Cox regression models addressed time to recurrence and mortality. For all statistical tests, p<0.05 was considered to indicate a statistically significant result.

Results

Association of APE1, XRCC1 and POLB transcript levels and clinicopathological parameters

All samples from MIBC patients (T2-T4 stage) were also classified as high-grade tumors and are referred to in Fig. 1 as HG5, HG8, HG9, HG10, HG11, HG13, HG22, HG23, HG24, and HG25. As shown in Table III, APE1, XRCC1 and POLB transcript levels were similar between the NMIBC (Ta/T1) and MIBC (T2–T4) groups and therefore were not associated with stage (p>0.05).

Figure 1

Panel of variations in transcripts levels for APE1, XRCC1 and POLB in low- and high-grade bladder tumors. The levels of all transcripts were normalized against GAPDH levels. Ratios <0.70 indicate reduced levels and are highlighted in green; ratios of 0.70–1.29 are in gray and represent similar levels to reference samples; ratios ≥1.30 are in red and show elevated levels. The symbol (−) represents a transcript not analyzed due to insufficient quantity of sample from patient HG11. The cut-off values of transcripts levels were arbitrarily chosen at 30% above or below the levels of normal mucosa adjacent to the tumor. APE1, apurinic/apyrimidinic (AP) endonuclease; XRCC1: X-ray repair cross-complementing protein 1; POLB, DNA polymerase β.

Table III

Median variation in transcript levels in each UCB group.

Table III

Median variation in transcript levels in each UCB group.

TranscriptsMedian value of transcript expression
P-valueMedian value of transcript expression
P-value
Low-grade (n=25)High-grade (n=27)Ta/T1 stage (n=10)T2–T4 stage (n=42)
APE10.611.440.005a1.181.380.745
XRCC10.221.310.000a0.901.120.150
POLB0.572.200.000a1.351.730.235

a p<0.01 represents a significant difference. APE1, apurinic/apyrimidinic (AP) endonuclease; XRCC1, X-ray repair cross-complementing protein 1; POLB, DNA polymerase β.

However, as summarized in Table III, statistical analysis revealed highly significant differences in BER transcript levels between low- and high-grade groups (p<0.01). In particular, increased levels of APE1, XRCC1 and POLB transcripts were detected in high-grade tumors (Fig. 1 and Table III).

According to Fig. 1, reduced levels of XRCC1 transcripts were observed in 92% of low-grade tumors, followed by APE1 (64%) and POLB (60%). In addition, the triple combination of reduced levels of APE1/XRCC1/POLB transcripts was observed in 40% of this tumor group. With regard to high-grade tumors, high levels of POLB transcripts were detected in nearly 77% of these tumors, followed by APE1 (52%) and XRCC1 (52%). Likewise, our data revealed that 33.3% of high-grade tumors exhibited combined increased levels of the APE1/XRCC1/POLB transcripts.

By observing the panel displayed in Fig. 1, it can be seen that expression of at least one of the BER genes varied among tumor samples of all UCB patients investigated in the present study, appearing different from the levels detected in the noncancerous samples. These findings place BER gene transcriptional activity as a common genetic alteration in UCB pathogenesis.

Correlation of clinicopathological characteristics with clinical outcomes

To assess whether tumor grade or stage has an influence on clinical outcomes, we investigated the relationship between these parameters. The presence of the first recurrence episode was associated with neither tumor stage nor tumor grade (Table IV). Similarly, there was no association between tumor grade and DSM (p=0.746). However, the mortality rate was higher and positively associated with advanced pathological stage (p=0.039).

Table IV

Correlation of the pathological grade and stage with overall survival and recurrence-free survival in the UCB patients.

Table IV

Correlation of the pathological grade and stage with overall survival and recurrence-free survival in the UCB patients.

ParametersGrade
P-valueParametersStage
P-value
Low-grade (n=25)High-grade (n=27)Ta/T1 (n=42)T2–T4 (n=10)
First recurrence, n (%)episodea12 (48)15 (55.6)0.786First recurrence, n (%)episodea19 (45.2)8 (80)0.078
DSMa, n (%)5 (20)7 (25.9)0.746DSMa, n (%)7 (16.7)5 (50) 0.039c
Overall survival ratebOverall survival rateb
 2-year95.2%77.3%0.596 2-year92.3%57.1% 0.013c
 5-year78.1%73.2% 5-year82.9%45.7%
Recurrence-free survivalbRecurrence-free survivalb
 2-year95.2%85%0.457 1-year31.6%25%0.585
 5-year65.1%63.6% 2-year10.5%12.5%

a The Chi-square test was adopted to test the statistical significance of the association between these variables.

b Statistical differences evaluated by the log rank test.

c P<0.05 represents a significant difference. DSM, disease-specific mortality.

Regarding the overall survival rate recorded at two and five years after diagnosis, no significant difference between low- and high-grade groups was observed (p=0.596, Table IV). However, MIBC patients had significantly shorter overall survival compared with the NMIBC patients (p=0.013). In relation to recurrence-free survival, we did not observe a significant difference between tumor grade or stage (p>0.05).

Association of reduced levels of APE1 with cancer-specific mortality

The levels of APE1, XRCC1 and POLB transcripts were compared with the selected clinical outcomes (DSM or recurrence) in each tumor grade and stage group to assess predictive value. Overall, no significant correlation was observed between transcript levels and DSM or recurrence, in either pathological grade or stage (data not shown). Despite that, by analyzing all patients in the study regardless of tumor stage or grade, univariable analysis revealed that reduced levels of APE1 transcripts were significantly associated with DSM (p=0.032, Fig. 2). According to the ROC plot, specificity and sensitivity for the APE1 gene were, respectively, 60% and 75%. Therefore, these results revealed that APE1 expression may be an indicator of poor prognosis in UCB patients.

Figure 2

Probability of bladder cancer-specific mortality relatively to APE1. (A) Receiver operating characteristic (ROC) curve for APE1 levels in all UCB patients achieved 75% sensitivity and 60% specificity. The optimal cut-off value was 0.81 and the calculated area under the curve (AUC) was 0.697 (95% CI 0.554–0.817). (B) Kaplan-Meier survival curves depicting cancer-specific survival (%) of bladder cancer patients for APE1 (red line, altered when combined score was >0.81). APE1, apurinic/apyrimidinic (AP) endonuclease.

APE1 T1349G polymorphism

Genotyping assays to evaluate the APE1 T1349G polymorphism were performed by preferentially sequencing the cDNA samples from a subset of patients who concomitantly presented reduced levels of APE1 transcripts and death and/or recurrence events (Fig. 3). As summarized in Table V, the G allele variant was observed in 75% (9/12) of this subset, being present in 67% (6/9) among the low-grade cases analyzed. In addition, the variant genotype (TG/GG) was found in 80% (4/5) of the low-grade cases, whose outcome was either death and/or recurrence. All high-grade patients analyzed had variant genotype (TG/GG), while only individuals with the variant genotypes TG (T2–T4 stage) succumbed to the disease.

Figure 3

APE1 T1349G polymorphism in the UCB patients. Representative chromatogram of the sense sequence from patient LG19 showing the T to G transversion at APE1 T1349G, as indicated by arrows.

Table V

Genotype frequencies of the APE1 T1349G polymorphism among the UCB patients.

Table V

Genotype frequencies of the APE1 T1349G polymorphism among the UCB patients.

GenotypeLow-grade (LG), n=9
High-grade (HG), n=3
n (%)DeathRecurrencen (%)DeathRecurrence
TT3 (33)LG17LG170 (0)––
TG3 (33)LG23LG232 (67)HG8; HG23HG8
GG3 (33)LG11; LG19; LG22LG11; LG19; LG221 (33)–HG17

Discussion

Urothelial carcinoma of the bladder (UCB) is a heterogeneous disease comprising multiple and complex molecular changes associated with initiation and tumor progression. Previous indications that pro-oxidant status appears to play a role in genitourinary carcinogenesis and its correlation with tumor invasion and metastasis encouraged our team to screen for molecular markers of genetic stability as an attempt to improve UCB prognosis (23,24). DNA repair mechanisms act as a barrier to prevent genetic instability and cancer susceptibility. A few studies have evaluated the association between dysfunction/dysregulation in particular DNA repair genes and UCB risk (25,26). Since APE1, XRCC1 and POLB proteins operate downstream the same DNA repair pathway to eliminate DNA oxidative damage, their expression above basal levels found in our study could reveal excessive oxidative stress in high-grade bladder tumors.

XRCC1 protein is required for efficient DNA repair of other BER-involved enzymes. Notwithstanding its core interplay in BER, a recent meta-analysis did not associate a dysfunctional XRCC1 polymorphism to UCB risk (27). Increased levels of XRCC1 transcripts were also associated with chemoresistance to cisplatin in non-small cell lung cancer (28). The set of results presented in this study revealed that XRCC1 transcripts were increased in 52% of high-grade tumors, whereas 92% of low-grade tumors displayed reduced levels of XRCC1. Since single nucleotide polymorphisms (SNPs) cannot be ascribed to such status, transcriptional alterations for XRCC1 were revealed in this study to better characterize the histopathological grade.

In higher eukaryotes, DNA polymerases participate in replication, repair and recombination. Pol β is the major BER DNA polymerase. Pol β is minimally expressed in normal cells but has been shown to be overexpressed in different tumors both at the transcriptional and protein levels, including bladder tumors (29). Approximately 30% of all human tumors express variant Pol β (30). As previously described in other studies, Pol β destabilization plays an important role in disrupting cell cycle control and increasing mutation rates. Being an error-prone DNA polymerase, excess Pol β could disturb the processivity of replication forks and increase genetic instability and tumorigenesis by curtailing the activity of error-free DNA polymerases during replication (31,32). Furthermore, Pol β can also enhance mutagenesis by incorporation of ribonucleotides into DNA and by competition with replicative DNA polymerases (33,34). Our results revealed that the POLB transcripts had increased levels in ~77% of high-grade tumors, suggesting a strong correlation of POLB dysregulation with tumorigenesis and progression events.

APE1 is a multifunctional protein essential in BER and a redox transcriptional co-activator. APE1 participates in the initial steps of BER by recognizing and nicking potentially genotoxic and mutagenic abasic (AP) sites in different substrates, such as double-strand DNA, hybrid DNA/RNA and RNA molecule (35). APE1 elevated levels have been reported to occur in a group of tumors (36–38). In general, its increased levels provide resistance to chemotherapeutic drugs and ionizing radiation and, as expected, marked cisplatin sensitivity was observed to occur in vitro in tumor cells knocked out for APE1 (39,40). Nonetheless, Sak et al reported that increased APE1 protein levels were correlated with improved cancer-specific survival in patients with muscle-invasive bladder cancer following radical radiotherapy (41). In the present study, reduced APE1 levels at initial diagnosis were significantly associated with poor clinical outcome, regardless of the chosen therapeutical approach, pathological grade, or stage. Moreover, reduced levels of APE1 also compromise the regulation of p53 target genes through its redox activity and may result in extensive genomic instability. All of these factors could explain why reduced levels of APE1 transcripts resulted in poorer UCB patient survival, causing it to be an important gene for clinical cancer-specific survival prediction.

In our study, differences in clinical outcomes such as recurrence and DSM were not correlated with pathological grade. However, we identified higher mortality rates and reduced overall survival in patients with advanced tumor stage. Since all MIBC patients analyzed were also designated as high-grade tumors, the characteristic highly aggressive profile of these tumors could explain the increased mortality and poor survival in this subset of UCB patients. The comprehensive profiling of BER transcripts in each pathological grade group highlights meaningful differences in the molecular signature of low- and high-grade bladder tumors that could be attributed to differential transcriptional regulation ensued by tumorigenesis and oxidative stress. Therefore, these differences in BER transcript levels able to characterize two distinct histologic UCB groups found in our study could complement molecular data from previous studies associating low- and high-grade UCB groups with distinct genetic alteration patterns (2–4). Moreover, APE1 analyses presented good specificity and sensitivity parameters (60% specificity and 75% sensitivity) which represent important information for a suitable clinical test.

In carcinogenesis events, the most extensively studied polymorphism in the APE1 gene is the T to G transversion (T1349G, also known as Asp148Glu, rs3136820) (42). Functional studies on this polymorphism have shown that the G variant allele may have an impact on APE1 endonuclease and reduce the ability to communicate with other BER proteins (43). In our study, some patients with reduced levels of APE1 transcripts also experienced death and/or recurrence events. In this context, we performed an additional analysis to investigate the presence of the APE1 T1349G polymorphism from this group of patients. Our data pointed out that all high-grade patients analyzed had variant genotypes (TG/GG), but only individuals with genotype TG (T2–T4 stage) succumbed to the disease. With regard to the low-grade group, the G allele variant occurred in 80% (4/5) of the cases, whose outcome was mortality and/or recurrence events. In a study for functional characterization of polymorphisms in DNA repair genes and chromosome aberrations by using X-rays or ultraviolet (UV) light to irradiate blood lymphocytes, samples from individuals with the TG or GG genotype showed higher levels of damage, including aberrant cells, chromatid breaks, chromatid exchanges, deletions, and dicentrics (44). A meta-analysis study showed that individuals carrying at least one G allele were associated with a higher cancer risk than subjects with the TT genotype (45). However, a meta-analysis study performed in 2013 suggested that the APE1 T1349G polymorphism was not associated with bladder cancer risk among Asians or non-Asians (46). Consistent with these observations, our data suggest that besides interfering with APE1 enzymatic activity, as shown in other studies, the G allele may also modify the APE1 transcriptional levels and result in worse clinical outcome for bladder cancer patients. Our small sample size for this polymorphism analysis (n=9 for low-grade and n=3 for high-grade groups) should be interpreted with caution, as more detailed data are needed to verify these findings. However, taken together, our results indicate that APE1 is an attractive candidate gene to open new perspective studies for evaluating clinical outcomes of UCB patients. Further analyses are required to validate APE1 as a reliable predictive molecular marker for UCB.

Finally, the present study thus reinforces the notion that DNA repair gene expression must be finely tuned in order to avoid genetic instability and the process of tumorigenesis (47). Despite current effective treatments to ensure better results for UCB patients, diagnostic and prognostic exams are still partially accurate and should be complemented with auxiliary tests. Therefore, more clinical research on UCB should be encouraged to allow a significant increase in clinical data, better comprehension of the biology of the disease, and optimization of diagnostic and prognostic tests (48).

In conclusion, evaluation of DNA repair transcripts revealed that high-grade tumors exhibited elevated levels of APE1, XRCC1, and POLB as compared with low-grade tumors. Taken together, this panel adds information on the histopathology of bladder tumors. By analyzing all patients, only APE1 reduced levels were an independent predictor of cancer-specific mortality in primary UCB regardless of pathological grade or stage, and APE1 may represent a possible candidate gene for evaluating clinical outcomes in UCB. Despite this, evidence suggests that dysregulated BER transcription may promote bladder carcinogenesis.

Acknowledgments

The authors acknowledge all participing clinicians, investigators, patients, and everyone who encouraged this study. This study was supported by the Brazilian Development Agencies: CAPES, FAPERJ and Prog. Oncobiologia FAF/Onco III.

References

1 

Siegel R, Naishadham D and Jemal A: Cancer statistics, 2013. CA Cancer J Clin. 63:11–30. 2013. View Article : Google Scholar : PubMed/NCBI

2 

Knowles MA: Molecular subtypes of bladder cancer: Jekyll and Hyde or chalk and cheese? Carcinogenesis. 27:361–373. 2006. View Article : Google Scholar

3 

DeGraff DJ, Cates JM, Mauney JR, Clark PE, Matusik RJ and Adam RM: When urothelial differentiation pathways go wrong: Implications for bladder cancer development and progression. Urol Oncol. 31:802–811. 2013. View Article : Google Scholar

4 

Castillo-Martin M, Domingo-Domenech J, Karni-Schmidt O, Matos T and Cordon-Cardo C: Molecular pathways of urothelial development and bladder tumorigenesis. Urol Oncol. 28:401–408. 2010. View Article : Google Scholar : PubMed/NCBI

5 

Burger M, Catto JW, Dalbagni G, Grossman HB, Herr H, Karakiewicz P, Kassouf W, Kiemeney LA, La Vecchia C, Shariat S, et al: Epidemiology and risk factors of urothelial bladder cancer. Eur Urol. 63:234–241. 2013. View Article : Google Scholar

6 

Kim WJ and Bae SC: Molecular biomarkers in urothelial bladder cancer. Cancer Sci. 99:646–652. 2008. View Article : Google Scholar : PubMed/NCBI

7 

Shariat SF, Tokunaga H, Zhou J, Kim J, Ayala GE, Benedict WF and Lerner SP: p53, p21, pRB, and p16 expression predict clinical outcome in cystectomy with bladder cancer. J Clin Oncol. 22:1014–1024. 2004. View Article : Google Scholar : PubMed/NCBI

8 

Yang J, Xu Z, Li J, Zhang R, Zhang G, Ji H, Song B and Chen Z: XPC epigenetic silence coupled with p53 alteration has a significant impact on bladder cancer outcome. J Urol. 184:336–343. 2010. View Article : Google Scholar : PubMed/NCBI

9 

Yan C, Kim YW, Ha YS, Kim IY, Kim YJ, Yun SJ, Moon SK, Bae SC and Kim WJ: RUNX3 methylation as a predictor for disease progression in patients with non-muscle-invasive bladder cancer. J Surg Oncol. 105:425–430. 2012. View Article : Google Scholar : PubMed/NCBI

10 

Hoeijmakers JH: Genome maintenance mechanisms for preventing cancer. Nature. 411:366–374. 2001. View Article : Google Scholar : PubMed/NCBI

11 

Christmann M, Tomicic MT, Roos WP and Kaina B: Mechanisms of human DNA repair: An update. Toxicology. 193:3–34. 2003. View Article : Google Scholar : PubMed/NCBI

12 

Wood RD, Mitchell M and Lindahl T: Human DNA repair genes, 2005. Mutat Res. 577:275–283. 2005. View Article : Google Scholar : PubMed/NCBI

13 

Zharkov DO: Base excision DNA repair. Cell Mol Life Sci. 65:1544–1565. 2008. View Article : Google Scholar : PubMed/NCBI

14 

Figueroa JD, Malats N, Real FX, Silverman D, Kogevinas M, Chanock S, Welch R, Dosemeci M, Tardón A, Serra C, et al: Genetic variation in the base excision repair pathway and bladder cancer risk. Hum Genet. 121:233–242. 2007. View Article : Google Scholar : PubMed/NCBI

15 

Fritz G: Human APE/Ref-1 protein. Int J Biochem Cell Biol. 32:925–929. 2000. View Article : Google Scholar : PubMed/NCBI

16 

Kubota Y, Nash RA, Klungland A, Schär P, Barnes DE and Lindahl T: Reconstitution of DNA base excision-repair with purified human proteins: Interaction between DNA polymerase beta and the XRCC1 protein. EMBO J. 15:6662–6670. 1996.PubMed/NCBI

17 

Campalans A, Marsin S, Nakabeppu Y, O'connor TR, Boiteux S and Radicella JP: XRCC1 interactions with multiple DNA glycosylases: A model for its recruitment to base excision repair. DNA Repair (Amst). 4:826–835. 2005. View Article : Google Scholar

18 

Allinson SL, Dianova II and Dianov GL: DNA polymerase beta is the major dRP lyase involved in repair of oxidative base lesions in DNA by mammalian cell extracts. EMBO J. 20:6919–6926. 2001. View Article : Google Scholar : PubMed/NCBI

19 

Dyrskjøt L, Thykjaer T, Kruhøffer M, Jensen JL, Marcussen N, Hamilton-Dutoit S, Wolf H and Orntoft TF: Identifying distinct classes of bladder carcinoma using microarrays. Nat Genet. 33:90–96. 2003. View Article : Google Scholar

20 

Mengual L, Burset M, Ars E, Lozano JJ, Villavicencio H, Ribal MJ and Alcaraz A: DNA microarray expression profiling of bladder cancer allows identification of noninvasive diagnostic markers. J Urol. 182:741–748. 2009. View Article : Google Scholar : PubMed/NCBI

21 

Damrauer JS, Hoadley KA, Chism DD, Fan C, Tiganelli CJ, Wobker SE, Yeh JJ, Milowsky MI, Iyer G, Parker JS, et al: Intrinsic subtypes of high-grade bladder cancer reflect the hallmarks of breast cancer biology. Proc Natl Acad Sci USA. 111:3110–3115. 2014. View Article : Google Scholar : PubMed/NCBI

22 

Bustin SA, Benes V, Garson JA, Hellemans J, Huggett J, Kubista M, Mueller R, Nolan T, Pfaffl MW, Shipley GL, et al: The MIQE guidelines: Minimum information for publication of quantitative real-time PCR experiments. Clin Chem. 55:611–622. 2009. View Article : Google Scholar : PubMed/NCBI

23 

Gecit I, Aslan M, Gunes M, Pirincci N, Esen R, Demir H and Ceylan K: Serum prolidase activity, oxidative stress, and nitric oxide levels in patients with bladder cancer. J Cancer Res Clin Oncol. 138:739–743. 2012. View Article : Google Scholar : PubMed/NCBI

24 

Kumar B, Koul S, Khandrika L, Meacham RB and Koul HK: Oxidative stress is inherent in prostate cancer cells and is required for aggressive phenotype. Cancer Res. 68:1777–1785. 2008. View Article : Google Scholar : PubMed/NCBI

25 

Michiels S, Laplanche A, Boulet T, Dessen P, Guillonneau B, Méjean A, Desgrandchamps F, Lathrop M, Sarasin A and Benhamou S: Genetic polymorphisms in 85 DNA repair genes and bladder cancer risk. Carcinogenesis. 30:763–768. 2009. View Article : Google Scholar : PubMed/NCBI

26 

Narter KF, Ergen A, Agaçhan B, Görmüs U, Timirci O and Isbir T: Bladder cancer and polymorphisms of DNA repair genes (XRCC1, XRCC3, XPD, XPG, APE1, hOGG1). Anticancer Res. 29:1389–1393. 2009.PubMed/NCBI

27 

Zhuo W, Zhang L, Cai L, Zhu B and Chen Z: XRCC1 Arg399Gln polymorphism and bladder cancer risk: Updated meta-analyses based on 5767 cases and 6919 controls. Exp Biol Med (Maywood). 238:66–76. 2013. View Article : Google Scholar

28 

Weaver DA, Crawford EL, Warner KA, Elkhairi F, Khuder SA and Willey JC: ABCC5, ERCC2, XPA and XRCC1 transcript abundance levels correlate with cisplatin chemoresistance in non-small cell lung cancer cell lines. Mol Cancer. 4:182005. View Article : Google Scholar : PubMed/NCBI

29 

Albertella MR, Lau A and O'Connor MJ: The overexpression of specialized DNA polymerases in cancer. DNA Repair (Amst). 4:583–593. 2005. View Article : Google Scholar

30 

Starcevic D, Dalal S and Sweasy JB: Is there a link between DNA polymerase beta and cancer? Cell Cycle. 3:998–1001. 2004. View Article : Google Scholar : PubMed/NCBI

31 

Osheroff WP, Jung HK, Beard WA, Wilson SH and Kunkel TA: The fidelity of DNA polymerase beta during distributive and processive DNA synthesis. J Biol Chem. 274:3642–3650. 1999. View Article : Google Scholar : PubMed/NCBI

32 

Bergoglio V, Pillaire MJ, Lacroix-Triki M, Raynaud-Messina B, Canitrot Y, Bieth A, Garès M, Wright M, Delsol G, Loeb LA, et al: Deregulated DNA polymerase beta induces chromosome instability and tumorigenesis. Cancer Res. 62:3511–3514. 2002.PubMed/NCBI

33 

Bergoglio V, Ferrari E, Hübscher U, Cazaux C and Hoffmann JS: DNA polymerase beta can incorporate ribonucleotides during DNA synthesis of undamaged and CPD-damaged DNA. J Mol Biol. 331:1017–1023. 2003. View Article : Google Scholar : PubMed/NCBI

34 

Pillaire MJ, Betous R, Conti C, Czaplicki J, Pasero P, Bensimon A, Cazaux C and Hoffmann JS: Upregulation of error-prone DNA polymerases beta and kappa slows down fork progression without activating the replication checkpoint. Cell Cycle. 6:471–477. 2007. View Article : Google Scholar : PubMed/NCBI

35 

Berquist BR, McNeill DR and Wilson DM III: Characterization of abasic endonuclease activity of human Ape1 on alternative substrates, as well as effects of ATP and sequence context on AP site incision. J Mol Biol. 379:17–27. 2008. View Article : Google Scholar : PubMed/NCBI

36 

Bobola MS, Blank A, Berger MS, Stevens BA and Silber JR: Apurinic/apyrimidinic endonuclease activity is elevated in human adult gliomas. Clin Cancer Res. 7:3510–3518. 2001.PubMed/NCBI

37 

Kelley MR, Cheng L, Foster R, Tritt R, Jiang J, Broshears J and Koch M: Elevated and altered expression of the multifunctional DNA base excision repair and redox enzyme Ape1/ref-1 in prostate cancer. Clin Cancer Res. 7:824–830. 2001.PubMed/NCBI

38 

Moore DH, Michael H, Tritt R, Parsons SH and Kelley MR: Alterations in the expression of the DNA repair/redox enzyme APE/ref-1 in epithelial ovarian cancers. Clin Cancer Res. 6:602–609. 2000.PubMed/NCBI

39 

Robertson KA, Bullock HA, Xu Y, Tritt R, Zimmerman E, Ulbright TM, Foster RS, Einhorn LH and Kelley MR: Altered expression of Ape1/ref-1 in germ cell tumors and overexpression in NT2 cells confers resistance to bleomycin and radiation. Cancer Res. 61:2220–2225. 2001.PubMed/NCBI

40 

Zhang Y, Wang J, Xiang D, Wang D and Xin X: Alterations in the expression of the apurinic/apyrimidinic endonuclease-1/redox factor-1 (APE1/Ref-1) in human ovarian cancer and indentification of the therapeutic potential of APE1/Ref-1 inhibitor. Int J Oncol. 35:1069–1079. 2009.PubMed/NCBI

41 

Sak SC, Harnden P, Johnston CF, Paul AB and Kiltie AE: APE1 and XRCC1 protein expression levels predict cancer-specific survival following radical radiotherapy in bladder cancer. Clin Cancer Res. 11:6205–6211. 2005. View Article : Google Scholar : PubMed/NCBI

42 

Gu D, Wang M, Wang S, Zhang Z and Chen J: The DNA repair gene APE1 T1349G polymorphism and risk of gastric cancer in a Chinese population. PLoS One. 6:e289712011. View Article : Google Scholar : PubMed/NCBI

43 

Hadi MZ, Coleman MA, Fidelis K, Mohrenweiser HW and Wilson DM III: Functional characterization of Ape1 variants identified in the human population. Nucleic Acids Res. 28:3871–3879. 2000. View Article : Google Scholar : PubMed/NCBI

44 

Au WW, Salama SA and Sierra-Torres CH: Functional characterization of polymorphisms in DNA repair genes using cytogenetic challenge assays. Environ Health Perspect. 111:1843–1850. 2003. View Article : Google Scholar : PubMed/NCBI

45 

Gu D, Wang M, Wang M, Zhang Z and Chen J: The DNA repair gene APE1 T1349G polymorphism and cancer risk: A meta-analysis of 27 case-control studies. Mutagenesis. 24:507–512. 2009. View Article : Google Scholar : PubMed/NCBI

46 

Liu C, Yin Q, Li L, Zhuang YZ, Zu X and Wang Y: APE1 Asp148Glu gene polymorphism and bladder cancer risk: A meta-analysis. Mol Biol Rep. 40:171–176. 2013. View Article : Google Scholar

47 

Sweasy JB, Lang T and DiMaio D: Is base excision repair a tumor suppressor mechanism? Cell Cycle. 5:250–259. 2006. View Article : Google Scholar : PubMed/NCBI

48 

Kunath F, Krause SF, Wullich B, Goebell PJ, Engehausen DG, Burger M, Meerpohl JJ and Keck B: Bladder cancer - the neglected tumor: A descriptive analysis of publications referenced in MEDLINE and data from the register ClinicalTrials.gov. BMC Urol. 13:562013. View Article : Google Scholar

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Chantre-Justino M, Alves G, Britto C, Cardoso A, Scherrer L, dos Santos Moreira A, Quirino R, Ornellas A, Leitão A, Lage C, Lage C, et al: Impact of reduced levels of APE1 transcripts on the survival of patients with urothelial carcinoma of the bladder. Oncol Rep 34: 1667-1674, 2015.
APA
Chantre-Justino, M., Alves, G., Britto, C., Cardoso, A., Scherrer, L., dos Santos Moreira, A. ... Lage, C. (2015). Impact of reduced levels of APE1 transcripts on the survival of patients with urothelial carcinoma of the bladder. Oncology Reports, 34, 1667-1674. https://doi.org/10.3892/or.2015.4151
MLA
Chantre-Justino, M., Alves, G., Britto, C., Cardoso, A., Scherrer, L., dos Santos Moreira, A., Quirino, R., Ornellas, A., Leitão, A., Lage, C."Impact of reduced levels of APE1 transcripts on the survival of patients with urothelial carcinoma of the bladder". Oncology Reports 34.4 (2015): 1667-1674.
Chicago
Chantre-Justino, M., Alves, G., Britto, C., Cardoso, A., Scherrer, L., dos Santos Moreira, A., Quirino, R., Ornellas, A., Leitão, A., Lage, C."Impact of reduced levels of APE1 transcripts on the survival of patients with urothelial carcinoma of the bladder". Oncology Reports 34, no. 4 (2015): 1667-1674. https://doi.org/10.3892/or.2015.4151
Copy and paste a formatted citation
x
Spandidos Publications style
Chantre-Justino M, Alves G, Britto C, Cardoso A, Scherrer L, dos Santos Moreira A, Quirino R, Ornellas A, Leitão A, Lage C, Lage C, et al: Impact of reduced levels of APE1 transcripts on the survival of patients with urothelial carcinoma of the bladder. Oncol Rep 34: 1667-1674, 2015.
APA
Chantre-Justino, M., Alves, G., Britto, C., Cardoso, A., Scherrer, L., dos Santos Moreira, A. ... Lage, C. (2015). Impact of reduced levels of APE1 transcripts on the survival of patients with urothelial carcinoma of the bladder. Oncology Reports, 34, 1667-1674. https://doi.org/10.3892/or.2015.4151
MLA
Chantre-Justino, M., Alves, G., Britto, C., Cardoso, A., Scherrer, L., dos Santos Moreira, A., Quirino, R., Ornellas, A., Leitão, A., Lage, C."Impact of reduced levels of APE1 transcripts on the survival of patients with urothelial carcinoma of the bladder". Oncology Reports 34.4 (2015): 1667-1674.
Chicago
Chantre-Justino, M., Alves, G., Britto, C., Cardoso, A., Scherrer, L., dos Santos Moreira, A., Quirino, R., Ornellas, A., Leitão, A., Lage, C."Impact of reduced levels of APE1 transcripts on the survival of patients with urothelial carcinoma of the bladder". Oncology Reports 34, no. 4 (2015): 1667-1674. https://doi.org/10.3892/or.2015.4151
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team