RNaseH2A is involved in human gliomagenesis through the regulation of cell proliferation and apoptosis

  • Authors:
    • Bin Dai
    • Peng Zhang
    • Yisong Zhang
    • Changcun Pan
    • Guolu Meng
    • Xinru Xiao
    • Zhen Wu
    • Wang Jia
    • Junting Zhang
    • Liwei Zhang
  • View Affiliations

  • Published online on: May 10, 2016     https://doi.org/10.3892/or.2016.4802
  • Pages: 173-180
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )


Abstract

Mutations in the RNaseH2A gene are involved in Aicardi‑Goutieres syndrome, an autosomal recessive neurological dysfunction; however, studies assessing RNaseH2A in relation to glioma are scarce. This study aimed to assess the role of RNaseH2A in glioma and to unveil the underlying mechanisms. RNaseH2A was silenced in glioblastoma cell lines U87 and U251. Gene expression was assessed in the cells transfected with RNaseH2A shRNA or scramble shRNA by microarrays, validated by quantitative real time PCR. Protein expression was evaluated by western blot analysis. Cell proliferation was assessed by the MTT assay; cell cycle distribution and apoptosis were analyzed by flow cytometry. Finally, the effects of RNaseH2A on colony formation and tumorigenicity were assessed in vitro and in a mouse xenograft model, respectively. RNaseH2A was successively knocked down in U87 and U251 cells. Notably, RNaseH2A silencing resulted in impaired cell proliferation, with 70.7 and 57.8% reduction in the U87 and U251 cells, respectively, with the cell cycle being blocked in the G0/G1 phase in vitro. Meanwhile, clone formation was significantly reduced by RNaseH2A knockdown, which also increased cell apoptosis by approximately 4.5-fold. In nude mice, tumor size was significantly decreased after RNaseH2A knockdown: 219.29±246.43 vs. 1160.26±222.61 mm3 for the control group; similar findings were obtained for tumor weight (0.261±0.245 and 1.127±0.232 g) in the shRNA and control groups, respectively). In the microarray data, RNaseH2A was shown to modulate several signaling pathways responsible for cell proliferation and apoptosis, such as IL-6 and FAS pathways. RNaseH2A may be involved in human gliomagenesis, likely by regulating signaling pathways responsible for cell proliferation and apoptosis.

Introduction

Human brain glioma, also known as neuroglioma, exhibits invasive growth without an overt boundary to surrounding tissues; it has unique cell origin, pathological structures, biological features, and clinical symptoms (16). Malignant glioma is a tumor with extremely high malignancy and recurrence rate; low total resection rate, high postoperative recurrence and residual lesion recurrence caused by radiation, and chemotherapeutic tolerance constitute the main problems faced by neurosurgeons (713). Considering the bottleneck in glioma treatment, dissecting relevant molecular mechanisms and finding tumor-related gene therapy approaches in human glioma attracts increasing attention for improved diagnosis, treatment and prognosis of glioma (6,1423).

Our laboratory and others have recently screened clinical relevant genes in glioma (2428); notably, we found a new glioma-expressed gene that plays an important regulatory role in the proliferation, progression and apoptosis of glioma cells. The gene is called ribonuclease H2, subunit A (RNaseH2A) also known as AGS4, JUNB, RNHL, RNHIA and RNaseHI. RNaseH2A (1148 bp), located on chromosome 19 (29,30), is a component of ribonuclease H2 (RNAseH2) and is responsible for its endoribonuclease activity (3133). RNaseH was discovered and isolated from calf thymus (34,35) and is widely distributed in mammalian cells, yeasts, prokaryotes and virus particles; it catalyzes in-nucleus degradation of RNA in DNA-RNA hybrids and is involved in reverse transcriptase of multifunctional enzymes in retroviruses, playing an important role in various stages of viral genome transcription (36,37). In eubacteria, RNaseH is required for several processes, including removal of RNA primers from Okazaki fragments, transcription of primers required for DNA polymerase I initiated DNA synthesis, and removal of R-ring to provide conditional initiating sites required for irregular DNA synthesis (38). In eukaryotes, RNaseH may play similar roles (39). Recent studies have shown that RNaseH2A mutations lead to Aicardi-Goutieres syndrome, an autosomal recessive neurological dysfunction, which mainly causes microcephaly, mental motor development retardation, cerebral calcification, increased IF-α and leukocytes in cerebrospinal fluid, fever, thrombocytopenia, and hepatitis (4042). RNaseH2A was proposed as a putative cancer target (31). In agreement, logistic regression analysis revealed that expression levels of RNaseH2A, among other genes, were positively correlated with aggressive prostate cancer (43). However, studies assessing RNaseH2A in relation to glioma are scarce. Therefore, in the present study, we aimed to assess the role of RNaseH2A in glioma, exploring the underlying mechanisms.

Our data demonstrated that RNaseH2A silencing altered cell proliferation and clone formation and enhanced apoptosis in the glioma cells in vitro. Meanwhile, RNaseH2A-knockdown xenografted glioma cells were less tumorigenic in a nude mouse model. Moreover, microarray data confirmed that RNaseH2A regulated genes that are frequently involved in multiple important cellular regulatory processes, including focal adhesion, cancer, p53 signaling, and cell cycle. Our findings provide a strong basis for finding new gene-based therapeutic approaches against human glioma.

Materials and methods

Cell culture

The human glioblastoma (GBM) cell lines U87, U251, A373 and A172 were maintained in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% fetal bovine serum (FBS) and 1% penicillin-streptomycin at 37°C in 5% CO2.

RNaseH2A knockdown in GBM cells

For RNaseH2A silencing, U85 and U251 cells were transfected with the pGCSIL-GFP plasmid containing RNaseH2A-specific shRNA, or non-effective shRNA control fragments (GeneChem, Montreal, QC, Canada).

Gene expression microarray analyses

Total RNA was extracted from the U87 cells (transfected with NC or RNaseH2A shRNA) using an RNeasy Mini-kit (Qiagen, Valencia, CA, USA), and quantified on a Nanodrop ND-1000 spectrophotometer (NanoDrop Technology). Samples with adequate RNA quality index (>7) were used for the microarray analyses.

Genome-wide transcriptome profiles were assessed by expression microarrays (GeneChip PrimeView human, Affymetrix) and validated by quantitative real-time PCR. Microarray data and fully detailed experimental procedures are published online at Gene Expression Omnibus (GEO, NCBI) (http://www.ncbi.nlm.nih.gov/geoprofiles/). Differentially expressed genes were identified using 1.5- or 2-fold change as cutoff values. Gene ontology enrichment analysis was carried out using David Functional Annotation Resources 6.7 (http://david.abcc.ncifcrf.gov/) and the KEGG pathway analysis.

Cell proliferation, apoptosis, and cell cycle analysis

GBM cells were seeded onto 96-well plates at 2×103 cells/well for culture. Cell proliferation was measured using the 3-(4,5-dimethyl-thiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay 96 h after transfection with NC or RNaseH2A shRNA. Briefly, 20 µl MTT solution (5 mg/ml) was added to each well for 4 h at 37°C. After the medium was aspirated, 100 µl dimethyl sulfoxide (DMSO) was added. Optical density was measured at 492 nm on a microplate reader (Bio-Rad Laboratories, Inc., Hercules, CA, USA). Viability index was calculated as experimental OD value/control OD value. Three independent experiments were performed in quadruplicate.

For cell cycle analysis, the cells were stained with propidium iodide (PI) solution (50 µg/ml) and analyzed on a FACSCalibur flow cytometer 24 h after transfection.

Apoptosis was assessed using a fluorescein isothiocyanate (FITC) Annexin V staining kit (Life Technologies, Grand Island, NY, USA) followed by fluorescence-activated cell sorter (FACS) analysis according to the manufacturer's instructions.

Colony formation assay

Following treatment, adherent cells were trypsinized and counted to determine viability. Then, 800 viable cells were seeded into each well of a 6-well plate (in triplicate). Cells were allowed to adhere and grow for 10–14 days. To visualize colonies, media were removed, and cells were fixed in paraformaldehyde for 30 min and stained with Giemsa solution (ECM 550, Chemicon). Finally, colonies were counted; data are presented as mean colony number ± SEM from at least three independent experiments.

RT-PCR and quantitative real-time PCR

RNA extraction was performed with TRIzol (Invitrogen Life Technologies, Carlsbad, CA, USA); cDNA was synthesized using RT-Phusion kit (Thermo Scientific, Waltham, MA, USA). Gene-specific mRNA levels were quantified by standard RT-PCR or quantitative PCR (qPCR), using the ΔΔCt method, as previously described (44). Primer sequences are listed in Table I.

Table I

List of primers.

Table I

List of primers.

GeneSequence
RNaseH2A-F AAGACCCTATTGGAGAGCGAG
RNaseH2A-R AGTTCAGGTTGTATTTGACCCG
GAPDH-F TGACTTCAACAGCGACACCCA
GAPDH-R CACCCTGTTGCTGTAGCCAAA
MDM2-F GAATCATCGGACTCAGGTACATC
MDM2-R TCTGTCTCACTAATTGCTCTCCT
SMAD3-F GACTACAGCCATTCCATCC
SMAD3-R CAGGTCCAAGTTATTATGTGC
FGF2-F ATCAAAGGAGTGTGTGCTAACC
FGF2-R ACTGCCCAGTTCGTTTCAGTG
SMAD2-F AGAGGGAAACAAGAACAGG
SMAD2-R ATGCTCTGGCGTCTACTG
IGF1R-F TGCGTGAGAGGATTGAGTTTC
IGF1R-R CTTATTGGCGTTGAGGTATGC
IL6-F CAAATTCGGTACATCCTCG
IL6-R CTCTGGCTTGTTCCTCACTA
IL8-F TGGCAGCCTTCCTGATTT
IL8-R AACCCTCTGCACCCAGTT
FAS-F ACACTCACCAGCAACACCAA
FAS-R CTTCCTTTCTCTTCACCCAAACA
BIRC5-F ACCGCATCTCTACATTCAAG
BIRC5-R CAAGTCTGGCTCGTTCTC
TGFBR2-F GTGCCAACAACATCAACC
TGFBR2-R GACTGCCACTGTCTCAAACT
Western blot analysis

After treatment, the cells were harvested and lysed in RIPA lysis buffer (50 mM Tris-HCl, pH 7.4, 150 mM NaCl, 1% Triton X-100, 1% sodium deoxycholate, and 0.1% SDS) that contained a protease inhibitor cocktail (Sigma-Aldrich, St. Louis, MO, USA) for 30 min at 4°C. Forty micrograms of protein from each lysate were fractionated by 10% SDS-PAGE and transferred to polyvinylidene difluoride membranes (Millipore, Bedford, MA, USA). After blocking with 5% nonfat milk in PBS-Tween-20 for 1 h at room temperature, the membranes were blotted with the appropriate primary antibody. Primary antibodies against RNaseH2A (1:1,000; Proteintech), IL-6 (1:2,000; Abcam), FAS (1:1,000; Abcam), IGTA2 (1:10,000; Abcam), GAPDH (1:20,000; Santa Cruz Biotechnology, Inc., Santa Cruz, CA, USA) were incubated at 4°C overnight. After washing four times with TBST, the membranes were incubated with a horseradish peroxidase (HRP)-conjugated anti-rabbit or anti-mouse secondary antibody (Santa Cruz Biotechnology, Inc.) for 2 h. The proteins were visualized using enhanced chemiluminescence (ECL; Beyotime Institute of Biotechnology, Nantong, China).

In vivo GBM xenograft studies

All mouse care and experiments were carried out with approval of the Institutional Animal Care and Use Committee at the Beijing Tian Tan Hospital, Capital Medical University. Subcutaneous xenograft models were performed by injecting U87 cells transfected with NC or RNaseH2A shRNA as previously described (45).

Statistical analysis

Results are representative of 3 independent experiments. Data are expressed as the mean ± standard deviation (SD). Student's t-test was employed to compare groups. P<0.05 was considered statistically significant. SPSS 10.0 software (SPSS, Chicago, IL, USA) was used for statistical analyses.

Results

The RNaseH2A gene is expressed in GBM cells

Four GBM cell lines, including U87, U251, A373 and A172 were assessed for RNaseH2A expression by RT-PCR. RNaseH2A was detected in all of the cell lines (Fig. 1A).

RNaseH2A silencing suppresses glioma cell proliferation in vitro and in vivo

Two cell lines (U87 and U251) were selected for RNA interference experiments, to assess RNaseH2A function in glioma cells. As shown in Fig. 1B and C, RNaseH2A was successfully silenced in both cell lines. RNaseH2A mRNA expression was reduced to a greater extent in the U251 cell line.

Cell proliferation analysis was performed in the two glioma cell lines (U87 and U251) transfected with RNaseH2A-shRNA. Both glioma cell lines showed significantly reduced viability after RNaseH2A silencing (Fig. 2A and B). Five days after shRNA transfection, cell viability was reduced by 70.7 and 57.8% in the U87 and U251 cells, respectively. In accordance, colony formation was also significantly decreased (P<0.05) in the U87 cells after RNaseH2A knockdown, compared with the control values (Fig. 2C). Furthermore, xenografted tumor growth in the RNaseH2A-shRNA group was markedly reduced compared with that of the normal control group in vivo (Fig. 2D–F). Indeed, 34 days after U87 cell injection, tumor volumes were 219.29±246.43 and 1160.26±222.61 mm3 in the RNaseH2A-shRNA and normal control groups, respectively; tumor weights of 1.127±0.232 and 0.261±0.245 g were obtained from the control and RNaseH2A-silenced cells, respectively (P<0.01). These findings demonstrated that RNaseH2A was required for glioma cell proliferation, both in vitro and in vivo.

RNaseH2A silencing causes cell cycle arrest in the G0/G1 phase and apoptosis in glioma cells

To explore the mechanism underlying the observed impaired growth of glioma cells after RNaseH2A silencing, cell cycle distribution was assessed by flow cytometry. RNaseH2A silencing resulted in an increased percentage of U87 cells in the G0/G1 phase, with 75.14±1.004 and 61.51±0.43% obtained respectively, in the RNaseH2A knockdown and control groups, respectively (P<0.01, Fig. 3A).

The effect of RNaseH2A on apoptosis in glioma cells (Fig. 3B) was also investigated. As shown in Fig. 3B, RNaseH2A knockdown induced cell apoptosis by 4.5-fold compared to the normal control cells.

RNaseH2A silencing induces differential expression of genes involved in multiple cell signaling pathways

To further explore the biological significance of RNaseH2A in glioma cells, gene expression profiles of U87 cells transfected with or without RNaseH2A shRNA were assessed. As shown in the heat map (Fig. 4A), gene expression profiles in the NC and RNaseH2A shRNA groups were remarkably different. A total of 821 upregulated and 941 downregulated genes were found in the RNaseH2A shRNA-transfected U87 cells. GO and KEGG pathway analysis revealed that the differentially expressed genes are frequently involved in multiple important cellular regulatory processes, including focal adhesion, cancer, p53 signaling, and cell cycle (Fig. 4B). Therefore, our data suggest that RNaseH2A shRNA affects various genes involved in important biological processes.

To validate the microarray data, qRT-PCR and western blot analysis were carried out. Protein and gene expression levels were consistent with the microarray data. For instance, IL-6 mRNA levels were decreased significantly in the RNaseH2A shRNA group compared to the control group, while FAS mRNA amounts were increased significantly in the RNaseH2A shRNA group compared to the control group (P<0.001); western blotting yielded similar results. These findings indicated that IL-6 and FAS might be suitable RNaseH2A target genes (Fig. 4C and D).

Discussion

RNaseH2A was expressed in all glioma cells assessed. Notably, RNaseH2A knockdown by shRNA silencing resulted in reduced proliferation and viability of the tumor cells, which were blocked in the G0/G1 phase. In addition, RNaseH2A-knockdown cells showed increased apoptosis in vitro. In agreement, clone formation (in vitro) and tumor growth (in vivo) were significantly decreased after RNaseH2A silencing. Gene-chip based transcriptome assay indicated that RNaseH2A plays an important role in several signaling pathways involved in cell proliferation, including the IL-6 and FAS pathways.

Gene dysregulation is a hallmark of tumor genesis and progression (4651), with post-transcriptional regulation of messenger RNA constituting an important step. Ribonucleases (RNases) catalyze RNA breakdown, thus influencing mRNA turnover and gene expression; their dysfunction is linked to various types of tumors. For instance, failure to recruit PARN, a poly A ribonuclease, has been observed in malignant glioma (52,53). In addition, reduction and/or depletion of XRN1, a 5′–3′ exonuclease which initiates mRNA decay, is implicated in primary osteogenic sarcoma and its derived cell lines (54). Furthermore, the gene encoding truncated RNase L is positively correlated with hereditary prostate cancer (55), while moderated reduction in enzyme activity is related to a higher risk of prostate and colorectal cancers (56) as well as pancreatic carcinoma (5759). IRE1, a transmembrane endoribonuclease found in the endoplasmic reticulum (60), can act as a tumor suppressor, deciding the fate of cancer cells (61). RNases from the miRNA pathway, including Drosha, Dicer, and Ago2, are also implicated in tumor biology. For instance, elevated expression of Drosha was found in esophageal cancers (62), with its suppression leading to decreased cancer cell proliferation; in addition, elevated mRNA levels and genomic copy numbers of Drosha were found in clinical cervical squamous cell carcinoma samples and derived cell lines (63). Several studies have reported overexpression of Dicer in multiple cancers, including salivary gland, lung, prostate, and ovary carcinomas, as well as Burkitt's lymphoma; Ago2-overexpression was also found in these cancers (6468).

RNaseH2A is a component of the heterotrimeric type II ribonuclease H enzyme (RNAseH2), which provides the main ribonuclease H activity (3133). Consistent with our findings, a previous study indicated that RNaseH2A is a putative anticancer drug target in transformed stem cells (31). However, how RNaseH2A is involved in tumor genesis and progression remains unclear. In this study, gene silencing and transcriptome profiling were combined to assess downstream signaling pathways mediating the effect of RNaseH2A. Multiple genes involved in important cellular processes, including focal adhesion, cancer, p53 signaling, and cell cycle, were differentially expressed after RNaseH2A silencing. Further analysis demonstrated that IL-6 was downregulated after RNaseH2A knockdown. GBM cells produced IL-6 in vitro and in vivo (69,70), and Goswami et al reported that IL-6 mediated autocrine growth promotion in the human GBM multiforme cell line U87MG (71); in addition, targeting IL-6Rα or IL-6 expression in GSCs impaired cell growth and increased the survival of mice bearing intracranial human glioma xenografts (71), in agreement with our findings of decreased xenograft growth after RNaseH2A silencing. We also found that FAS expression was upregulated after RNaseH2A silencing, which is consistent with the enhanced apoptosis described above after RNaseH2A silencing. FAS receptor is a death receptor on the surface of cells that leads to programmed cell death (72). Activation of FAS was shown to initiate apoptosis in different glioma cell lines (73). Fas-ligand, which is expressed in GBM cell lines and primary astrocytic brain tumors (74), can lead to >90% inhibition of clonal tumor cell growth in high grade gliomas ex vivo (73). Thus, silencing of RNaseH2A may inhibit proliferation and promote apoptosis in glioma cells, via downregulation of IL-6 and upregulation of FAS simultaneously.

In summary, we unveiled a possible mechanism by which RNaseH2A contributes to glioma cell proliferation. Indeed, RNaseH2A silencing resulted in growth arrest and apoptosis in glioma cells, possibly through IL-6 and FAS regulation. These findings indicate that RNaseH2A upregulation may contribute to gliomagenesis and progression, via modulation of factors involved in cell growth and apoptosis. Therefore, RNaseH2A should be considered as a potential molecular target for glioma diagnosis and treatment.

Acknowledgments

This study was supported by the National Key Technologies R&D Program of the Ministry of Science and Technology of China (no. 2013BAI09B03)

References

1 

Adamczyk LA, Williams H, Frankow A, Ellis HP, Haynes HR, Perks C, Holly JM and Kurian KM: Current understanding of circulating tumor cells–potential value in malignancies of the central nervous system. Front Neurol. 6:1742015. View Article : Google Scholar

2 

Aparicio-Blanco J and Torres-Suárez AI: Glioblastoma multiforme and lipid nanocapsules: a review. J Biomed Nanotechnol. 11:1283–1311. 2015. View Article : Google Scholar : PubMed/NCBI

3 

Cuddapah VA, Robel S, Watkins S and Sontheimer H: A neurocentric perspective on glioma invasion. Nat Rev Neurosci. 15:455–465. 2014. View Article : Google Scholar : PubMed/NCBI

4 

Errico A: CNS cancer: new options for glioblastoma. Nat Rev Clin Oncol. 11:1242014.PubMed/NCBI

5 

Parsons DW, Jones S, Zhang X, Lin JC, Leary RJ, Angenendt P, Mankoo P, Carter H, Siu IM, Gallia GL, et al: An integrated genomic analysis of human glioblastoma multiforme. Science. 321:1807–1812. 2008. View Article : Google Scholar : PubMed/NCBI

6 

Westphal M and Lamszus K: Circulating biomarkers for gliomas. Nat Rev Neurol. 11:556–566. 2015. View Article : Google Scholar : PubMed/NCBI

7 

Zhang ZZ, Shields LB, Sun DA, Zhang YP, Hunt MA and Shields CB: The art of intraoperative glioma identification. Front Oncol. 5:1752015. View Article : Google Scholar : PubMed/NCBI

8 

Samdani AF, Torre-Healy A, Khalessi A, McGirt M, Jallo GI and Carson B: Intraventricular ganglioglioma: a short illustrated review. Acta Neurochir (Wien). 151:635–640. 2009. View Article : Google Scholar

9 

Gautschi OP, van Leyen K, Cadosch D, Hildebrandt G and Fournier JY: Fluorescence guided resection of malignant brain tumors-breakthrough in the surgery of brain tumors. Praxis Bern (1994). 98:643–647. 2009.In German. View Article : Google Scholar

10 

Signorelli F, Guyotat J, Elisevich K and Barbagallo GM: Review of current microsurgical management of insular gliomas. Acta Neurochir (Wien). 152:19–26. 2010. View Article : Google Scholar

11 

Bello L, Fava E, Carrabba G, Papagno C and Gaini SM: Present day's standards in microsurgery of low-grade gliomas. Adv Tech Stand Neurosurg. 35:113–157. 2010.PubMed/NCBI

12 

Furnari FB, Fenton T, Bachoo RM, Mukasa A, Stommel JM, Stegh A, Hahn WC, Ligon KL, Louis DN, Brennan C, et al: Malignant astrocytic glioma: genetics, biology, and paths to treatment. Genes Dev. 21:2683–2710. 2007. View Article : Google Scholar : PubMed/NCBI

13 

Lacroix M, Abi-Said D, Fourney DR, Gokaslan ZL, Shi W, DeMonte F, Lang FF, McCutcheon IE, Hassenbusch SJ, Holland E, et al: A multivariate analysis of 416 patients with glioblastoma multiforme: prognosis, extent of resection, and survival. J Neurosurg. 95:190–198. 2001. View Article : Google Scholar

14 

Ohgaki H and Kleihues P: Genetic alterations and signaling pathways in the evolution of gliomas. Cancer Sci. 100:2235–2241. 2009. View Article : Google Scholar : PubMed/NCBI

15 

Marumoto T and Saya H: Molecular biology of glioma. Adv Exp Med Biol. 746:2–11. 2012. View Article : Google Scholar : PubMed/NCBI

16 

Patel M, Vogelbaum MA, Barnett GH, Jalali R and Ahluwalia MS: Molecular targeted therapy in recurrent glioblastoma: current challenges and future directions. Expert Opin Investig Drugs. 21:1247–1266. 2012. View Article : Google Scholar : PubMed/NCBI

17 

Spasic M, Chow F, Tu C, Nagasawa DT and Yang I: Molecular characteristics and pathways of Avastin for the treatment of glioblastoma multiforme. Neurosurg Clin N Am. 23:417–427. 2012. View Article : Google Scholar : PubMed/NCBI

18 

Zhu JJ and Wong ET: Personalized medicine for glioblastoma: current challenges and future opportunities. Curr Mol Med. 13:358–367. 2013.PubMed/NCBI

19 

Goodenberger ML and Jenkins RB: Genetics of adult glioma. Cancer Genet. 205:613–621. 2012. View Article : Google Scholar : PubMed/NCBI

20 

Assi H, Candolfi M, Baker G, Mineharu Y, Lowenstein PR and Castro MG: Gene therapy for brain tumors: basic developments and clinical implementation. Neurosci Lett. 527:71–77. 2012. View Article : Google Scholar : PubMed/NCBI

21 

Carén H, Pollard SM and Beck S: The good, the bad and the ugly: epigenetic mechanisms in glioblastoma. Mol Aspects Med. 34:849–862. 2013. View Article : Google Scholar :

22 

Rizzo D, Ruggiero A, Martini M, Rizzo V, Maurizi P and Riccardi R: Molecular biology in pediatric high-grade glioma: impact on prognosis and treatment. BioMed Res Int. 2015:2151352015. View Article : Google Scholar : PubMed/NCBI

23 

Mischel PS and Cloughesy TF: Targeted molecular therapy of GBM. Brain Pathol. 13:52–61. 2003. View Article : Google Scholar : PubMed/NCBI

24 

Zhang L, Chen LH, Wan H, Yang R, Wang Z, Feng J, Yang S, Jones S, Wang S, Zhou W, et al: Exome sequencing identifies somatic gain-of-function PPM1D mutations in brainstem gliomas. Nat Genet. 46:726–730. 2014. View Article : Google Scholar : PubMed/NCBI

25 

Wan W, Xu X, Jia G, Li W, Wang J, Ren T, Wu Z, Zhang J, Zhang L and Lu Y: Differential expression of p42.3 in low- and high-grade gliomas. World J Surg Oncol. 12:1852014. View Article : Google Scholar : PubMed/NCBI

26 

Melton C, Reuter JA, Spacek DV and Snyder M: Recurrent somatic mutations in regulatory regions of human cancer genomes. Nat Genet. 47:710–716. 2015. View Article : Google Scholar : PubMed/NCBI

27 

Peters I, Tezval H, Kramer MW, Wolters M, Grünwald V, Kuczyk MA and Serth J: Implications of TCGA network data on 2nd generation immunotherapy concepts based on PD-L1 and PD-1 target structures. Aktuelle Urol. 46:481–485. 2015.In German. PubMed/NCBI

28 

Chen X, Shi K, Wang Y, Song M, Zhou W, Tu H and Lin Z: Clinical value of integrated-signature miRNAs in colorectal cancer: miRNA expression profiling analysis and experimental validation. Oncotarget. 6:37544–37556. 2015.PubMed/NCBI

29 

Moelling K and Broecker F: The reverse transcriptase-RNase H: from viruses to antiviral defense. Ann NY Acad Sci. 1341:126–135. 2015. View Article : Google Scholar : PubMed/NCBI

30 

Natiq A, Elalaoui SC, Miesch S, Bonnet C, Jonveaux P, Amzazi S and Sefiani A: A new case of de novo 19p13.2p13.12 deletion in a girl with overgrowth and severe developmental delay. Mol Cytogenet. 7:402014. View Article : Google Scholar : PubMed/NCBI

31 

Flanagan JM, Funes JM, Henderson S, Wild L, Carey N and Boshoff C: Genomics screen in transformed stem cells reveals RNASEH2A, PPAP2C, and ADARB1 as putative anticancer drug targets. Mol Cancer Ther. 8:249–260. 2009. View Article : Google Scholar : PubMed/NCBI

32 

Feng S and Cao Z: Is the role of human RNase H2 restricted to its enzyme activity? Prog Biophys Mol Biol. Nov 19–2015.Epub ahead of print. PubMed/NCBI

33 

Reijns MA, Bubeck D, Gibson LC, Graham SC, Baillie GS, Jones EY and Jackson AP: The structure of the human RNase H2 complex defines key interaction interfaces relevant to enzyme function and human disease. J Biol Chem. 286:10530–10539. 2011. View Article : Google Scholar :

34 

Hausen P and Stein H: Ribonuclease H. An enzyme degrading the RNA moiety of DNA-RNA hybrids. Eur J Biochem. 14:278–283. 1970. View Article : Google Scholar : PubMed/NCBI

35 

Stein H and Hausen P: Enzyme from calf thymus degrading the RNA moiety of DNA-RNA hybrids: effect on DNA-dependent RNA polymerase. Science. 166:393–395. 1969. View Article : Google Scholar : PubMed/NCBI

36 

Coté ML and Roth MJ: Murine leukemia virus reverse transcriptase: structural comparison with HIV-1 reverse transcriptase. Virus Res. 134:186–202. 2008. View Article : Google Scholar : PubMed/NCBI

37 

Mizuno M, Yasukawa K and Inouye K: Insight into the mechanism of the stabilization of moloney murine leukaemia virus reverse transcriptase by eliminating RNase H activity. Biosci Biotechnol Biochem. 74:440–442. 2010. View Article : Google Scholar : PubMed/NCBI

38 

Schultz SJ and Champoux JJ: RNase H activity: structure, specificity, and function in reverse transcription. Virus Res. 134:86–103. 2008. View Article : Google Scholar : PubMed/NCBI

39 

Rice GI, Forte GM, Szynkiewicz M, Chase DS, Aeby A, Abdel-Hamid MS, Ackroyd S, Allcock R, Bailey KM, Balottin U, et al: Assessment of interferon-related biomarkers in Aicardi-Goutières syndrome associated with mutations in TREX1, RNASEH2A, RNASEH2B, RNASEH2C, SAMHD1, and ADAR: a case-control study. Lancet Neurol. 12:1159–1169. 2013. View Article : Google Scholar : PubMed/NCBI

40 

Orcesi S, La Piana R and Fazzi E: Aicardi-Goutieres syndrome. Br Med Bull. 89:183–201. 2009. View Article : Google Scholar : PubMed/NCBI

41 

Crow YJ: Aicardi-Goutières syndrome. Handb Clin Neurol. 113:1629–1635. 2013. View Article : Google Scholar

42 

Crow YJ and Manel N: Aicardi-Goutières syndrome and the type I interferonopathies. Nat Rev Immunol. 15:429–440. 2015. View Article : Google Scholar : PubMed/NCBI

43 

Williams KA, Lee M, Hu Y, Andreas J, Patel SJ, Zhang S, Chines P, Elkahloun A, Chandrasekharappa S, Gutkind JS, et al: A systems genetics approach identifies CXCL14, ITGAX, and LPCAT2 as novel aggressive prostate cancer susceptibility genes. PLoS Genet. 10:e10048092014. View Article : Google Scholar : PubMed/NCBI

44 

Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT Method. Methods. 25:402–408. 2001. View Article : Google Scholar

45 

Dai B, Wan W, Zhang P, Zhang Y, Pan C, Meng G, Xiao X, Wu Z, Jia W, Zhang J, et al: SET and MYND domain-containing protein 3 is overexpressed in human glioma and contributes to tumorigenicity. Oncol Rep. 34:2722–2730. 2015.PubMed/NCBI

46 

Yun K, Fidler AE, Eccles MR and Reeve AE: Insulin-like growth factor II and WT1 transcript localization in human fetal kidney and Wilms' tumor. Cancer Res. 53:5166–5171. 1993.PubMed/NCBI

47 

Pritchard-Jones RO, Dunn DB, Qiu Y, Varey AH, Orlando A, Rigby H, Harper SJ and Bates DO: Expression of VEGFxxxb, the inhibitory isoforms of VEGF, in malignant melanoma. Br J Cancer. 97:223–230. 2007. View Article : Google Scholar : PubMed/NCBI

48 

Ismail PM, Lu T and Sawadogo M: Loss of USF transcriptional activity in breast cancer cell lines. Oncogene. 18:5582–5591. 1999. View Article : Google Scholar : PubMed/NCBI

49 

Macé K, Aguilar F, Wang JS, Vautravers P, Gómez-Lechón M, Gonzalez FJ, Groopman J, Harris CC and Pfeifer AM: Aflatoxin B1-induced DNA adduct formation and p53 mutations in CYP450-expressing human liver cell lines. Carcinogenesis. 18:1291–1297. 1997. View Article : Google Scholar

50 

Cox C, Bignell G, Greenman C, Stabenau A, Warren W, Stephens P, Davies H, Watt S, Teague J, Edkins S, et al: A survey of homozygous deletions in human cancer genomes. Proc Natl Acad Sci USA. 102:4542–4547. 2005. View Article : Google Scholar : PubMed/NCBI

51 

Doyle GA, Bourdeau-Heller JM, Coulthard S, Meisner LF and Ross J: Amplification in human breast cancer of a gene encoding a c-myc mRNA-binding protein. Cancer Res. 60:2756–2759. 2000.PubMed/NCBI

52 

Suswam E, Li Y, Zhang X, Gillespie GY, Li X, Shacka JJ, Lu L, Zheng L and King PH: Tristetraprolin down-regulates interleukin-8 and vascular endothelial growth factor in malignant glioma cells. Cancer Res. 68:674–682. 2008. View Article : Google Scholar : PubMed/NCBI

53 

Lai WS, Kennington EA and Blackshear PJ: Tristetraprolin and its family members can promote the cell-free deadenylation of AU-rich element-containing mRNAs by poly(A) ribonuclease. Mol Cell Biol. 23:3798–3812. 2003. View Article : Google Scholar : PubMed/NCBI

54 

Zhang K, Dion N, Fuchs B, Damron T, Gitelis S, Irwin R, O'Connor M, Schwartz H, Scully SP, Rock MG, et al: The human homolog of yeast SEP1 is a novel candidate tumor suppressor gene in osteogenic sarcoma. Gene. 298:121–127. 2002. View Article : Google Scholar : PubMed/NCBI

55 

Rökman A, Ikonen T, Seppälä EH, Nupponen N, Autio V, Mononen N, Bailey-Wilson J, Trent J, Carpten J, Matikainen MP, et al: Germline alterations of the RNASEL gene, a candidate HPC1 gene at 1q25, in patients and families with prostate cancer. Am J Hum Genet. 70:1299–1304. 2002. View Article : Google Scholar : PubMed/NCBI

56 

Krüger S, Silber AS, Engel C, Görgens H, Mangold E, Pagenstecher C, Holinski-Feder E, von Knebel Doeberitz M, Moeslein G, Dietmaier W, et al German Hereditary Non-Polyposis Colorectal Cancer Consortium: Arg462Gln sequence variation in the prostate-cancer-susceptibility gene RNASEL and age of onset of hereditary non-polyposis colorectal cancer: a case-control study. Lancet Oncol. 6:566–572. 2005. View Article : Google Scholar : PubMed/NCBI

57 

Bartsch DK, Fendrich V, Slater EP, Sina-Frey M, Rieder H, Greenhalf W, Chaloupka B, Hahn SA, Neoptolemos JP and Kress R: RNASEL germline variants are associated with pancreatic cancer. Int J Cancer. 117:718–722. 2005. View Article : Google Scholar : PubMed/NCBI

58 

Shook SJ, Beuten J, Torkko KC, Johnson-Pais TL, Troyer DA, Thompson IM and Leach RJ: Association of RNASEL variants with prostate cancer risk in Hispanic Caucasians and African Americans. Clin Cancer Res. 13:5959–5964. 2007. View Article : Google Scholar : PubMed/NCBI

59 

Rennert H, Zeigler-Johnson CM, Addya K, Finley MJ, Walker AH, Spangler E, Leonard DG, Wein A, Malkowicz SB and Rebbeck TR: Association of susceptibility alleles in ELAC2/HPC2, RNASEL/HPC1, and MSR1 with prostate cancer severity in European American and African American men. Cancer Epidemiol Biomarkers Prev. 14:949–957. 2005. View Article : Google Scholar : PubMed/NCBI

60 

Sidrauski C and Walter P: The transmembrane kinase Ire1p is a site-specific endonuclease that initiates mRNA splicing in the unfolded protein response. Cell. 90:1031–1039. 1997. View Article : Google Scholar : PubMed/NCBI

61 

Davies MP, Barraclough DL, Stewart C, Joyce KA, Eccles RM, Barraclough R, Rudland PS and Sibson DR: Expression and splicing of the unfolded protein response gene XBP-1 are significantly associated with clinical outcome of endocrine-treated breast cancer. Int J Cancer. 123:85–88. 2008. View Article : Google Scholar : PubMed/NCBI

62 

Sugito N, Ishiguro H, Kuwabara Y, Kimura M, Mitsui A, Kurehara H, Ando T, Mori R, Takashima N, Ogawa R, et al: RNASEN regulates cell proliferation and affects survival in esophageal cancer patients. Clin Cancer Res. 12:7322–7328. 2006. View Article : Google Scholar : PubMed/NCBI

63 

Muralidhar B, Goldstein LD, Ng G, Winder DM, Palmer RD, Gooding EL, Barbosa-Morais NL, Mukherjee G, Thorne NP, Roberts I, et al: Global microRNA profiles in cervical squamous cell carcinoma depend on Drosha expression levels. J Pathol. 212:368–377. 2007. View Article : Google Scholar : PubMed/NCBI

64 

Kaul D and Sikand K: Defective RNA-mediated c-myc gene silencing pathway in Burkitt's lymphoma. Biochem Biophys Res Commun. 313:552–554. 2004. View Article : Google Scholar

65 

Flavin RJ, Smyth PC, Finn SP, Laios A, O'Toole SA, Barrett C, Ring M, Denning KM, Li J, Aherne ST, et al: Altered eIF6 and Dicer expression is associated with clinicopathological features in ovarian serous carcinoma patients. Mod Pathol. 21:676–684. 2008. View Article : Google Scholar : PubMed/NCBI

66 

Chiosea S, Jelezcova E, Chandran U, Acquafondata M, McHale T, Sobol RW and Dhir R: Up-regulation of dicer, a component of the MicroRNA machinery, in prostate adenocarcinoma. Am J Pathol. 169:1812–1820. 2006. View Article : Google Scholar : PubMed/NCBI

67 

Chiosea S, Jelezcova E, Chandran U, Luo J, Mantha G, Sobol RW and Dacic S: Overexpression of Dicer in precursor lesions of lung adenocarcinoma. Cancer Res. 67:2345–2350. 2007. View Article : Google Scholar : PubMed/NCBI

68 

Chiosea SI, Barnes EL, Lai SY, Egloff AM, Sargent RL, Hunt JL and Seethala RR: Mucoepidermoid carcinoma of upper aerodigestive tract: clinicopathologic study of 78 cases with immunohistochemical analysis of Dicer expression. Virchows Arch. 452:629–635. 2008. View Article : Google Scholar : PubMed/NCBI

69 

Wang H, Lathia JD, Wu Q, Wang J, Li Z, Heddleston JM, Eyler CE, Elderbroom J, Gallagher J, Schuschu J, et al: Targeting interleukin 6 signaling suppresses glioma stem cell survival and tumor growth. Stem Cells. 27:2393–2404. 2009. View Article : Google Scholar : PubMed/NCBI

70 

Chang CY, Li MC, Liao SL, Huang YL, Shen CC and Pan HC: Prognostic and clinical implication of IL-6 expression in glioblastoma multiforme. J Clin Neurosci. 12:930–933. 2005. View Article : Google Scholar : PubMed/NCBI

71 

Goswami S, Gupta A and Sharma SK: Interleukin-6-mediated autocrine growth promotion in human glioblastoma multiforme cell line U87MG. J Neurochem. 71:1837–1845. 1998. View Article : Google Scholar : PubMed/NCBI

72 

Green DR and Llambi F: Cell Death Signaling. Cold Spring Harb Perspect Biol. 7:2015.pii: a006080. View Article : Google Scholar : PubMed/NCBI

73 

Frei K, Ambar B, Adachi N, Yonekawa Y and Fontana A: Ex vivo malignant glioma cells are sensitive to Fas (CD95/APO-1) ligand-mediated apoptosis. J Neuroimmunol. 87:105–113. 1998. View Article : Google Scholar : PubMed/NCBI

74 

Gratas C, Tohma Y, Van Meir EG, Klein M, Tenan M, Ishii N, Tachibana O, Kleihues P and Ohgaki H: Fas ligand expression in glioblastoma cell lines and primary astrocytic brain tumors. Brain Pathol. 7:863–869. 1997. View Article : Google Scholar : PubMed/NCBI

Related Articles

Journal Cover

July-2016
Volume 36 Issue 1

Print ISSN: 1021-335X
Online ISSN:1791-2431

Sign up for eToc alerts

Recommend to Library

Copy and paste a formatted citation
x
Spandidos Publications style
Dai B, Zhang P, Zhang Y, Pan C, Meng G, Xiao X, Wu Z, Jia W, Zhang J, Zhang L, Zhang L, et al: RNaseH2A is involved in human gliomagenesis through the regulation of cell proliferation and apoptosis. Oncol Rep 36: 173-180, 2016
APA
Dai, B., Zhang, P., Zhang, Y., Pan, C., Meng, G., Xiao, X. ... Zhang, L. (2016). RNaseH2A is involved in human gliomagenesis through the regulation of cell proliferation and apoptosis. Oncology Reports, 36, 173-180. https://doi.org/10.3892/or.2016.4802
MLA
Dai, B., Zhang, P., Zhang, Y., Pan, C., Meng, G., Xiao, X., Wu, Z., Jia, W., Zhang, J., Zhang, L."RNaseH2A is involved in human gliomagenesis through the regulation of cell proliferation and apoptosis". Oncology Reports 36.1 (2016): 173-180.
Chicago
Dai, B., Zhang, P., Zhang, Y., Pan, C., Meng, G., Xiao, X., Wu, Z., Jia, W., Zhang, J., Zhang, L."RNaseH2A is involved in human gliomagenesis through the regulation of cell proliferation and apoptosis". Oncology Reports 36, no. 1 (2016): 173-180. https://doi.org/10.3892/or.2016.4802