Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Oncology Reports
Join Editorial Board Propose a Special Issue
Print ISSN: 1021-335X Online ISSN: 1791-2431
Journal Cover
July-2016 Volume 36 Issue 1

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
July-2016 Volume 36 Issue 1

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Hypoxia inducible factor-1α-dependent epithelial to mesenchymal transition under hypoxic conditions in prostate cancer cells

  • Authors:
    • Mingchuan Li
    • Yong Xing Wang
    • Yong Luo
    • Jiahui Zhao
    • Qing Li
    • Jiao Zhang
    • Yongguang Jiang
  • View Affiliations / Copyright

    Affiliations: Department of Urology, Beijing Anzhen Hospital, Capital Medical University, Beijing 100029, P.R. China, Department of Anatomy and Cell Biology, East Carolina University, Greenville, NC 27834, USA
  • Pages: 521-527
    |
    Published online on: April 25, 2016
       https://doi.org/10.3892/or.2016.4766
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

Prostate cancer is the most commonly diagnosed cancer in men and the second leading cause of cancer death. Hypoxia is an environmental stimulus that plays an important role in the development and cancer progression especially for solid tumors. The key regulator under hypoxic conditions is stabilized hypoxia-inducible factor (HIF)-1α. In the present study, immune-fluorescent staining, siRNAs, qRT-PC, immunoblotting, cell migration and invasion assays were carried out to test typical epithelial to mesenchymal transition under hypoxia and the key regulators of this process in PC3, a human prostate cancer cell line. Our data demonstrated that hypoxia induces diverse molecular, phenotypic and functional changes in prostate cancer cells that are consistent with EMT. We also showed that a cell signal factor such as HIF-1α, which might be stabilized under hypoxic environment, is involved in EMT and cancer cell invasive potency. The induced hypoxia could be blocked by HIF-1α gene silencing and reoxygenation of EMT in prostate cancer cells, hypoxia partially reversed accompanied by a process of mesenchymal-epithelial reverting transition (MErT). EMT might be induced by activation of HIF-1α-dependent cell signaling in hypoxic prostate cancer cells.

Introduction

Prostate cancer is the most commonly diagnosed cancer in men and the second leading cause of cancer death during the past 5 years according to the cancer statistics (1) reported by the American Cancer Society, this trend can be traced back even 10 years. For patients with localized prostate cancer, it is treatable and the 5-year survival rates could be even 100%. Yet, patients usually die of cancer metastasis or drug resistance with the 5-year survival rates lowered to 30–40%. It is urgent to explore the mechanisms involved in cancer metastasis and drug resistance and develop new strategies to improve the treatment outcome.

Hypoxia is an environmental stimulus that plays an important role in cancer development and progression especially in solid tumors which outgrow local blood supply during the progression to advanced stages. Hypoxic conditions are widely present in many human malignancies including breast, prostate, lung, pancreas, rectum and renal cell cancer (2). The key regulator under hypoxic conditions is stabilized hypoxia-inducible factor (HIF)-1α which dimerizes with constitutively expressed HIF-1β and then translocates into the nucleus where they bind to a specific sequence, the hypoxia-responsive element (HRE), usually present in the promoter of several hypoxia-dependent target genes (3).

Epithelial to mesenchymal transition (EMT) was first used to depict embryonic development, which is characterized by adherent epithelial cells converting to motile mesenchymal cells. EMT is now been classified into 3 different subtypes that is EMT during implantation, embryogenesis and organ development, EMT associated with tissue regeneration and organ fibrosis, EMT associated with cancer progression and metastasis (4). It has been reported that EMT existed in many kinds of human cancers such as pancreatic, breast and colon cancer (5) and hypoxia alone can trigger an EMT process with increased invasiveness (5). At the molecular level, EMT is accompanied by loss of epithelial cell markers, such as cell adhesion protein E-cadherin, and acquisition of mesenchymal markers, such as vimentin and N-cadherin. With more and more research concerning on the role of EMT in cancer progression and metastasis, a family of transcriptional factors including Snail, Slug, Twist, Zeb and E47 have emerged as EMT master genes since they can directly downregulate E-cadherin expression which is a hallmark of EMT.

As mentioned above, hypoxia alone can trigger EMT in many solid tumors including hepatoblastoma, pancreatic, colon and breast cancer (5), yet, the mechanisms involved in prostate cancer under hypoxic condition remain unclear. In the present study, we demonstrated that hypoxia might induce diverse molecular, phenotypic, and functional changes in prostate cancer cells that are consistent with EMT. We also showed that cell signaling factors such as HIF-1α, which is thought to be stabilized under hypoxic environment is involved in EMT and cancer cell invasive potency. Hypoxia-induced EMT in prostate cancer cells can be blocked by HIF-1α gene silencing and reoxygenation after hypoxia partially reverses EMT which is accompanied by a process named mesenchymal-epithelial reverting transition (MErT). We conclude that EMT could be induced by a mechanism that might involve the activation of HIF-1α-dependent cell signaling in hypoxic prostate cancer cells.

Materials and methods

Cell culture under normal and hypoxic conditions

Human prostate cancer cell lines PC3 and DU145 were purchased from the National Platform of Experimental Cell Resources for Sci-Tech (Beijing, China). The cells were cultured in RPMI-1640 medium supplemented with 10% fetal bovine serum (FBS; Gibco-BRL, Grand Island, NY, USA) at 37°C under a 5% CO2 condition. To recapitulate the effects of hypoxia as it occurs in prostate cancer, we exposed 60–70% subconfluent PC3 cells to hypoxic conditions (3% O2, 5% CO2 and 92% N2) for up to 72 h.

Fluorescent immunostaining

Immunofluorescence staining was employed to further confirm EMT phenotype changes of prostate cancer cells under hypoxic condition. PC3 and DU145 cells were cultured on coverslips in 24-well plates at initial density 5×104 cells/well. At the indicated time-points, culture media were removed from the cultured cells followed by 3 washings with PBS. Cells were fixed with 4% polyoxymethylene solution for 20 min and washed with PBS 3 times. Cells were incubated with rabbit anti-human E-cadherin polyclonal antibody (Santa Cruz Biotechnology, Santa Cruz, CA, USA), and mouse anti-human vimentin monoclonal antibody (Santa Cruz Biotechnology) respectively, then their corresponding lumophore conjugated secondary antibodies. DAPI was used for nuclei staining. Finally, cells were observed under a fluorescent microscope or a confocal microscope.

Plasmid construction and transfections

PcDNA3.1 plasmid (a generous gift from Professor Dalin He) was digested with endonucleases HindIII and BglII in order to construct vectors for expression of HIF-1α-small interfering RNAs (siRNAs). Three chemically synthesized oligonucleotides encoding HIF-1α-short hairpin siRNAs that included a loop motif were inserted downstream of the BglII promoter of the plasmid using DNA Ligation kit (Takara Biotechnology, Co., Ltd., Dalian, China) and cloned. PC3 cells were transfected with the above plasmids (4 µg total) using Lipofectamine™ 2000 (Invitrogen Corp., Carlsbad, CA, USA) according to the manufacturer's instructions. A scramble siRNA was used as control.

Quantitative real-time PCR (qRT-PCR)

PC3 and DU145 cells were harvested at the indicated time-points. Total RNA was extracted by using TRIzol (Invitrogen) according to the manufacturer's protocol. Reverse transcription was performed according to the protocol of SuperScript™ First-Strand Synthesis System for RT-PCR (Invitrogen). Quantitative real-time PCR was performed using SYBR Premix Ex Taq (Takara Biotechnology) under conditions recommend by the manufacturer and Applied Biosystems 7300 Real-Time PCR System (Applied Biosystems, Waltham, MA, USA) supplied with the analytical software.

Primers were designed for transcription factors that regulate EMT, including Snail, Slug, Twist, Zeb1, Zeb2 and E47, GAPDH gene as an internal reference gene, by using web-based program at www.idtdna.com and synthesized from integrated DNA Technologies (Coralville, IA, USA). The primers used for the analysis are shown in Table I.

Table I

Primers used for the analysis.

Table I

Primers used for the analysis.

Primers
SnailForward: CCACGAGGTGTGACTAACTATG
Reverse: ACCAAACAGGAGGCTGAAATA
SlugForward: AACTACAGCGAACTGGACAC
Reverse: GAGGATCTCTGGTTGTGGTATG
TwistForward: AGGCATCACTATGGACTTTCTC
Reverse: GGCCAGTTTGATCCCAGTAT
Zeb1Forward: CTTCTCACACTCTGGGTCTTATTC
Reverse: CGTTCTTCCGCTTCTCTCTTAC
Zeb2Forward: CTAACCCAAGGAGCAGGTAATC
Reverse: GTGAATTCGCAGGTGTTCTTTC
E47Forward: GTCTCGGTCATCCTGAACTTG
Reverse: TTTCCTCTTCTCGCCGTTTC
GAPDHForward: GGTGTGAACCATGAGAAGTATGA
Reverse: GAGTCCTTCCACGATACCAAAG
Immunoblotting with ECL detection

PC3 cells were incubated under hypoxic conditions for different periods of time (6, 24, 48 and 72 h). After each indicated incubation period, PC3 cells for protein assay were lysed in RIPA buffer (1% Triton X-100, 0.5% deoxycholic acid, 0.2% SDS, 150 mM sodium chloride and 2 mM EDTA) with complete protease inhibitor cocktail tablet (Roche, Mannheim, Germany) and pepstatin A. After removing cell debris by centrifugation, protein concentration was determined using BCA method.

Total proteins were separated on 8–12% polyacrylamide gels and transferred onto 0.45 µm nitrocellulose in a buffer containing 25 mmol/l Tris-HCL (pH 8.3), 192 mmol/l glycine, 20% methanol and blocked with 5% fat-free dry milk in PBS for 2 h. The membranes were incubated with primary antibodies. The following antibodies were used: rabbit anti-human HIF-1α polyclonal antibody (Santa Cruz Biotechnology), rabbit anti-human E-cadherin polyclonal antibody (Santa Cruz Biotechnology), and mouse anti-human vimentin monoclonal antibody (Santa Cruz Biotechnology). β-actin was used as internal control.

Cell migration and invasion assays

The invasion assays were performed using Millicell inserts (Millipore, Billerica, MA, USA) coated with Matrigel (BD Biosciences, Sparks, MD, USA). Cells (2.5×104) were seeded per upper chambers in serum-free DMEM whereas the lower chambers were loaded with DMEM containing 5% FBS. After 12 h, on the upper chambers non-migrating cells were removed by cotton swabs, and cells invaded through the Matrigel layer to the underside of the membrane were stained by crystal violet. The cell numbers were counted. Cell migration assays were performed similarly, but without Matrigel.

Statistical analysis

Each experiment was performed at least 3 times. All values are presented as mean ± SD. The statistics were analyzed by unpaired, two-tailed t-test. Data were considered to be statistically significant when P<0.05.

Results

Hypoxia results in the morphologic and cell biological changes characteristic of EMT in prostate cancer cells

After 72 h culture at hypoxic conditions (3% O2, 5% CO2 and 92% N2), PC3 cells started to loose cell contacts, scattered from cell clusters and acquired a spindle-shaped and fibroblast-like phenotype which is characteristic of EMT compared to the normoxic counterparts (95% air and 5% CO2) (Fig. 1A).

Figure 1

Hypoxia induces EMT phenotype in prostate cancer cells. (A) Cells were cultured for 72 h in 21% O2 (normoxia; N) or 3.0% O2 (hypoxia; H). Cell images were captured by phase-contrast microscopy. (B) Western blot analysis of epithelial marker (E-cadherin) under normoxic (N) or hypoxic conditions. A representative blot from 3 independent experiments is shown. (C) Western blot analysis of mesenchymal marker (vimentin) under normoxic (N) or hypoxic conditions. A representative blot from 3 independent experiments is shown. (D) Immunofluorescence staining of E-cadherin in PC3 under normoxic or hypoxic conditions for 72 h. Green represents E-cadherin staining. Blue signal represents nuclear DNA staining by DAPI (original magnification, ×400). (E) Immunofluorescence staining of vimentin in PC3 under normoxic or hypoxic conditions for 72 h. Green signal represents vimentin staining. Blue signal represents nuclear DNA staining by DAPI (original magnification, ×400). (F) Matrigel invasion assay. Photomicrographs showing cells that passed through Matrigel under normoxic or hypoxic conditions for 12 h (original magnification, ×100).

To further confirm whether prostate cancer underwent EMT, the expression of markers of epithelial and mesenchymal phenotypes were detected by western blot analysis (Fig. 1B and C). As is shown in Fig. 1B and C, hypoxic PC3 cells underwent a typical transition manifested by reduced E-cadherin expression and increased vimentin expression compared with normoxic control.

Immunofluorescence staining showed that the expression of E-cadherin decreased (Fig. 1D), but the expression of vimentin increased (Fig. 1E) when compared with their counterparts in normoxic environment. Matrigel invasion assay was also used to assess the cell invasiveness, which indicated that PC3 cells under hypoxic conditions for 12 h readily migrated through the Matrigel chamber in a relatively high numbers, whereas their normoxic partners exhibited a less invasive potency (Fig. 1F).

Under hypoxic conditions prostate cancer cells exhibit heightened HIF-1α expression

HIF-1α was analyzed by western blot analysis to determine whether the EMT observed in prostate cancer cells was attributable to heightened HIF-1α activity under hypoxic conditions (Fig. 2). PC3 cells were incubated under hypoxic conditions and collected as described before. As shown by western blot analysis (Fig. 2), HIF-1α protein levels in prostate cancer cells were upregulated during hypoxia and reached the highest expression at 6 h. The increased HIF-1α protein level was possibly due to the variation of protein stability under hypoxia condition.

Figure 2

Hypoxia induced HIF-1α overexpression in prostate cancer cells. Western blot analysis of epithelial marker (E-cadherin) under normoxic (N) or hypoxic conditions. A representative blot from 3 independent experiments is shown.

Inhibition of HIF-1α activity in prostate cancer cells under hypoxic conditions or reoxygenation reverses EMT

Having established that hypoxia results in elevated HIF-1α expression in prostate cancer cells, we next investigated the possibility for inhibition of HIF-1α to attenuate the mesenchymal characteristics of hypoxic cells. Molecular inhibition was accomplished by siRNA to downregulate HIF-1α. Inhibition of HIF-1α activity by siRNA under hypoxic conditions for 48 h did not cause any significant changes in cell morphology (Fig. 3A). No obvious change in protein expression was detected by western blot analysis (Fig. 3B and C), consistent with reversion to an epithelial phenotype. Importantly, inhibition of HIF-1α by siRNA led to a remarkable decrease in the invasiveness of hypoxic cells compared with control in Matrigel invasion assay at 12 h under hypoxic conditions (Fig. 3D).

Figure 3

Inhibition of HIF-1α reverses EMT characteristics in prostate cancer cells under hypoxic conditions. (A) Cells were cultured for 48 h in 21% O2 (normoxia) or 3.0% O2 (hypoxia) with additional siHIF-1α treatment. Cell images were captured by phase-contrast microscopy. (B) Western blot analysis. No obvious change was observed in E-cadherin protein expression when treated with siHIF-1α under hypoxia compared to culture under normoxia. (C) Western blot analysis. No obvious change in vimentin protein expression when treated with siHIF-1α under hypoxia compared to culture under normoxia. (D) Matrigel invasion assays. Cells that have passed through Matrigel under normoxic or hypoxic conditions with siHIF-1α treatment for 12 h (original magnification, ×100) showed no significant differences.

At the same time, we elucidated what would happen when PC3 cells were re-cultured under normoxic conditions after exposed to hypoxic conditions for 72 h. Western blot analysis showed that E-cadherin protein was regained when PC3 cells returned to normoxia gradually compared to those cultured under hypoxia (Fig. 4A), whereas expressions of vimentin gradually lost in contrast to the enhanced expression under hypoxia condition (Fig. 4B). These changes occurred after inhibition of HIF-1α activity in PC3 cells indicated that prostate cancer cells might undergo MErT through reoxygenation after they were exposed in hypoxic conditions.

Figure 4

Reoxygenation reverses EMT characteristics in prostate cancer cells. (A) Western blot analysis. Increased E-cadherin protein expression when re-cultured under normoxia. (B) Western blot analysis. Decreased vimentin protein expression when re-cultured under normoxia.

Prostate cancer cells under hypoxic conditions exhibit upregulation of Snail and Slug, transcriptional regulators of the EMT program

The gene expression cataract that mediates EMT is regulated by one or more transcription factors, including Snail, Slug, Twist, Zeb1, Zeb2 and E47 (6–9) and these transcription factors are transcriptionally induced by upstream signals, including hypoxia or HIF-1α. Real-time PCR result showed that, hypoxic prostate cancer cells exhibited substantial upregulation of Snail and Slug compared with normoxic cells (Fig. 5).

Figure 5

Relative expression of Snail and Slug under hypoxia in PC3 cells. Prostate cancer cells under hypoxic conditions exhibit upregulation of Snail and Slug, transcriptional regulators of the EMT program.

Hypoxic conditions upregulated the invasive capability of epithelialorigin mesenchymal cells

The DU145 cell line was derived from prostate cancer brain metastasis, which showed fibroblastic-like phenotype under normoxia condition. The spindle shape of DU145 cells did not show any change when they were cultured under hypoxic environment, but real-time PCR results showed that DU145 cells exhibited substantial upregulation of Snail as compared with normoxic cells (Fig. 6A). Transwell assay also showed that Du145 has remarkably increased invasiveness, which related to the activation of HIF-1α signal pathway and the upregulation of Snail (Fig. 6B) under hypoxic conditions.

Figure 6

Hypoxic conditions upregulate the invasive capability of epithelial-origin mesenchymal cells. (A) Relative expression of snail under hypoxia in DU145 cells. (B) Transwell assay under hypoxia in DU145 cells.

Discussion

EMT has been defined as a three-part process in which cells firstly acquire a fibroblast-like morphology, and then downregulation of epithelial-specific proteins such as E-cadherin while simultaneously expression of mesenchymal proteins such as vimentin, and ultimately digest and migrate through extracellular matrix (ECM) (10). Hypoxia alone can trigger EMT in many solid tumors including hepatoblastoma, pancreatic, colon and breast cancer (5). Yet, the mechanisms involved in prostate cancer under hypoxic conditions remained unclear. A variety of physiological or pathophysiological conditions can cause imbalance in oxygen supply and demand. In response to reduction in oxygen supply, tissues initiate signaling events that trigger the upregulation of genes that are used to be 'silent' under normoxic conditions to allow for both short and long-term adaptation to hypoxia. Many of these events are initiated by the activation of the hypoxia-inducible factor (HIF) family of transcription factors of which HIF-1α plays an important role. Thus, we sought to determine whether the EMT observed in prostate cancer cells under hypoxic conditions attribute to enhance HIF-1α activity.

HIF-1α was analyzed to determine whether increased HIF-1α activity result in EMT in prostate cancer cells under hypoxic conditions. PC3 cells were incubated under hypoxic conditions for different periods of time (6, 24, 48 and 72 h) and western blot analysis was used to prove our hypothesis. Having established that hypoxia lead to elevated HIF-1α expression in prostate cancer cells, we next investigated the possibility for inhibition of HIF-1α to attenuate the mesenchymal characteristics of hypoxic cells. Towards this end, siRNAs were used to inhibit HIF-1α expression in these hypoxic cells and then compared their phenotype with their counterparts. Our data indicated changes in morphology, protein expression and invasion and supported the notion that hypoxia leads to EMT in prostate cancer cells.

Substantial evidence illustrated that EMT plays important roles in cancer metastasis and is also responsible for resistance to conventional chemotherapeutics (11). Tumor microenvironments, including hypoxia, have been documented as inducing this phenomenon through upregulation of Twist, Snail, Slug, Zeb1 and Zeb2 according to different cancer cell types (8,12,13). Hypoxic microenvironment can be found in central region of solid tumors and intratumoral hypoxia is conducive to high-grade and high invasive ability tumor cell screen which might contribute to tumor malignant progression (14–16). According to epidemiological and clinical studies, hypoxia and hypoxia-induced signaling pathways were associated with poor prognosis of patient including prostate cancer (17), and HIF-1α was reported to mediate hypoxia and EMT (5,9). However, the molecular mechanism of hypoxia that induced aggressiveness of prostate cancer has not been defined previously.

It was demonstrated that transcription factor HIF-1 is a heterodimer that composed of a constitutively expressed HIF-1β subunit and a HIF-1α subunit that mediates adaptive responses to changes in tissue oxygenation (3). The level of HIF-1α expression is determined not by the rates of protein synthesis but the protein degradation. In the case of normoxia, HIF-1α protein is degraded by O2-dependent prolylhydroxylation, which targets the protein for ubiquitylation by E3 ubiquitin-protein ligases. Stabilization of HIF-1α is critical in the transcriptional response to hypoxia. Our preliminary study suggested that high expression of HIF-1α can induce prostate cancer LnCap to undergo EMT under normoxia (18) and inhibition of β-catenin through shRNA causes a reversal of EMT and metastatic phenotypes induced by HIF-1α (19).

Some relevant research has already demonstrated EMT and HIF-1α in the different human PCa cell lines, for example, DU145, PC-3, PPC-1 and TSU. In these investigations, the majority of EMT studies in prostate cancer used PC-3 and DU145 human prostate cancer cells. Our previous research also included different human PCa cell lines. At the same time, we already successfully proved that overexpression of hypoxia inducible factor-1α (HIF-1α) could induce EMT in LNCaP cells, but not in PC3 (18–24). Based on these studies, in the present study, we simulated the hypoxia condition and explored the potential mechanism of HIF-1α on EMT in human prostate cancer cell lines PC3 and DU145.

In the present study, we confirmed that hypoxia treatment may induce epithelial origin of the prostate cancer cells PC3 to undergo typical EMT transforming, which includes changes in cell morphology, decreased expression of E-cadherin, increased stromal protein vimentin expression, high expression of Snail, accompanied by increased cell invasion and metastasis. Further research indicated that inhibition of HIF-1α expression under hypoxic conditions or reoxygenation reverses EMT which implies that HIF-1α plays a critical role under hypoxia induced EMT of prostate cancer and that the EMT process is a means, not an end for cancer metastasis. Our result is consistent with the study by Yang et al (8) who also confirmed that Twist is directly regulated by HIF-1α to induce tumor cell EMT transformation, while our result indicated that Snail is highly expressed in the hypoxic microenvironment, and its direct inhibition of E-cadherin expression in ovarian tumors were reported (7). Whether Snail mediated EMT phenomenon induced by activation of HIF-1α under hypoxia, or hypoxia directly regulates the expression of Snail, or whether there is a direct transcriptional regulation between HIF-1α and Snail requires further experimental studies. HIF-1α can also induce epithelial cell EMT transformation through other signaling pathways, such as the direct or indirect regulation of vimentin and fibronectin (25). In addition to HIF-1α, there are some other transcriptional factors that can induce EMT phenomenon under hypoxic conditions, such as regulation of E-cadherin and β-catenin by URG11 (upregulated gene 11) (26) and regulation of GSK3β through hypoxia (5) which can target Snail (27) and further induce EMT.

Phenomena were reported which described a mesenchymal to epithelial reverting transition (MErT), where mesenchymal-like prostate cancer cell lines revert to epithelial-like, and re-establish cellular adhesion during colonization when re-express E-cadherin in the liver tumor microenvironment (28–32). There is a report that hyperoxic treatment induces MErT in a rat adenocarcinoma model (33), so partial pressure of oxygen alone can make the tumor cells of epithelial origin conversion between EMT and MErT and it is of great importance to elucidate the mechanisms involved in oxygen pressure changes.

We may conclude that EMT is essential for tumor metastasis and MErT is conducive to the formation of metastasis. MErT transformation conditions might change when the re-expression of E-cadherin and the increase in the ability of the intercellular adhesion is essential. At the same time, we observed that not all cells underwent conversion of MErT accompanying with the time extension of reoxygenation, there are still part of the cells showing interstitial cells long spindle shape and related proteins were not restored to the level prior to hypoxia, which suggested that possibly only certain cells undergo some changes, such as having characteristics of stem cells (30,34–37), but not the conversion of MErT.

The evidence provides incentives for further investigation and optimization in establishing the mechanistic role of how HIF-1α and Snail work in the attenuation of EMT characteristics and drug resistance under hypoxia and their utility in the clinical practice in the treatment of prostate cancer for which there is no effective and curative therapy.

In conclusion, in the present study, we conclude that EMT could be induced by a mechanism that might involve the activation of HIF-1α-dependent cell signaling in hypoxic prostate cancer cells. Our results provide incentives for further investigation and optimization in establishing the mechanistic role of how HIF-1α and Snail work in the attenuation of EMT characteristics and drug resistance under hypoxia and their utility in the clinical practice in the treatment of prostate cancer for which there is no effective and curative therapy.

Acknowledgments

We thank Yatong Chen and Tao Peng for their technical support in research design, acquisition of data, or analysis and interpretation of data. The present study is supported by funds from the National Natural Science Foundation of China (81341066) and the Beijing Health System Special Foundation for building high-level health personnel.

References

1 

Siegel R, Naishadham D and Jemal A: Cancer statistics, 2013. CA Cancer J Clin. 63:11–30. 2013. View Article : Google Scholar : PubMed/NCBI

2 

Vaupel P and Mayer A: Hypoxia in cancer: Significance and impact on clinical outcome. Cancer Metastasis Rev. 26:225–239. 2007. View Article : Google Scholar : PubMed/NCBI

3 

Semenza GL: Targeting HIF-1 for cancer therapy. Nat Rev Cancer. 3:721–732. 2003. View Article : Google Scholar : PubMed/NCBI

4 

Kalluri R and Weinberg RA: The basics of epithelial-mesenchymal transition. J Clin Invest. 119:1420–1428. 2009. View Article : Google Scholar : PubMed/NCBI

5 

Cannito S, Novo E, Compagnone A, Valfrè di Bonzo L, Busletta C, Zamara E, Paternostro C, Povero D, Bandino A, Bozzo F, et al: Redox mechanisms switch on hypoxia-dependent epithelial-mesenchymal transition in cancer cells. Carcinogenesis. 29:2267–2278. 2008. View Article : Google Scholar : PubMed/NCBI

6 

Peinado H, Olmeda D and Cano A: Snail, Zeb and bHLH factors in tumour progression: An alliance against the epithelial phenotype? Nat Rev Cancer. 7:415–428. 2007. View Article : Google Scholar : PubMed/NCBI

7 

Imai T, Horiuchi A, Wang C, Oka K, Ohira S, Nikaido T and Konishi I: Hypoxia attenuates the expression of E-cadherin via up-regulation of SNAIL in ovarian carcinoma cells. Am J Pathol. 163:1437–1447. 2003. View Article : Google Scholar : PubMed/NCBI

8 

Yang MH, Wu MZ, Chiou SH, Chen PM, Chang SY, Liu CJ, Teng SC and Wu KJ: Direct regulation of TWIST by HIF-1alpha promotes metastasis. Nat Cell Biol. 10:295–305. 2008. View Article : Google Scholar : PubMed/NCBI

9 

Cheng ZX, Sun B, Wang SJ, Gao Y, Zhang YM, Zhou HX, Jia G, Wang YW, Kong R, Pan SH, et al: Nuclear factor-κB-dependent epithelial to mesenchymal transition induced by HIF-1α activation in pancreatic cancer cells under hypoxic conditions. PLoS One. 6:e237522011. View Article : Google Scholar

10 

Grünert S, Jechlinger M and Beug H: Diverse cellular and molecular mechanisms contribute to epithelial plasticity and metastasis. Nat Rev Mol Cell Biol. 4:657–665. 2003. View Article : Google Scholar : PubMed/NCBI

11 

Huber MA, Kraut N and Beug H: Molecular requirements for epithelial-mesenchymal transition during tumor progression. Curr Opin Cell Biol. 17:548–558. 2005. View Article : Google Scholar : PubMed/NCBI

12 

Min C, Eddy SF, Sherr DH and Sonenshein GE: NF-kappaB and epithelial to mesenchymal transition of cancer. J Cell Biochem. 104:733–744. 2008. View Article : Google Scholar : PubMed/NCBI

13 

Shin SR, Sánchez-Velar N, Sherr DH and Sonenshein GE: 7,12-dimethylbenz(a)anthracene treatment of a c-rel mouse mammary tumor cell line induces epithelial to mesenchymal transition via activation of nuclear factor-kappaB. Cancer Res. 66:2570–2575. 2006. View Article : Google Scholar : PubMed/NCBI

14 

Harris AL: Hypoxia - a key regulatory factor in tumour growth. Nat Rev Cancer. 2:38–47. 2002. View Article : Google Scholar : PubMed/NCBI

15 

Semenza GL: Defining the role of hypoxia-inducible factor 1 in cancer biology and therapeutics. Oncogene. 29:625–634. 2010. View Article : Google Scholar :

16 

Le QT, Denko NC and Giaccia AJ: Hypoxic gene expression and metastasis. Cancer Metastasis Rev. 23:293–310. 2004. View Article : Google Scholar : PubMed/NCBI

17 

Movsas B, Chapman JD, Greenberg RE, Hanlon AL, Horwitz EM, Pinover WH, Stobbe C and Hanks GE: Increasing levels of hypoxia in prostate carcinoma correlate significantly with increasing clinical stage and patient age: An Eppendorf pO2 study. Cancer. 89:2018–2024. 2000. View Article : Google Scholar : PubMed/NCBI

18 

Jiang YG, Luo Y, He DL, Li X, Zhang LL, Peng T, Li MC and Lin YH: Role of Wnt/beta-catenin signaling pathway in epithelial-mesenchymal transition of human prostate cancer induced by hypoxia-inducible factor-1alpha. Int J Urol. 14:1034–1039. 2007. View Article : Google Scholar : PubMed/NCBI

19 

Zhao JH, Luo Y, Jiang YG, He DL and Wu CT: Knockdown of β-Catenin through shRNA cause a reversal of EMT and metastatic phenotypes induced by HIF-1α. Cancer Invest. 29:377–382. 2011. View Article : Google Scholar : PubMed/NCBI

20 

Zhao L, Jiang YG, Ma J, Luo Y and Zhao JH: Characterization of prostate cancer cell lines and their epithelial-mesenchymal transition in subcutaneous tumors. Zhonghua Nan Ke Xue. 17:314–317. 2011.In Chinese. PubMed/NCBI

21 

Hugo H, Ackland ML, Blick T, Lawrence MG, Clements JA, Williams ED and Thompson EW: Epithelial-mesenchymal and mesenchymal-epithelial transitions in carcinoma progression. J Cell Physiol. 213:374–383. 2007. View Article : Google Scholar : PubMed/NCBI

22 

Thomas R and Kim MH: HIF-1 alpha: A key survival factor for serum-deprived prostate cancer cells. Prostate. 68:1405–1415. 2008. View Article : Google Scholar : PubMed/NCBI

23 

Zhong H, Agani F, Baccala AA, Laughner E, Rioseco-Camacho N, Isaacs WB, Simons JW and Semenza GL: Increased expression of hypoxia inducible factor-1alpha in rat and human prostate cancer. Cancer Res. 58:5280–5284. 1998.PubMed/NCBI

24 

Luo Y, He DL, Ning L, Shen SL, Li L, Li X, Zhau HE and Chung LW: Over-expression of hypoxia-inducible factor-1alpha increases the invasive potency of LNCaP cells in vitro. BJU Int. 98:1315–1319. 2006. View Article : Google Scholar : PubMed/NCBI

25 

Krishnamachary B, Berg-Dixon S, Kelly B, Agani F, Feldser D, Ferreira G, Iyer N, LaRusch J, Pak B, Taghavi P, et al: Regulation of colon carcinoma cell invasion by hypoxia-inducible factor 1. Cancer Res. 63:1138–1143. 2003.PubMed/NCBI

26 

Du R, Huang C, Bi Q, Zhai Y, Xia L, Liu J, Sun S and Fan D: URG11 mediates hypoxia-induced epithelial-to-mesenchymal transition by modulation of E-cadherin and beta-catenin. Biochem Biophys Res Commun. 391:135–141. 2009. View Article : Google Scholar : PubMed/NCBI

27 

Zhou BP, Deng J, Xia W, Xu J, Li YM, Gunduz M and Hung MC: Dual regulation of Snail by GSK-3beta-mediated phosphorylation in control of epithelial-mesenchymal transition. Nat Cell Biol. 6:931–940. 2004. View Article : Google Scholar : PubMed/NCBI

28 

Yates CC, Shepard CR, Stolz DB and Wells A: Co-culturing human prostate carcinoma cells with hepatocytes leads to increased expression of E-cadherin. Br J Cancer. 96:1246–1252. 2007. View Article : Google Scholar : PubMed/NCBI

29 

Yates C, Shepard CR, Papworth G, Dash A, Beer Stolz D, Tannenbaum S, Griffith L and Wells A: Novel three-dimensional organotypic liver bioreactor to directly visualize early events in metastatic progression. Adv Cancer Res. 97:225–246. 2007. View Article : Google Scholar : PubMed/NCBI

30 

van der Pluijm G: Epithelial plasticity, cancer stem cells and bone metastasis formation. Bone. 48:37–43. 2011. View Article : Google Scholar

31 

Chaffer CL, Brennan JP, Slavin JL, Blick T, Thompson EW and Williams ED: Mesenchymal-to-epithelial transition facilitates bladder cancer metastasis: Role of fibroblast growth factor receptor-2. Cancer Res. 66:11271–11278. 2006. View Article : Google Scholar : PubMed/NCBI

32 

Elloul S, Vaksman O, Stavnes HT, Trope CG, Davidson B and Reich R: Mesenchymal-to-epithelial transition determinants as characteristics of ovarian carcinoma effusions. Clin Exp Metastasis. 27:161–172. 2010. View Article : Google Scholar : PubMed/NCBI

33 

Moen I, Øyan AM, Kalland KH, Tronstad KJ, Akslen LA, Chekenya M, Sakariassen PO, Reed RK and Stuhr LE: Hyperoxic treatment induces mesenchymal-to-epithelial transition in a rat adenocarcinoma model. PLoS One. 4:e63812009. View Article : Google Scholar : PubMed/NCBI

34 

Hill RP, Marie-Egyptienne DT and Hedley DW: Cancer stem cells, hypoxia and metastasis. Semin Radiat Oncol. 19:106–111. 2009. View Article : Google Scholar : PubMed/NCBI

35 

Phinney DG: Twist, epithelial-to-mesenchymal transition, and stem cells. Stem Cells. 29:3–4. 2010. View Article : Google Scholar

36 

Martin A and Cano A: Tumorigenesis: Twist1 links EMT to self-renewal. Nat Cell Biol. 12:924–925. 2010. View Article : Google Scholar : PubMed/NCBI

37 

Zavadil J: A spotlight on regulatory networks connecting EMT and cancer stem cells. Cell Cycle. 9:2927–2935. 2010. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Li M, Wang YX, Luo Y, Zhao J, Li Q, Zhang J and Jiang Y: Hypoxia inducible factor-1α-dependent epithelial to mesenchymal transition under hypoxic conditions in prostate cancer cells. Oncol Rep 36: 521-527, 2016.
APA
Li, M., Wang, Y.X., Luo, Y., Zhao, J., Li, Q., Zhang, J., & Jiang, Y. (2016). Hypoxia inducible factor-1α-dependent epithelial to mesenchymal transition under hypoxic conditions in prostate cancer cells. Oncology Reports, 36, 521-527. https://doi.org/10.3892/or.2016.4766
MLA
Li, M., Wang, Y. X., Luo, Y., Zhao, J., Li, Q., Zhang, J., Jiang, Y."Hypoxia inducible factor-1α-dependent epithelial to mesenchymal transition under hypoxic conditions in prostate cancer cells". Oncology Reports 36.1 (2016): 521-527.
Chicago
Li, M., Wang, Y. X., Luo, Y., Zhao, J., Li, Q., Zhang, J., Jiang, Y."Hypoxia inducible factor-1α-dependent epithelial to mesenchymal transition under hypoxic conditions in prostate cancer cells". Oncology Reports 36, no. 1 (2016): 521-527. https://doi.org/10.3892/or.2016.4766
Copy and paste a formatted citation
x
Spandidos Publications style
Li M, Wang YX, Luo Y, Zhao J, Li Q, Zhang J and Jiang Y: Hypoxia inducible factor-1α-dependent epithelial to mesenchymal transition under hypoxic conditions in prostate cancer cells. Oncol Rep 36: 521-527, 2016.
APA
Li, M., Wang, Y.X., Luo, Y., Zhao, J., Li, Q., Zhang, J., & Jiang, Y. (2016). Hypoxia inducible factor-1α-dependent epithelial to mesenchymal transition under hypoxic conditions in prostate cancer cells. Oncology Reports, 36, 521-527. https://doi.org/10.3892/or.2016.4766
MLA
Li, M., Wang, Y. X., Luo, Y., Zhao, J., Li, Q., Zhang, J., Jiang, Y."Hypoxia inducible factor-1α-dependent epithelial to mesenchymal transition under hypoxic conditions in prostate cancer cells". Oncology Reports 36.1 (2016): 521-527.
Chicago
Li, M., Wang, Y. X., Luo, Y., Zhao, J., Li, Q., Zhang, J., Jiang, Y."Hypoxia inducible factor-1α-dependent epithelial to mesenchymal transition under hypoxic conditions in prostate cancer cells". Oncology Reports 36, no. 1 (2016): 521-527. https://doi.org/10.3892/or.2016.4766
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team