Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Oncology Reports
Join Editorial Board Propose a Special Issue
Print ISSN: 1021-335X Online ISSN: 1791-2431
Journal Cover
January-2018 Volume 39 Issue 1

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
January-2018 Volume 39 Issue 1

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Role of mitochondrial function in the invasiveness of human colon cancer cells

  • Authors:
    • Chen-Sung Lin
    • Li-Tzu Liu
    • Liang-Hung Ou
    • Siao-Cian Pan
    • Chia-I Lin
    • Yau-Huei Wei
  • View Affiliations / Copyright

    Affiliations: Faculty of Medicine, National Yang-Ming University, Taipei, Taiwan, R.O.C., Institute of Biochemistry and Molecular Biology, National Yang-Ming University, Taipei, Taiwan, R.O.C., Division of General Surgery, Taipei Hospital, Ministry of Health and Welfare, New Taipei City, Taiwan, R.O.C., Department of Pathology, Taipei Hospital, Ministry of Health and Welfare, New Taipei City, Taiwan, R.O.C.
  • Pages: 316-330
    |
    Published online on: November 9, 2017
       https://doi.org/10.3892/or.2017.6087
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

We investigated the role of mitochondrial function in the invasiveness of human colorectal cancer (CRC) cell lines, using paired primary SW480 and metastatic SW620 cells, and appraised the clinical relevance of the alteration of mtDNA copy number in 33 pairs of CRC specimens after surgical resection. Suppression of mitochondrial function was achieved by the exposure of cells to oligomycin A (OA) or by knockdown of mitochondrial transcriptional factor A (TFAM) to evaluate their effects on energy metabolism, reactive oxygen species, protein expression levels of epithelial-mesenchymal transition (EMT) markers and invasive activity of CRC cells. We found that SW620 cells expressed higher levels of TFAM and mitochondrial DNA (mtDNA)-encoded NADH dehydrogenase subunit 6 (ND6) and cytochrome c oxidase subunit II (COX-II) and nuclear DNA-encoded NADH ubiquinone oxidoreductase subunit A9 (NDUFA9), iron-sulfur protein subunit B of succinate dehydrogenase (SDHB), ubiquinol‑cytochrome c reductase core protein I/II (UQCRC1/2) and cytochrome c oxidase subunit IV (COX-IV) when compared with the SW480 cells. The mtDNA copy number, ADP-triggered oxygen consumption rate (OCR) and respiratory control ratio (RCR) of succinate-supported respiration in the SW620 cells were higher than those noted in the SW480 cells. The intracellular levels of H2O2 and O2-• in the SW620 cells were lower than levels noted in the SW480 cells. Moreover, SW620 cells displayed lower protein levels of hexokinase II (HK-II), glucose 6-phosphate isomerase (GPI) and lactate dehydrogenase (LDH), and lower lactate production rate, and expressed higher levels of EMT markers N-cadherin, vimentin and Snail, and showed higher Transwell migration and invasion activities as compared with the SW480 cells. After OA treatment, SW620 cells exhibited a decrease in OCR and RCR of succinate-supported respiration, an increase in lactate production rate and intracellular levels of H2O2 and O2-•. Moreover, the level of vimentin and Transwell migration activity of the SW620 cells were decreased. After TFAM knockdown, the protein levels of TFAM, ND6 and COX-II, and mtDNA copy number, OCR and RCR of succinate-supported respiration in the SW620-KD#4 and SW620-KD#5 cells were all lower than those noted in the SW620‑Control cells. By contrast, the protein level of HK-II, lactate production rate, the intracellular levels of H2O2 and O2-• in the SW620-KD#4 and SW620-KD#5 cells were all higher than those noted in the SW620-Control cells. Subsequently, both SW620-KD#4 and SW620-KD#5 cells had lower Transwell invasion activity than did the SW620-Control cells. Furthermore, we found that deeper invasion (P=0.025) and longer tumor length (P=0.069) were associated with higher mtDNA copy ratios in the 33 pairs of CRC specimens obtained from surgical resection. Taken together, we conclude that higher mtDNA copy number and mitochondrial function may confer an invasive advantage to CRCs.

Introduction

Colorectal cancer (CRC) is one of the leading causes of cancer-related deaths in Taiwan and worldwide (Health Promotion Administration, the Ministry of Health and Welfare, Taiwan: http://www.hpa.gov.tw/English/Index.aspx; Center for Disease Control and Prevention, USA: http://www.cdc.gov/cancer/colorectal/). Due to the invasive property, CRC may cause direct tissue invasion, regional lymph node involvement or distant organ metastasis, which culminates in incurable or life-threatening disease (1). With regard to the regulation of CRC invasiveness, most studies have focused on oncogenes or tumor-suppressor genes. However, the role of mitochondria in CRC remains unclear (2,3).

In the early 20th century, Dr Warburg described that human cancers display an avid glucose uptake with profound lactate production even under a sufficient oxygen supply (4). He proposed that respiratory enzymes are impaired or suppressed in human cancers. Such a phenomenon was termed the Warburg effect, and the enhanced glycolysis was supposed to compensate for the ‘defective or suppressed mitochondria’ to produce a sufficient amount of ATP (5,6).

Mitochondria are the major organelles responsible for ATP production through the Krebs cycle and electron transport chain (ETC) that consists of respiratory enzyme complexes I, II, III, IV and V (7). Mitochondria have their own mtDNA copies packed in the nucleoid. In contrast to one set of nuclear DNA (nDNA) in the nucleus, there are several nucleoids distributed in the cytoplasmic mitochondria. The nucleoid is an efficient and constitutional unit of the mitochondrial network (8,9). Except that 4 polypeptides of complex II are all encoded by nDNA, ~90 polypeptides constituting the respiratory enzyme complexes I, III, IV and V are encoded by the nDNA and mtDNA cooperatively (10). As a result, delicate regulation of mtDNA plays a pivotal role in the maintenance of mitochondrial biogenesis. Mitochondrial biogenesis or mitochondrial function is correlated positively with the amount of mtDNA, and a higher mtDNA copy number indicates higher mitochondrial function (11). Several DNA-binding proteins are involved in the replication or transcription of mtDNA, and the mitochondrial transcriptional factor A (TFAM) is the unique one that regulates mtDNA replication and transcription in the nucleoid (12,13).

During the past 20 years, alterations in mtDNA and mitochondrial function have been evaluated in many human cancers (2,14,15). Various studies have demonstrated an increase in mitochondrial function or mtDNA copy number during carcinogenesis or progression of human cancers, including skin (16,17), head and neck (18), breast (19,20) and esophageal cancer (21,22). On the contrary, other studies have shown suppressed or impaired mitochondrial function with amplified glycolysis or a decrease in mtDNA copy number during carcinogenesis or progression of cancers (23), which include lung (24,25), renal (26,27), gastric (28) and hepatic cancer (29,30). Since TFAM plays a key role in the regulation of mitochondrial biogenesis, its involvement in human cancers has been appraised in endometrial, prostate and bladder cancer (31–33). By means of TFAM knockdown to suppress mitochondrial function, we demonstrated a decrease in the invasive activity in an esophageal squamous cell carcinoma cell line, but an increase in invasive activity in a renal cell carcinoma cell line (22,27). In light of these findings, the role of mitochondria in human cancers deserves further study.

Likewise, the role of mitochondrial function in human CRCs has remained speculative and an appraisal of the role of mitochondrial function in human CRCs is clinically relevant. In the present study, we investigated the effects of the suppression of mitochondrial function, either induced by oligomycin A (OA) treatment or by TFAM knockdown, on the invasiveness of CRC cell lines (34). The alterations in mtDNA copy number, metabolic profiles, intracellular ROS levels and expression of EMT markers were also examined. However, we analyzed the mtDNA copy numbers in 33 pairs of specimens from CRC patients. We believe that the findings of the present study may help us to better understand the pathophysiology of human CRC from the viewpoint of mitochondrial biology.

Materials and methods

CRC cell lines, cell viability and caspase 3 activity

Paired CRC cell lines, the primary SW480 (Amerian Type Culture Collection, ATCC, Manassas, VA, USA; CCL-228) and metastatic SW620 (ATCC, CCL-227), were used in the present study. They were established from the same CRC patient at different disease stages, i.e., SW480 from the primary adenocarcinoma at age of 50, Dukes' type B; and SW620 from the metastatic lymph node at age of 51 during recurrence, Dukes' type C (34,35). According to the gene analysis, their alterations were mainly those involved in the regulation of transcription, cell cycle control and division, cell signaling and cell adhesion as well as cell metabolism (36). As a result, they are suitable for evaluation of the role of mitochondrial function in CRC invasion.

The culture medium was composed of Roswell Park Memorial Institute-1640 (RPMI-1640) with 10% fetal bovine serum (FBS), 2 g/l NaHCO3 and antibiotics including 100 U/ml penicillin G, 100 µg/ml streptomycin sulfate and 0.25 µg/ml amphotericin B (37).

OA, an inhibitor of respiratory enzyme complex V, was purchased from Merck Inc. (Darmstadt, Germany) to suppress mitochondrial function in the present study. The optimal concentration and duration of OA treatment (10 and 20 µg/ml for 24 or 48 h) were titrated and modified according to the assays for cell viability and caspase 3 activity as previously reported (38–40).

A total of 5,000 SW620 cells suspended in 100 µl of growth medium were seeded on a 96-well plastic reader plate (Corning Glass Works, Corning, NY, USA) for 24 h to achieve the steady state. The culture medium was then changed to new ones with and without addition of OA (10 and 20 µg/ml) for 24 and 48 h, respectively. After incubation for 24 or 48 h at 37°C, an additional 200 µl of 1X AlamarBlue™ reagent (Invitrogen) was added to the cells and further incubated for 1.5 h. The fluorescence intensity was measured by the Victor2™ 1420 Multilabel Counter (Perkin-Elmer Life Sciences, Waltham, MA, USA) on a reader plate set at the excitation wavelength of 538 nm and emission wavelength of 590 nm (22). The cell viability was calculated by the ratio between the fluorescence intensity of cells treated with OA to those without OA. Each experiment was repeated using 3 batches of culture cells (n=3). The data are presented as mean ± SD.

Caspase 3 activity was assayed by the EnzChek Caspase-3 Assay kit #2 (Molecular Probes, Eugene, OR, USA) (41). An aliquot of 50 µl cellular protein lysate or lysis buffer (as blank control) was mixed with 50 µl of substrate working buffer (20 mM PIPES, 4 mM EDTA, 0.2% CHAPS, 10 mM dithiothreitol and 50 µM Z-DEVD-R110 substrate, pH 7.4) at room temperature for 30 min. Due to the recognition of the specific amino acid sequence Asp-Glu-Val-Asp (DEVD) by caspase 3, the linkage between DEVD and fluorescent Rhodamine 110 (R110) was broken to emit fluorescence. The excitation wavelength was set at 485 nm, and the intensity of the emitted fluorescence at 510 nm was recorded by the Victor2™ 1420 Multilabel Counter on a reader plate. In this experiment, 100 nM staurosporinex (STS) was added to the cells and incubated for 6 h prior to protein purification to induce apoptosis as the positive control. The fluorescence intensity was normalized by the protein concentration in each group to assess the relative caspase 3 activity. The relative caspase 3 activity of SW620 cell without treatment with OA was defined as 100%. Each experiment was repeated using 3 batches of culture cells (n=3). Data are presented as mean ± SD.

Transfection for TFAM knockdown

Two small hairpin RNA (shRNA) oligonucleotides, constructed into pLKO.1 DNA backbone, respectively, were supplied by the National RNAi Core Facility of Academia Sinica in Taiwan (http://rnai.genmed.sinica.edu.tw/index.asp). They were named as vector-#4 and -#5, and were used to knock down TFAM expression (22,27). The oligonucleotide sequences against TFAM mRNA of vector-#4 and -#5 were: 5′-CGTTTATGTAGCTGAAAGATT-3′ and 5′-GCAGATTTAAAGAACAGCTAA-3′, respectively; the oligonucleotide 5′-CAAATCACAGAATCGTCGTAT-3′, specific to the gene coding for luciferase (Luc), was constructed as the control vector. With the facilitation of Lipofectamine 2000, 4 µg of vector DNA was transfected into the SW620 cells (106 cells in a 6-well plate) (42). The culture medium containing 1 µg/ml puromycin (lethal dose for SW620) was used for clone selection. The SW620 cells harboring the control vector, knockdown vector-#4 and -#5 were named SW620-Control, SW620-KD#4 and SW620-KD#5, respectively.

Oxygen consumption rate and respiratory control ratio

The cellular oxygen consumption rate (OCR, nmol/min/106 cells) was measured by a 782 Oxygen Meter (Strathkelvin Instruments, Scotland, UK) at 37°C under a circulating water system (22,43). During the steady state (106 cells in the assay mixture), digitonin was added at a final concentration of 0.0006% to pierce the plasma membrane and enable direct exposure of the respiratory enzyme complexes to the substrates and inhibitors. Succinate and ADP were added sequentially to final concentrations of 10 and 1 mM, to measure the OCR-Succinate and OCR-ADP values, respectively. The respiratory control ratio (RCR) was defined and calculated as the ratio between OCR-ADP to OCR-Succinate to assess the integrity of the structure and function of mitochondria (44,45). Each experiment was repeated using three batches of cultured cells (n=3).

Total intracellular ATP content

The intracellular ATP content (fmol/cell) was measured using the ATP Bioluminescent Somatic Cell Assay kit (Sigma-Aldrich) (22). Under steady state, cells were trypsinized, re-suspended and mixed with Somatic Cell Releasing Reagent, and then transferred to a black OptiPlate-96F 96-well reader plate (Packard Biosciences, Perkin-Elmer) containing the ATP assay mixture. The luminescence intensity was measured using the Victor2™ 1420 Multilabel Counter and was normalized by the cell number. Each experiment was repeated using three batches of cultured cells (n=3).

Lactate production rate

Under steady state, cells were washed with phosphate-buffered saline (PBS) and added to fresh growth medium in an incubator at 37°C for 4 h. An aliquot of 10 µl medium was then transferred to a 96-well plate and mixed with the Lactate Reagent (Trinity Biotech Plc., Bray, Ireland). The absorbance at 540 nm was measured on an ELISA reader (BioTek PowerWaveX 340; Boston Laboratory Equipment, Boston, MA, USA) and was normalized by the cell number to calculate the lactate production rate (ng/h/104 cells) (22,43). Each experiment was repeated using three batches of cultured cells (n=3).

Transwell migration and invasion assays

Transwell migration or invasion activity was assayed using Millicell hanging cell culture inserts harboring 8-µm pores (Millipore, Bedford, MA, USA) coated with or without Matrigel placed into a 24-well plate (22,27). Growth medium (400 µl) containing RPMI-1640 plus 10% FBS was added to the 24-well plate, and 5×104 cells suspended in 150 µl of growth medium containing RPMI-1640 plus 1% FBS were seeded in the insert. After incubation for 24 h, cells were removed from the upper surface of the membranes of the insert with a cotton swab. Cells that migrated or invaded to the lower surface were fixed with methanol for 20 min and stained with Hoechst 33342 (1 µg/ml; Sigma-Aldrich). Three random areas under a light microscope (magnification, ×40) were selected to count the migrated/invaded cells and to obtain the average cell number (cells/field) (22,27). Each experiment was repeated using three batches of cultured cells (n=3).

Intracellular ROS levels

The intracellular level of H2O2 was determined as previously described (46). Approximately 3×106 cells were seeded in a 6-cm dish, and 2 ml of medium containing 2′-7′-dichlorofluorescin diacetate (DCFH-DA; 40 µM) was added and incubated at 37°C for 20 min. After trypsinization, cells were subjected to analysis on a flow cytometer (Model EPICS XL-MCL, Beckman-Coulter, Miami, FL, USA). The excitation wavelength was set at 488 nm, and the intensity of emitted fluorescence of 10,000 cells at 525 nm was recorded. The data were analyzed by EXPO32 software (Beckman-Coulter). Each experiment was repeated using three batches of cultured cells (n=3).

The intracellular levels of O2-• were also determined as previously described (46). Approximately 3×106 cells were seeded in a 6-cm dish, and 2 ml of medium containing hydroethidine (HE; 5 µM) was added and incubated at 37°C for 20 min. After trypsinization, cells were subjected to analysis on a flow cytometer (Model EPICS XL-MCL). The excitation wavelength was set at 488 nm and the intensity of emitted fluorescence of 10,000 cells at 580 nm was recorded. The data were analyzed using EXPO32 software. Each experiment was repeated using three batches of cultured cells (n=3).

Preparation of cellular DNA, RNA and proteins

Extraction of cellular DNA and RNA and its reverse-transcription to cDNA as well as protein purification were performed as previously described (27,47,48).

Collection of clinical samples and DNA extraction

A total of 33 CRC patients who had received surgical resection at Taipei Hospital, Ministry of Health and Welfare (New Taipei City, Taiwan) were retrospectively collected and their pathological slides were reviewed by an experienced pathologist. Representative tumor foci without tumor necrosis and without lymphocyte infiltration were identified, and thin slices ~5-µm in thickness from paraffin-embedded tissue blocks were prepared for DNA extraction. Simultaneously, the paired non-cancerous regions were also collected as control. After de-waxing and re-hydration processes, tissue samples were mixed with 500 µl of the DNA extraction solution (QuickExtract; Epicenter, Madison, WI, USA) to extract total cellular DNA at 65°C for 3 h as previously described (20,21). The DNA samples were kept at −20°C until use.

Determination of relative mtDNA copy number and mRNA expression levels

Quantitative polymerase chain reaction (qPCR) using SYBR-Green I (Roche Applied Science, Penzberg, Germany) was employed to determine the threshold cycle (Ct) for the calculation of relative mtDNA copy number and relative mRNA expression levels of specific genes by the 2−ΔΔCt method (47–49). The mtDNA copy number is defined as the total copies of tRNALeu (UUR) (mtDNA) relative to the total copies of 18S rRNA (nDNA). The mRNA expression level was defined as the total cDNA copies of the gene of interest relative to the total cDNA copies of 18S rRNA.

For analysis of the cellular mtDNA copy number or target gene mRNA expression level in the SW620 and SW480 cells, the value of SW480 was taken as 1.00. Each experiment was repeated using three batches of cultured cells (n=3). For analysis of clinical samples, the 143B cell DNA (1 ng/µl) was loaded as a control in each run of qPCR and the mtDNA copy number of 143B cells was adjusted as 1.00. Furthermore, we defined mtDNA copy ratio as the mtDNA copy number of the tumor part divided by the mtDNA of the non-tumor part for each CRC patient. The oligonucleotide sequences of primers are summarized in Table I (22,27,48).

Table I.

Summary of the analyzed target genes and sequences of the primers used to amplify the indicated genes.

Table I.

Summary of the analyzed target genes and sequences of the primers used to amplify the indicated genes.

Forward primer sequenceReverse primer sequence
DNA
  mtDNAa CACCCAAGAACAGGGTTTGT TGGCCATGGGTATGTTGTTAA
  nDNAb TAGAGGGACAAGTGGCGTTC CGCTGAGCCAGTCAGTGT
Messenger RNA (mRNA)
  Reference gene
    β-actin CCAACCGTGAAAAGATGACC ACCAGAGGCATACAGGGACA
  Target genes
    PGC-1α TGAGAGGGCCAAGCAAAG ATAAATCACACGGCGCTCTT
    TFAM CAACTACCCATATTTAAAGCTCAGAA GAATCAGGAAGTTCCCTCCA
    HK-II CCCTGCCACCAGACTAAACT TGGACTTGAATCCCTTGGTC
    GPI GGAAGGGTCTGCATCACAAG CCTCATCAGGGCCTCTGTC
    PFK AGGAGGGGAAGGGCATCT TTCCTATCAAATGGGGTTGG
    LDH GCAGATTTGGCAGAGAGTATAATG GACATCATCCTTTATTCCGTAAAGAC

a The analyzed region of mtDNA was the tRNALeu (UUR) gene.

b The analyzed region of nDNA was the 18S rRNA gene. mtDNA, mitochondrial DNA; nDNA, nuclear DNA; PGC-1α, peroxisome proliferator-activated receptor γ coactivator 1-α; TFAM, mitochondrial transcriptional factor A; HK-II, hexokinase II; GPI, glucose 6-phosphate isomerase; PFK, phosphofructokinase; LDH, lactate dehydrogenase.

Determination of relative protein expression levels

The relative protein expression levels of the genes of interest were determined using western blotting. An aliquot of 50 µg of total cellular proteins was separated on a 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE), and then blotted onto a piece of BioTrace™ polyvinylidene difluoride (PVDF) membrane (Pall Corporation, Pensacola, FL, USA). Non-specific bindings were blocked with 5% skimmed milk in a Tris-buffered saline Tween-20 (TBST) buffer (50 mM Tris-HCl, 150 mM NaCl and 0.1% Tween-20, pH 7.4). The membrane was subjected to specific primary antibodies against target proteins, as listed in Table II, and was incubated for 16 h at 4°C (22,50). β-actin was used as the internal control. The membrane was then incubated with a horseradish peroxidase (HRP)-conjugated secondary antibody for 1 h at room temperature, the protein band was visualized on X-ray film (Fujifilm, Tokyo, Japan) using enhanced chemiluminescence (ECL) reagents (GE Healthcare, Chalfont, UK). The band density was scanned by a densitometer to calculate the relative protein expression levels. Each experiment was repeated using three batches of cultured cells (n=3).

Table II.

Summary of the primary antibodies and their dilution titers and suppliers used in the present study.

Table II.

Summary of the primary antibodies and their dilution titers and suppliers used in the present study.

Primary antibody TiterSupplier
ND6(Subunit of complex I, mtDNA encoded)1:1,000Molecular Probes, Eugene, OR, USA
NDUFA9(Subunit of complex I, nDNA encoded)1:1,000Molecular Probes, Eugene, OR, USA
SDHA(Subunit of complex II, nDNA encoded)1:1,000Molecular Probes, Eugene, OR, USA
SDHB(Subunit of complex II, nDNA encoded)1:2,000Molecular Probes, Eugene, OR, USA
UQCRC1(Subunit of complex III, nDNA encoded)1:2,000Molecular Probes, Eugene, OR, USA
UQCRC2(Subunit of complex III, nDNA encoded)1:2,000Molecular Probes, Eugene, OR, USA
COX-II(Subunit of complex IV, mtDNA encoded)1:1,000Molecular Probes, Eugene, OR, USA
COX-IV(Subunit of complex IV, nDNA encoded)1:1,000Molecular Probes, Eugene, OR, USA
GPI 1:1,000Santa Cruz Biotechnology, Santa Cruz, CA, USA
LDH 1:5,000Santa Cruz Biotechnology, Santa Cruz, CA, USA
PDH 1:1,000Santa Cruz Biotechnology, Santa Cruz, CA, USA
HK-II 1:1,000Merck Millipore, Darmstadt, Germany
E-cadherin 1:1,000Cell Signaling, Danvers, MA, USA
N-cadherin 1:1,000BD (Becton-Dickinson and Company, Franklin Lakes, NJ, USA)
Vimentin 1:1,000Sigma-Aldrich, St. Louis, MO, USA
Snail 1:1,000Abcam, Cambridge, MA, USA
TFAM 1:1,000Santa Cruz Biotechnology, Santa Cruz, CA, USA
β-actin 1:10,000Merck Millipore, Darmstadt, Germany

[i] ND6, mtDNA-encoded NADH dehydrogenase subunit 6; NDUFA9, NADH ubiquinone oxidoreductase subunit A9; SDHA, succinate dehydrogenase complex flavoprotein subunit A; SDHB, succinate dehydrogenase complex iron-sulfur subunit B; UQCRC1, ubiquinol-cytochrome c reductase core protein I; UQCRC2, ubiquinol-cytochrome c reductase core protein II; COX-II, mtDNA-encoded cytochrome c oxidase subunit II; COX-IV, cytochrome c oxidase subunit IV; GPI, glucose-6-phosphate isomerase; LDH, lactate dehydrogenase; PDH, pyruvate dehydrogenase; HK-II, hexokinase II; TFAM, mitochondrial transcription factor A.

Statistical analysis

The continuous variables between two or among three or more independent groups were analyzed using Student's t-test or Mann-Whitey U test (two groups)/or the one-way analysis of variance (ANOVA) or Kruskal-Wallis H test (three or more groups) when appropriate. Significant difference was considered at a P-value <0.05.

Results

Difference in metabolic profiles, ROS levels and invasive activity between SW480 and SW620 CRC cell lines

The metastatic SW620 cells exhibited a higher percentage of fibroblast-like morphology than did primary SW480 cells under light microscopy (Fig. 1). Regarding the metabolic profiles of mitochondria (Fig. 1 and Table III), SW620 cells had a higher mtDNA copy number (2.05±0.57 vs. 1.00±0.00, P=0.006), higher ADP-stimulated OCR (3.41±0.02 vs. 2.94±0.09, P=0.020) and higher respiratory control ratio (RCR, 1.90±0.03 vs. 1.57±0.06; P=0.018) of succinate-supported respiration rate than did SW480 cells. SW620 cells had higher mRNA and protein expression levels of mitochondrial biogenesis-related proteins including the mRNAs for peroxisome proliferator-activated receptor γ coactivator 1-α (PGC-1α, 6.90±0.71 vs. 1.00±0.00, P=0.007) and TFAM (2.58±0.20 vs. 1.00±0.00, P<0.001) (Table III), and proteins for TFAM (4.01±0.48 vs. 1.00±0.00, P<0.001) and pyruvate dehydrogenase (PDH) (1.56±0.11 vs. 1.00±0.00, P=0.001) (Fig. 1) than did SW480 cells. SW620 cells also expressed higher protein levels of mitochondrial respiratory enzyme complexes including mtDNA-encoded NADH dehydrogenase subunit 6 (ND6, subunit of complex I, 1.63±0.13 vs. 1.00±0.00, P=0.001) and cytochrome c oxidase subunit II (COX-II, subunit of complex IV, 1.75±0.07 vs. 1.00±0.00, P=0.004) (Fig. 1), and nDNA-encoded NADH ubiquinone oxidoreductase subunit A9 (NDUFA9; subunit of complex I, 1.60±0.24 vs. 1.00±0.00, P=0.013), iron-sulfur protein subunit B of succinate dehydrogenase (SDHB, subunit of complex II, 2.55±0.67 vs. 1.00±0.00, P=0.016), ubiquinol-cytochrome c reductase core protein I (UQCRC1, subunit of complex III, 1.66±0.35 vs. 1.00±0.00, P=0.032) and UQCRC2 (subunit of complex III, 2.01±0.44 vs. 1.00±0.00, P=0.084) and cytochrome c oxidase subunit IV (COX-IV, subunit of complex IV, 1.86±0.23 vs. 1.00±0.00, P=0.033) (Fig. 1) when compared with the SW480 cells.

Figure 1.

SW620 cells expressed a higher percentage of fibroblast-like morphology, higher levels of mitochondrial biogenesis-related proteins (ND6, NDUFA9, SDHB, UQCR1/2, COX-II/IV, PDH and TFAM), higher levels of EMT markers (N-cadherin, vimentin and Snail), but lower expression levels of glycolysis-related enzymes (HK-II, GPI and LDH) than SW480 cells. ND6, NADH dehydrogenase subunit 6; NDUFA9, NADH ubiquinone oxidoreductase subunit A9; SDHB, iron-sulfur protein subunit B of succinate dehydrogenase; UQCRC1/2, ubiquinol-cytochrome c reductase core protein I/II; COX-II, cytochrome c oxidase subunit II; COX-IV, cytochrome c oxidase subunit IV; PDH, pyruvate dehydrogenase; TFAM, mitochondrial transcriptional factor A; HK-II, hexokinase II; GPI, glucose 6-phosphate isomerase; LDH, lactate dehydrogenase.

Table III.

Differences in metabolic profiles, ROS intensity and migration/invasion activities between primary SW480 and metastatic SW620 CRC cell lines.

Table III.

Differences in metabolic profiles, ROS intensity and migration/invasion activities between primary SW480 and metastatic SW620 CRC cell lines.

Cell line

Parameters/variablesSW480SW620 P-valuea
mtDNA copy number1.00±0.002.05±0.570.006
Oxygen consumption rate (OCR) (nmol/min/106 cells)
  Respiratory substrate
    Succinate-supported1.87±0.121.80±0.030.508
    ADP-stimulated2.94±0.093.41±0.020.020
    Respiratory control ratio (RCR)1.57±0.061.90±0.030.018
Lactate production rate (ng/h/104 cells)204.7±13.1141.3±8.50.002
Total intracellular ATP (fmol/cell) mRNA expression level4.82±0.184.71±0.120.827
  Mitochondrial biogenesis-related proteins
    PGC-1α1.00±0.006.90±0.710.007
    TFAM1.00±0.002.58±0.20<0.001
  Glycolytic enzymes
    HK-II1.00±0.000.73±0.060.002
    GPI1.00±0.000.74±0.070.003
    PFK1.00±0.000.71±0.03<0.001
    LDH1.00±0.000.49±0.01<0.001
  Relative intracellular ROS level
    Hydrogen peroxide (H2O2)1.00±0.000.57±0.05<0.001
  Transwell assay (cells/field)
    Migration93.1±31.1325.6±66.8<0.001
    Invasion15.8±2.558.6±4.40.006

a Comparison between SW480 and SW620 cells. PGC-1α, peroxisome proliferator-activated receptor γ coactivator 1-α; TFAM, mitochondrial transcriptional factor A; HK-II, hexokinase II; GPI, glucose-6-phosphate isomerase; PFK, phosphofructokinase; LDH, lactate dehydrogenase; ROS, reactive oxygen species.

Regarding the metabolic profile of glycolysis (Fig. 1 and Table III), the SW620 cells showed lower expression levels of glycolytic enzymes, including mRNA levels of hexokinase II (HK-II, 0.73±0.06 vs. 1.00±0.00, P=0.002), glucose 6-phosphate isomerase (GPI; 0.74±0.07 vs. 1.00±0.00, P=0.003), phosphofructokinase (PFK; 0.71±0.03 vs. 1.00±0.00, P<0.001) and lactate dehydrogenase (LDH; 0.49±0.01 vs. 1.00±0.00, P<0.001) (Table III) as well as protein levels of HK-II (0.43±0.10 vs. 1.00±0.00, P=0.001), GPI (0.48±0.06 vs. 1.00±0.00, P<0.001) and LDH (0.64±0.06 vs. 1.00±0.00, P=001) (Fig. 1), and a lower lactate production rate (141.3±8.5 vs. 204.7±13.1, ng/h/104 cells, P=0.002) (Table III) when compared with the SW480 cells.

The total intracellular ATP contents of SW620 and SW480 cells did not differ (4.71±0.12 vs. 4.82±0.18, fmol/cell, P=0.827, Table III). With regard to the relative intracellular ROS levels, SW620 cells had a lower H2O2 level than the level noted in the SW480 cells (0.57±0.05 vs. 1.00±0.00, P=0.006, Table III). The SW620 cells displayed higher Transwell migration (325.6±66.8 vs. 93.1±31.1, cells/field, P<0.001) and invasion (58.6±4.4 vs. 15.8±2.5, cells/field, P=0.006) activities (Table III and Fig. 2), and higher protein expression levels of EMT markers N-cadherin (1.16±0.03 vs. 1.00±0.00, P=0.001), vimentin (4.73±0.42 vs. 1.00±0.00, P<0.001) and Snail (6.08±1.41 vs. 1.00±0.00, P=0.036) (Fig. 1) when compared with these levels noted in the SW480 cells.

Figure 2.

The Transwell migration and invasion activities of the SW620 cells were higher than those of the SW480 cells.

Effects of oligomycin A on cell viability, caspase 3 activity, metabolic profiles, ROS levels and invasion activity of SW620 cells

Regarding cell viability (Fig. 3A), there were no obvious differences between SW620 (as control at 24 and 48 h, 100.0±0.0%) and SW620 cells treated with OA at 10 µg/ml for 24 h (SW620 OA-10 24 h, 95.0±4.1%, P=0.167), between SW620 (100±0.0%) and SW620 cells treated with OA at 10 µg/ml for 48 h (SW620 OA-10 48 h, 90.1±8.2%, P=0.172), and between SW620 (100.0±0.0%) and SW620 cells treated with OA at 20 µg/ml for 24 h (SW620 OA-20 24 h, 80.4±17.4%, P=0.191). However, SW620 cells (100.0±0.0%) had a significantly higher cell viability than did SW620 cells treated with OA at 20 µg/ml for 48 h (SW620 OA-20 48 h, 64.7±5.9%, P=0.009). In light of these findings, we did not perform the comparison for SW620 cells treated with OA at 20 µg/ml for 48 h.

Figure 3.

(A) Cell viability and (B) caspase 3 activity of SW620 and SW620 treated with 10 and 20 µg/ml of oligomycin A (OA) for 24 and 48 h, respectively. SW620 cells treated with 20 µg/ml of OA for 48 h had the lowest cell viability (*P=0.009). SW620 cells treated with STS had significantly higher caspase 3 activity (*P<0.05).

In the analysis of the caspase 3 activity (Fig. 3B), we found no significant difference between SW620 (100.0±0.0%) and SW620 treated with OA at 10 µg/ml for 24 h (SW620 OA-10 24 h, 121.7±7.5%, P=0.152), between SW620 (100.0±0.0%) and SW620 treated with OA at 10 µg/ml for 48 h (SW620 OA-10 48 h, 131.0±6.2%, P=0.089) and between SW620 (100.0±0.0%) and SW620 cells treated with OA at 20 µg/ml for 24 h (SW620 OA-20 24 h, 109.4±8.6%, P=0.362). However, these values were all much lower than those of SW620 cells treated with STS (343.7±12.5%, P<0.05).

As shown in Table IV, from SW620 to SW620 cells treated with OA at 5 and 10 µg/ml for 24 h, there were progressive decreases in ADP-stimulated OCR (3.41±0.02 vs. 1.20±0.14 vs. 1.09±0.18, P=0.047) and RCR (1.85±0.09 vs. 1.18±0.13 vs. 1.05±0.02, P=0.017) of succinate-supported respiration and Transwell invasion activity of SW620 cells (84.6±6.9 vs. 43.9±5.8 vs. 30.5±3.5, P=0.017).

Table IV.

Alterations of ADP-stimulated OCR and RCR of succinate-supported respiration and Transwell invasion activity in SW620 cells after treatment of cells with oligomycin A.

Table IV.

Alterations of ADP-stimulated OCR and RCR of succinate-supported respiration and Transwell invasion activity in SW620 cells after treatment of cells with oligomycin A.

SW620SW620

Oligomycin A (µg/ml)
510

Duration (h)
Parameters/variables 2424 P-valuea
Oxygen consumption rate (OCR) (nmol/min/106 cells)
  Respiratory substrate
    Succinate-supported1.85±0.111.02±0.011.04±0.150.112
    ADP-stimulated3.41±0.021.20±0.141.09±0.180.047
    Respiratory control ratio (RCR)1.85±0.091.18±0.131.05±0.020.017
Transwell assay (cells/field)
Invasion84.6±6.943.9±5.830.5±3.50.017

a Comparison among SW620, SW620 cells after treatment with 5 µg/ml olygomycin A for 24 h and after treatment of SW620 cells with 10 µg/ml olygomycin A for 24 h.

From SW620 to SW620 cells treated with OA at 10 µg/ml for 24 h and further treatment of SW620 with OA at 10 µg/ml for 48 h, we found progressive increases in the lactate production rate (140.6±6.4 vs. 179.5±22.2 vs. 212.1±1.6, P=0.017), and intracellular levels of H2O2 (0.59±0.01 vs. 0.77±0.03 vs. 0.81±0.07, P=0.047) and O2-• (0.68±0.01 vs. 0.85±0.02 vs. 0.88±0.03, P=0.026) (Table V). No significant differences in the lactate production rate (206.5±15.8 vs. 212.1±1.6, P=1.000), the intracellular levels of H2O2 (1.00±0.00 vs. 0.81±0.07, P=0.333) and O2-• (1.00±0.00 vs. 0.88±0.03, P=0.333) were found between SW480 and SW620 cells after treatment with OA at 10 µg/ml for 48 h (Table V).

Table V.

Alterations of lactate production rate, relative intracellular ROS intensity and Transwell migration activity in SW620 cells after the treatment of oligomycin A.

Table V.

Alterations of lactate production rate, relative intracellular ROS intensity and Transwell migration activity in SW620 cells after the treatment of oligomycin A.

Cell lines

SW480S620SW620

Oligomycin A (µg/ml)
101020

Duration (h)
Parameters/variables 244824 P-valuea P-valueb P-valuec P-valued
Lactate production rate (ng/h/104 cells)206.5±15.8140.6±6.4179.5±22.2212.1±1.6195.8±12.00.0171.0000.0470.667
Relative intracellular ROS level
Hydrogen peroxide (H2O2)1.00±0.000.59±0.010.77±0.030.81±0.070.76±0.080.0470.3330.1120.333
Suproxide (O2-•)1.00±0.000.68±0.010.85±0.020.88±0.031.05±0.010.0260.3330.0170.333

a Comparison between SW620 and SW620 cells treated with 10 µg/ml oligomycin A for 24 h and SW620 cells treated with 10 µg/ml oligomycin A for 48 h.

b Comparison between SW480 and SW620 cells treated with 10 µg/ml oligomycin A for 48 h.

c Compared between SW620 and SW620 cells treated with 10 µg/ml oligomycin A for 24 h and SW620 cells treated with 20 µg/ml oligomycin A for 24 h.

d Comparison between SW480 and SW620 cells treated with 20 µg/ml oligomycin A for 24 h. ROS, reactive oxygen species.

From SW620 to SW620 cells treated with OA at 10 and 20 µg/ml for 24 h, progressive increases in the lactate production rate (140.6±6.4 vs. 179.5±22.2 vs. 195.8±12.0, P=0.047) and intracellular level of the O2-• (0.68±0.01 vs. 0.85±0.02 vs. 1.05±0.01, P=0.017) were noted (Table V). There were no significant differences in the lactate production rate (206.5±15.8 vs. 195.8±12.0, P=0.667), and intracellular level of O2-• (1.00±0.00 vs. 1.05±0.01, P=0.333) between SW480 and SW620 cells treated with OA at 20 µg/ml for 24 h (Table V).

After treatment of SW480 and SW620 cells with OA at 10 and 20 µg/ml for 24 h, respectively, we found no obvious changes in the protein expression levels of glycolytic enzymes including HK-II and LDH. However, the protein expression level of vimentin was decreased in SW620 cells, but unchanged in SW480 cells (Fig. 4).

Figure 4.

Protein expression levels of glycolytic enzymes HK-II and LDH were stable while EMT marker vimentin was progressively decreased in SW620 cells after treatment for 24 h with oligomycin A (OA) at 10 and 20 µg/ml, respectively. However, no significant changes were noted in SW480 cells treated with OA. HK-II, hexokinase II; LDH, lactate dehydrogenase.

Alterations in metabolic profiles, ROS levels and invasion activity after knockdown of TFAM in SW620 cells

Between the parental SW620 and the SW620-Control cells, there were no obvious differences in the protein expression levels of TFAM, Snail, N-cadherin and vimentin (Fig. 5), in mRNA expression levels of TFAM (2.88±0.05 vs. 2.81±0.02, P=0.122) and mtDNA copy numbers (2.27±0.13 vs. 2.21±0.13, P=0.669) (Table VI). The consequences of TFAM knockdown were evaluated and compared between the SW620-Control and SW620-KD#4 as well as between the SW620-Control and SW620-KD#5 cells, respectively. Compared to the SW620-Control, both SW620-KD#4 and SW620-KD#5 cells had lower protein levels of TFAM, Snail, N-cadherin and vimentin (Fig. 5), a lower mRNA level of TFAM (1.81±0.03 vs. 2.81±0.02, P<0.001; 1.62±0.04 vs. 2.81±0.02, P<0.001) and lower mtDNA copy number (1.40±0.18 vs. 2.21±0.13, P=0.036; 1.00±0.10 vs. 2.21±0.13, P=0.009) (Table VI). Both SW620-KD#4 and SW620-KD#5 cells had lower protein expression levels of mtDNA-encoded ND6 and COX-II, but similar nDNA-encoded SDHA (Fig. 6), and lower ADP-stimulated OCR (3.78±0.13 vs. 5.61±0.01, P=0.002; 3.50±0.14 vs. 5.61±0.01, P=0.002) and RCR (2.02±0.05 vs. 2.67±0.11, P=0.015; 1.96±0.04 vs. 2.67±0.11, P=0.012) values of succinate-supported respiration than did the SW620-Control cells (Table VI). In contrast, both SW620-KD#4 and SW620-KD#5 cells had higher protein level of HK-II (Fig. 6) and higher lactate production rate (130.4±6.1 vs. 103.1±2.7, P=0.002; 159.4±4.9 vs. 103.1±2.7, P<0.001) (Table VI) than did the SW620-Control cells. Both SW620-KD#4 and SW620-KD#5 cells had higher intracellular levels of O2-• (1.65±0.01 vs. 1.00±0.00, P=0.010; 1.67±0.02 vs. 1.00±0.00, P<0.001) and H2O2 (1.57±0.10 vs. 1.00±0.00, P=0.036; 1.73±0.10 vs. 1.00±0.00, P=0.024), but had lower Transwell invasion activity (94.0±6.2 vs. 209.9±33.6, P=0.041; 80.7±4.8 vs. 209.9±33.6, P=0.024) when compared with the SW620-Control (Table VI). However, the protein expression levels of GPI and LDH in the SW620-KD#4 and SW620-KD#5 cells were not significantly different from those of the SW620-Control cells (Fig. 6).

Figure 5.

Decrease in the protein expression levels of TFAM and EMT markers Snail, N-cadherin and vimentin after knockdown of TFAM in SW620 cells. TFAM, mitochondrial transcriptional factor A.

Figure 6.

A decrease in the expression levels of mtDNA-encoded proteins ND6 and COX-II without a change in nDNA-encoded SDHA, no change in glycolysis-related enzymes LDH and GPI but an increase in HK-II were noted in the SW620 cells following knockdown of TFAM. ND6, mtDNA-encoded NADH dehydrogenase subunit 6; COX-II, mtDNA-encoded, cytochrome c oxidase subunit II; SDHA, nDNA-encoded, SDHA, succinate dehydrogenase complex flavoprotein subunit A; HK-II, hexokinase II; GPI, glucose 6-phosphate isomerase; LDH, lactate dehydrogenase.

Table VI.

Alterations in metabolic profiles, ROS intensity and invasive activity after the knockdown of TFAM in metastatic SW620 cell line.

Table VI.

Alterations in metabolic profiles, ROS intensity and invasive activity after the knockdown of TFAM in metastatic SW620 cell line.

Cell line

Parameters/variablesSW480SW620SW620-ControlSW620-KD#4SW620-KD#5 P-valuea P-valueb P-valuec
TFAM mRNA1.00±0.002.88±0.052.81±0.021.81±0.031.62±0.040.122<0.001<0.001
mtDNA copy number1.00±0.002.27±0.132.21±0.131.40±0.181.00±0.100.6690.0360.009
Oxygen consumption rate (OCR)d
  Respiratory substrate
    Succinate-supported 2.11±0.081.88±0.021.79±0.11 0.1300.085
    ADP-stimulated 5.61±0.013.78±0.133.50±0.14 0.0020.002
    Respiratory control ratio (RCR) 2.67±0.112.02±0.051.96±0.04 0.0150.012
Lactate production rate (ng/h/104 cells) 103.1±2.7130.4±6.1159.4±4.9 0.002<0.001
Relative intracellular ROS level
  Superoxide (O2-•) 1.00±0.001.65±0.011.67±0.02 0.010<0.001
  Hydrogen peroxide (H2O2) 1.00±0.001.57±0.101.73±0.10 0.0360.024
Transwell assay (cells/field)
  Invasion 209.9±33.694.0±6.253.9±7.8 0.0410.024

a Comparison between SW620 and SW620-Control cells.

b Comparison between SW620-Control and SW620-KD#4 cells.

c Comparison between SW620-Control and SW620-KD#5 cells.

d nmol/min/106 cells. ROS, reactive oxygen species; TFAM, mitochondrial transcriptional factor A.

Clinical parameters and mtDNA copy ratio

The relationships between the clinical parameters and the mtDNA copy ratios in the tumor tissues of CRC patients are presented in Table VII. We found that deeper tumor invasion beyond the submucosa layer (T2/T3/T4 vs. T1; 1.22±0.83 vs. 0.64±0.32, P=0.025) and longer tumor length (>2 vs. ≤2 cm; 1.25±0.89 vs. 0.84±0.34, P=0.069) were associated with a higher mtDNA copy ratio in the tumor tissues of the CRC patients examined.

Table VII.

Relationships between the clinical parameters and the alteration of mtDNA copy ratios in CRC patients.

Table VII.

Relationships between the clinical parameters and the alteration of mtDNA copy ratios in CRC patients.

ParametersmtDNA copy ratioP-value
Age (years) 0.462
  >65 (n=11)1.30±1.27
  ≤65 (n=22)1.07±0.44
Sex 0.510
  Male (n=22)1.01±0.49
  Female (n=11)1.42±1.20
Pathological findings
  T-status 0.025
    T1 (n=4)0.64±0.32
    T2/T3/T4 (n=29)1.22±0.83
  N status 0.260
    N(−) (n=16)1.00±0.56
    N(+) (n=17)1.29±0.97
  M status 0.900
    M0 (n=32)1.15±0.82
    M1 (n=1)1.05±0.00
  Tumor length (cm) 0.069
    ≤2 (n=8)0.84±0.34
    >2 (n=25)1.25±0.89

[i] mtDNA copy ratio was determined as mtDNA copy number of the tumor part/mtDNA copy number of paired non-tumor part. CRC, colorectal cancer.

Discussion

Phenotypically, SW620 cells were found to have a higher Transwell migration activity than do SW480 cells. Biologically, SW620 cells exhibited higher expression of mitochondrial biogenesis-related proteins, higher OCR and higher expression of EMT markers, but lower ROS production, lower glycolytic enzyme and lower lactate production rate than SW480 cells (Table III and Fig. 1). Furthermore, decreases in Transwell migration activity and protein expression of EMT markers were observed in the SW620 cells presenting with suppressed mitochondrial function induced by OA treatment or TFAM knockdown (Figs. 4 and 5; Tables IV and VI). Clinicopathologically, the colorectal cancer (CRC) tumors that invaded beyond the submucosa layer or that had a longer tumor length, had higher mtDNA copy ratios (Table VII). These findings substantiate the notion that suppressed mitochondrial function or low mtDNA copy number may contribute to a decrease in the invasion activity of CRC cells. However, these findings are different from the well-known Warburg effect. Thus, further studies are warranted using more tumor specimens of CRC patients at different clinical stages, different CRC cell lines, or using other agents to suppress mitochondrial function in the near future.

Impairment or suppression of mitochondria in human cancers was first described by Dr Warburg based on his finding of enhanced glycolysis in cancer tissue even when the oxygen supply is sufficient (4,6). As a result, some cancer researchers claimed that mitochondrial dysfunction may be involved in the carcinogenesis and progression of cancers (51–54). However, there are conflicting results. During the past two decades, alteration of mitochondrial biogenesis has been evaluated and discussed in many human cancers (15,23,55,56). A decrease in mtDNA copy number, an increase in oxidative mtDNA damage or decreases in the activities of respiratory enzyme complexes have been observed in human lung, gastric and breast cancer, renal cell carcinoma and esophageal cancer (26,28,57,58). On the contrary, increases in mtDNA copy number or mitochondrial function were found in esophageal cancer or head and neck cancer during carcinogenesis or progression of cancers (18,21,22,59). With regard to the mitochondrial alterations in human CRC, some reseachers have demonstrated an increase in mtDNA copy number or increased expression of mtDNA-encoded ND2 (60–63). In contrast, some showed a decrease in mtDNA copy number, a decrease in mitochondrial function or the presence of mDNA mutation (64–66). Whether mitochondrial biogenesis is suppressed, amplified or dysfunctional in human cancers, including CRC, has remained a puzzle.

Recently, the concept of glucose metabolic switch (the Warburg effect) has been associated with metabolic reprogramming in cancer mitochondria. In other words, the consideration of maximal bioenergetic demand has been shifted to the regulation of both biosynthetic and energetic demands (67–69). For a given cancer cell, it needs an ATP supply, but also carbohydrate, lipid and protein synthesis to support cancer growth. After glucose uptake and glycolysis, PDH may convert pyruvate to acetyl-CoA to enter the Krebs cycle in the mitochondria. The Krebs cycle can offer high energy intermediates, NADH or FADH2, for subsequent electron transport and ATP production and can offer citrate, which can be exported from the mitochondria to the cytosol, to re-form acetyl-CoA for lipid synthesis in the cytosol. PDH plays an important role in metabolic reprogramming of human cancer. Intriguingly, Koukourakis et al demonstrated that when lung tissues of cancer patients exhibited decreased PDH expression (suggesting the shutdown of oxidative metabolism or metabolic reprogramming) and decreased LDH5 expression (suggesting a shutdown of Warburg effect and glucose metabolic switch), they had the best prognosis (70). This explains why SW620 cells harboring higher protein levels of PDH and TFAM expression, indicating a higher biosynthetic and energetic activity, had a higher Transwell migration activity than did the SW480 cells (Figs. 1 and 2). Indeed, several studies have suggested that most cancer mitochondria are not impaired in executing oxidative phosphorylation. Nevertheless, they are reprogrammed to meet the need of biosynthesis of macromolecules and growth of human cancer (67–73). Furthermore, the associations among EMT, stemness properties and mitochondrial metabolic reprogramming have received great attention of cancer research scientists (74–76). Mitochondria have remained the main powerhouse of human cancers, and high mitochondrial function may confer high invasive property in human cancer cells, as demonstrated in the present study and our previous observations in esophageal cancer cell lines (22,73).

Whether mitochondrial function does affect the invasion activity of CRC cells, suppression of mitochondrial function of SW620 cells could confer SW620 cells a phenotype with lower invasion activity. After treatments of cancer cells with 5, 10 and 20 µg/ml of OA, we demonstrated that the OA-treated SW620 cells exhibited decreased Transwell migration activity and decreased vimentin expression, increased ROS production and increased lactate fermentation which mimicked SW480 cells (Fig. 4; Tables IV and V). OA is commonly used to suppress mitochondrial production of ATP. Different concentrations of OA have been used, including 0.5 µg/ml for HepG2 cells (77), 2.5, 5, 10 and 25 µg/ml for human chondrocytes (40), 10 µg/ml for adipose tissue cells (38), and 15 µg/ml for SKBR3 and 4T1 breast cancer cells (39). The concentrations of 5, 10 and 20 µg/ml of OA were thus used in the present study.

Such a high OA concentrations in the present study did confer SW620 cells the ability to exhibit some characteristics similar to SW480 cells (Tables IV and V), but did not cause an obvious decrease in cell viability or increase in caspase 3 activity in the SW620 cells (Fig. 3A and B). However, it seemed to markedly suppress the mitochondrial function in SW620 cells (Table IV). This indicates a near-complete suppression of mitochondrial function of SW620 cells, which is not applicable in a physiological condition. As a result, we further conducted the knockdown of TFAM in SW620 cells to test our hypothesis. The TFAM-knockdown SW620 cells did display lower RCR, but not as low as the results following OA treatment (Tables IV and VI). The TFAM-knockdown SW620 cells expressed lower levels of mtDNA-encoded polypeptides (ND6 and COX-II, Fig. 6), but increased intracellular ROS production and a lactate production rate (Table VI) and HK-II protein expression (Fig. 6). Subsequently, the TFAM-knockdown SW620 cells expressed lower protein levels of EMT markers including Snail, N-cadherin and vimentin (Fig. 5) and lower Transwell invasion activity (Table VI). It is worth mentioning that SW620-KD#4 and SW620-KD#5 cells did express lower mtDNA-encoded ND6 and COX-II without obvious alteration in nDNA-encoded SDHA (Fig. 6), which have convinced us that these are caused by the selective effect of TFMA knockdown rather than off-target effects. However, some differences existed between the SW620-Control and the parental SW620 cells, including RCR and Transwell invasion activity. The possible effects of scramble Luc-vector, the facilitation of Lipofectamine 2000, and the addition of puromycin for clone selection may account for these differences. On the contrary, we tried to further evaluate the effects of overexpression of TFAM on the OCR, ROS, EMT markers, and invasion of SW480 and SW620 cells to test our hypothesis. We found that SW480 with TFAM overexpression did show increased expression of COX-II, Snail and vimentin (data not shown). The preliminary data indicated that mitochondrial function may serve an important role in the invasiveness of human CRC cells. More investigations, either in vitro or ex vivo studies, are needed in the near future to generate a clear picture of mitochondrial function in the invasion and progression of human cancers.

The novel role of TFAM in human colon cancer has been a hot research topic. Studies have shown that p53 increases mtDNA copy number via upregulation of TFAM, and a high level of TFAM expression was found to be associated with a poor prognosis in CRC patients (60,78,79). Some investigators further claimed that TFAM may be involved in the carcinogenesis of CRCs. TFAM and mitochondrial function in human CRCs deserve further studies in the future.

A difference in ROS production was also observed between SW480 and SW620 CRC cells, and between SW620 and SW620 cells with suppressed mitochondrial function through OA treatment or TFAM knockdown (Tables III, V and VI). Several recent studies suggest that mitochondria can generate some retrograding signals, ROS included, for cellular adaptation or cancer invasion (80–82). The endogenous ROS generated from mitochondria through electron leak can cross the mitochondrial membrane to regulate several proteins, transcriptional factors and transcriptional co-activators, e.g., PCG-1α as demonstrated in the present study (Table III) (83,84). PCG-1α has also been shown to play an important role in the regulation of TFAM (11). Abrupt production of ROS may be hazardous to living cells through the triggering of necrosis or apoptosis. Moderate levels of ROS may act as regulatory mediators in signaling processes. Sustained increase in the production of ROS is implicated in the pathogenesis of cancer and other diseases (85–87). However, the suitable levels or thresholds of mitochondrial ROS for cancer carcinogenesis, progression or invasion were not clearly demonstrated in the present study and have remained unclear (88,89).

Another important finding of the present study is amplified lactate fermentation of SW620 cells with suppressed mitochondrial function, and the difference in glycolysis between SW480 and SW620 cells (Tables III, V and VI). Since similar ATP levels were found in SW480 and SW620 cells, it seems reasonable to conjecture that the increase in lactate fermentation is compensated for the defects in mitochondrial function as described by Warburg (4–6). However, some researchers suggest that lactate fermentation from amplified glycolysis may confer several advantages for carcinogenesis, proliferation and progression of cancers by providing precursors for DNA/RNA synthesis and eradicating ROS by NADPH produced from the pentose phosphate pathway (PPP) (52,89,90). The PPP is an offshoot pathway parallel to glycolysis that generates NADPH and 5-carbon sugars for biosynthesis of nucleotides (52,89).

Recent studies indicate that proto-oncogenes, tumor-suppressor genes and specific signaling pathways may participate in the regulation of metabolic reprogramming or increase of glycolysis, including PI3K/Akt/mTOR1 and HIF-1/PDK1/PDH pathways, c-myc oncogene activation, and mutant p53 tumor-suppressor gene (5,80,91–95). However, the detail mechanism involved in CRC invasion deserves future study.

Regarding the difference between cancer cell invasion activity between SW480 and SW620 cells, some controversies exist. We and some researchers have demonstrated that SW620 cells have a higher invasion activity than SW480 cells (34,96,97). On the contrary, higher invasion activity of SW480 cells was observed in other studies (50,98,99). Differences in the culture medium, cell migration assay, and activation of signaling pathways may account for these differences. The tumor microenvironment seems to be another important issue in cancer cell adaptation to different cancer invasion phenotypes (100).

In summary, the above-mentioned findings suggest that a sufficient supply of ATP by mitochondrial respiration and oxidative phosphorylation is essential for migration and invasion of CRC cells. Metabolic reprogramming, amplified glycolysis and mitochondrial retrograde signaling are advantageous for cancer cells to achieve effective adaption to the microenvironment. However, the checkpoint and mechanism with which to trigger metabolic reprogramming and cancer invasion have remained a puzzle. We speculate that this type of metabolic plasticity may be a signature of malignant cancer cells, which may explain the failure of many anticancer therapies.

Acknowledgements

The present study was supported by grants from the Ministry of Science and Technology, Executive Yuan, Taiwan (MOST104-2320-B-715-006-MY2, MOST104-2627-B-715-002 and MOST105-2627-M-715-001-).

References

1 

Puppa G, Sonzogni A, Colombari R and Pelosi G: TNM staging system of colorectal carcinoma: A critical appraisal of challenging issues. Arch Pathol Lab Med. 134:837–852. 2010.PubMed/NCBI

2 

Hsu CC, Tseng LM and Lee HC: Role of mitochondrial dysfunction in cancer progression. Exp Biol Med. 241:1281–1295. 2016. View Article : Google Scholar

3 

Fearon ER: Molecular genetics of colorectal cancer. Annu Rev Pathol. 6:479–507. 2011. View Article : Google Scholar : PubMed/NCBI

4 

Warburg O, Wind F and Negelein E: The metabolism of tumors in the body. J Gen Physiol. 8:519–530. 1927. View Article : Google Scholar : PubMed/NCBI

5 

Kim JW and Dang CV: Cancer's molecular sweet tooth and the Warburg effect. Cancer Res. 66:8927–8930. 2006. View Article : Google Scholar : PubMed/NCBI

6 

Warburg O: On the origin of cancer cells. Science. 123:309–314. 1956. View Article : Google Scholar : PubMed/NCBI

7 

Bratic I and Trifunovic A: Mitochondrial energy metabolism and ageing. Biochim Biophys Acta. 797:961–967. 2010. View Article : Google Scholar

8 

Gilkerson R, Bravo L, Garcia I, Gaytan N, Herrera A, Maldonado A and Quintanilla B: The mitochondrial nucleoid: Integrating mitochondrial DNA into cellular homeostasis. Cold Spring Harb Perspect Biol. 5:a0110802013. View Article : Google Scholar : PubMed/NCBI

9 

Kaniak-Golik A and Skoneczna A: Mitochondria-nucleus network for genome stability. Free Radic Biol Med. 82:73–104. 2015. View Article : Google Scholar : PubMed/NCBI

10 

Baker MJ, Frazier AE, Gulbis JM and Ryan MT: Mitochondrial protein-import machinery: Correlating structure with function. Trends Cell Biol. 17:456–464. 2007. View Article : Google Scholar : PubMed/NCBI

11 

Lee HC and Wei YH: Mitochondrial biogenesis and mitochondrial DNA maintenance of mammalian cells under oxidative stress. Int J Biochem Cell Biol. 37:822–834. 2005. View Article : Google Scholar : PubMed/NCBI

12 

Asin-Cayuela J and Gustafsson CM: Mitochondrial transcription and its regulation in mammalian cells. Trends Biochem Sci. 32:111–117. 2007. View Article : Google Scholar : PubMed/NCBI

13 

Moraes CT: What regulates mitochondrial DNA copy number in animal cells? Trends Genet. 17:199–205. 2001. View Article : Google Scholar : PubMed/NCBI

14 

Boland ML, Chourasia AH and Macleod KF: Mitochondrial dysfunction in cancer. Front Oncol. 3:2922013. View Article : Google Scholar : PubMed/NCBI

15 

Lin CS and Wang LS: Mitochondrial DNA instability in human cancers. Formos J Surg. 46:71–75. 2013. View Article : Google Scholar

16 

Lee CH and Yu HS: Role of mitochondria, ROS, and DNA damage in arsenic induced carcinogenesis. Front Biosci. 8:312–320. 2016. View Article : Google Scholar

17 

Lee CH, Wu SB, Hong CH, Liao WT, Wu CY, Chen GS, Wei YH and Yu HS: Aberrant cell proliferation by enhanced mitochondrial biogenesis via mtTFA in arsenical skin cancers. Am J Pathol. 178:2066–2076. 2011. View Article : Google Scholar : PubMed/NCBI

18 

Kim MM, Clinger JD, Masayesva BG, Ha PK, Zahurak ML, Westra WH and Califano JA: Mitochondrial DNA quantity increases with histopathologic grade in premalignant and malignant head and neck lesions. Clin Cancer Res. 10:8512–8515. 2004. View Article : Google Scholar : PubMed/NCBI

19 

Yu M, Shi Y, Wei X, Yang Y, Zhou Y, Hao X, Zhang N and Niu R: Depletion of mitochondrial DNA by ethidium bromide treatment inhibits the proliferation and tumorigenesis of T47D human breast cancer cells. Toxicol Lett. 170:83–93. 2007. View Article : Google Scholar : PubMed/NCBI

20 

Lin CS, Chang SC, Ou LH, Chen CM, Hsieh SS, Chung YP, King KL, Lin SL and Wei YH: Mitochondrial DNA alterations correlate with the pathological status and the immunological ER, PR, HER-2/neu, p53 and Ki-67 expression in breast invasive ductal carcinoma. Oncol Rep. 33:2924–2934. 2015. View Article : Google Scholar : PubMed/NCBI

21 

Lin CS, Chang SC, Wang LS, Chou TY, Hsu WH, Wu YC and Wei YH: The role of mitochondrial DNA alterations in esophageal squamous cell carcinomas. J Thorac Cardiovasc Surg. 139:189–197 e184. 2010. View Article : Google Scholar : PubMed/NCBI

22 

Lin CS, Lee HT, Lee SY, Shen YA, Wang LS, Chen YJ and Wei YH: High mitochondrial DNA copy number and bioenergetic function are associated with tumor invasion of esophageal squamous cell carcinoma cell lines. Int J Mol Sci. 13:11228–11246. 2012. View Article : Google Scholar : PubMed/NCBI

23 

Lee HC and Wei YH: Mitochondrial DNA instability and metabolic shift in human cancers. Int J Mol Sci. 10:674–701. 2009. View Article : Google Scholar : PubMed/NCBI

24 

Roberts ER and Thomas KJ: The role of mitochondria in the development and progression of lung cancer. Comput Struct Biotechnol J. 6:e2013030192013. View Article : Google Scholar : PubMed/NCBI

25 

Lin CS, Wang LS, Tsai CM and Wei YH: Low copy number and low oxidative damage of mitochondrial DNA are associated with tumor progression in lung cancer tissues after neoadjuvant chemotherapy. Interact Cardiovasc Thorac Surg. 7:954–958. 2008. View Article : Google Scholar : PubMed/NCBI

26 

Simonnet H, Alazard N, Pfeiffer K, Gallou C, Béroud C, Demont J, Bouvier R, Schägger H and Godinot C: Low mitochondrial respiratory chain content correlates with tumor aggressiveness in renal cell carcinoma. Carcinogenesis. 23:759–768. 2002. View Article : Google Scholar : PubMed/NCBI

27 

Lin CS, Lee HT, Lee MH, Pan SC, Ke CY, Chiu AW and Wei YH: Role of mitochondrial DNA copy number alteration in human renal cell carcinoma. Int J Mol Sci. 17:E8142016. View Article : Google Scholar : PubMed/NCBI

28 

Wu CW, Yin PH, Hung WY, Li AF, Li SH, Chi CW, Wei YH and Lee HC: Mitochondrial DNA mutations and mitochondrial DNA depletion in gastric cancer. Genes Chromosomes Cancer. 44:19–28. 2005. View Article : Google Scholar : PubMed/NCBI

29 

Lee YK, Woo HG and Yoon G: Mitochondrial defect-responsive gene signature in liver-cancer progression. BMB Rep. 48:597–598. 2015. View Article : Google Scholar : PubMed/NCBI

30 

Yin PH, Lee HC, Chau GY, Wu YT, Li SH, Lui WY, Wei YH, Liu TY and Chi CW: Alteration of the copy number and deletion of mitochondrial DNA in human hepatocellular carcinoma. Br J Cancer. 90:2390–2396. 2004. View Article : Google Scholar : PubMed/NCBI

31 

Toki N, Kagami S, Kurita T, Kawagoe T, Matsuura Y, Hachisuga T, Matsuyama A, Hashimoto H, Izumi H and Kohno K: Expression of mitochondrial transcription factor A in endometrial carcinomas: Clinicopathologic correlations and prognostic significance. Virchows Arch. 456:387–393. 2010. View Article : Google Scholar : PubMed/NCBI

32 

Singh KP, Kumari R, Treas J and DuMond JW: Chronic exposure to arsenic causes increased cell survival, DNA damage, and increased expression of mitochondrial transcription factor A (mtTFA) in human prostate epithelial cells. Chem Res Toxicol. 24:340–349. 2011. View Article : Google Scholar : PubMed/NCBI

33 

Mo M, Peng F, Wang L, Peng L, Lan G and Yu S: Roles of mitochondrial transcription factor A and microRNA-590-3p in the development of bladder cancer. Oncol Lett. 6:617–623. 2013.PubMed/NCBI

34 

Hewitt RE, McMarlin A, Kleiner D, Wersto R, Martin P, Tsokos M, Stamp GW and Stetler-Stevenson WG: Validation of a model of colon cancer progression. J Pathol. 192:446–454. 2000. View Article : Google Scholar : PubMed/NCBI

35 

Leibovitz A, Stinson JC, McCombs WB III, McCoy CE, Mazur KC and Mabry ND: Classification of human colorectal adenocarcinoma cell lines. Cancer Res. 36:4562–4569. 1976.PubMed/NCBI

36 

Futschik M, Jeffs A, Pattison S, Kasabov N, Sullivan M, Merrie A and Reeve A: Gene expression profiling of metastatic and nonmetastatic colorectal cancer cell lines. Genome Lett. 1:26–34. 2002. View Article : Google Scholar

37 

Lee CC, Chen WS, Chen CC, Chen LL, Lin YS, Fan CS and Huang TS: TCF12 protein functions as transcriptional repressor of E-cadherin, and its overexpression is correlated with metastasis of colorectal cancer. J Biol Chem. 287:2798–2809. 2012. View Article : Google Scholar : PubMed/NCBI

38 

Wang CH, Wang CC, Huang HC and Wei YH: Mitochondrial dysfunction leads to impairment of insulin sensitivity and adiponectin secretion in adipocytes. FEBS J. 280:1039–1050. 2013. View Article : Google Scholar : PubMed/NCBI

39 

Ma J, Zhang Q, Chen S, Fang B, Yang Q, Chen C, Miele L, Sarkar FH, Xia J and Wang Z: Mitochondrial dysfunction promotes breast cancer cell migration and invasion through HIF1α accumulation via increased production of reactive oxygen species. PLoS One. 8:e694852013. View Article : Google Scholar : PubMed/NCBI

40 

Cillero-Pastor B, Rego-Pérez I, Oreiro N, Fernandez-Lopez C and Blanco FJ: Mitochondrial respiratory chain dysfunction modulates metalloproteases −1, −3 and −13 in human normal chondrocytes in culture. BMC Musculoskelet Disord. 14:2352013. View Article : Google Scholar : PubMed/NCBI

41 

Li C, Wu Z, Liu M, Pazgier M and Lu W: Chemically synthesized human survivin does not inhibit caspase-3. Protein Sci. 17:1624–1629. 2008. View Article : Google Scholar : PubMed/NCBI

42 

Salazar N, Muñoz D, Hoy J and Lokeshwar BL: Use of shRNA for stable suppression of chemokine receptor expression and function in human cancer cell lines. Methods Mol Biol. 1172:209–218. 2014. View Article : Google Scholar : PubMed/NCBI

43 

Chen CT, Shih YR, Kuo TK, Lee OK and Wei YH: Coordinated changes of mitochondrial biogenesis and antioxidant enzymes during osteogenic differentiation of human mesenchymal stem cells. Stem Cells. 26:960–968. 2008. View Article : Google Scholar : PubMed/NCBI

44 

Clerc P and Polster BM: Investigation of mitochondrial dysfunction by sequential microplate-based respiration measurements from intact and permeabilized neurons. PLoS One. 7:e344652012. View Article : Google Scholar : PubMed/NCBI

45 

Wang CH, Chen YF, Wu CY, Wu PC, Huang YL, Kao CH, Lin CH, Kao LS, Tsai TF and Wei YH: Cisd2 modulates the differentiation and functioning of adipocytes by regulating intracellular Ca2+ homeostasis. Hum Mol Genet. 23:4770–4785. 2014. View Article : Google Scholar : PubMed/NCBI

46 

Chou SJ, Tseng WL, Chen CT, Lai YF, Chien CS, Chang YL, Lee HC, Wei YH and Chiou SH: Impaired ROS scavenging system in human induced pluripotent stem cells generated from patients with MERRF syndrome. Sci Rep. 6:236612016. View Article : Google Scholar : PubMed/NCBI

47 

Lee HT, Lin CS, Chen WS, Liao HT, Tsai CY and Wei YH: Leukocyte mitochondrial DNA alteration in systemic lupus erythematosus and its relevance to the susceptibility to lupus nephritis. Int J Mol Sci. 13:8853–8868. 2012. View Article : Google Scholar : PubMed/NCBI

48 

Lee HT, Lin CS, Lee CS, Tsai CY and Wei YH: Increased 8-hydroxy-2′-deoxyguanosine in plasma and decreased mRNA expression of human 8-oxoguanine DNA glycosylase 1, anti-oxidant enzymes, mitochondrial biogenesis-related proteins and glycolytic enzymes in leucocytes in patients with systemic lupus erythematosus. Clin Exp Immunol. 176:66–77. 2014. View Article : Google Scholar : PubMed/NCBI

49 

Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCt method. Methods. 25:402–408. 2001. View Article : Google Scholar : PubMed/NCBI

50 

Kubens BS and Zänker KS: Differences in the migration capacity of primary human colon carcinoma cells (SW480) and their lymph node metastatic derivatives (SW620). Cancer Lett. 131:55–64. 1998. View Article : Google Scholar : PubMed/NCBI

51 

Koppenol WH, Bounds PL and Dang CV: Otto Warburg's contributions to current concepts of cancer metabolism. Nat Rev Cancer. 11:325–337. 2011. View Article : Google Scholar : PubMed/NCBI

52 

Pedersen PL: Warburg, me and Hexokinase 2: Multiple discoveries of key molecular events underlying one of cancers' most common phenotypes, the ‘Warburg Effect’, i.e., elevated glycolysis in the presence of oxygen. J Bioenerg Biomembr. 39:211–222. 2007. View Article : Google Scholar : PubMed/NCBI

53 

Gatenby RA and Gillies RJ: Why do cancers have high aerobic glycolysis? Nat Rev Cancer. 4:891–899. 2004. View Article : Google Scholar : PubMed/NCBI

54 

Lu J, Tan M and Cai Q: The Warburg effect in tumor progression: Mitochondrial oxidative metabolism as an anti-metastasis mechanism. Cancer Lett. 356:156–164. 2015. View Article : Google Scholar : PubMed/NCBI

55 

Zong WX, Rabinowitz JD and White E: Mitochondria and Cancer. Mol Cell. 61:667–676. 2016. View Article : Google Scholar : PubMed/NCBI

56 

Verschoor ML, Ungard R, Harbottle A, Jakupciak JP, Parr RL and Singh G: Mitochondria and cancer: Past, present, and future. Biomed Res Int. 2013:6123692013. View Article : Google Scholar : PubMed/NCBI

57 

Lee HC, Yin PH, Lin JC, Wu CC, Chen CY, Wu CW, Chi CW, Tam TN and Wei YH: Mitochondrial genome instability and mtDNA depletion in human cancers. Ann NY Acad Sci. 1042:109–122. 2005. View Article : Google Scholar : PubMed/NCBI

58 

Tseng LM, Yin PH, Chi CW, Hsu CY, Wu CW, Lee LM, Wei YH and Lee HC: Mitochondrial DNA mutations and mitochondrial DNA depletion in breast cancer. Genes Chromosomes Cancer. 45:629–638. 2006. View Article : Google Scholar : PubMed/NCBI

59 

Jiang WW, Masayesva B, Zahurak M, Carvalho AL, Rosenbaum E, Mambo E, Zhou S, Minhas K, Benoit N, Westra WH, et al: Increased mitochondrial DNA content in saliva associated with head and neck cancer. Clin Cancer Res. 11:2486–2491. 2005. View Article : Google Scholar : PubMed/NCBI

60 

Wen S, Gao J, Zhang L, Zhou H, Fang D and Feng S: p53 increase mitochondrial copy number via up-regulation of mitochondrial transcription factor A in colorectal cancer. Oncotarget. 7:75981–75995. 2016.PubMed/NCBI

61 

Gao J, Wen S, Zhou H and Feng S: De-methylation of displacement loop of mitochondrial DNA is associated with increased mitochondrial copy number and nicotinamide adenine dinucleotide subunit 2 expression in colorectal cancer. Mol Med Rep. 12:7033–7038. 2015. View Article : Google Scholar : PubMed/NCBI

62 

Feng S, Xiong L, Ji Z, Cheng W and Yang H: Correlation between increased copy number of mitochondrial DNA and clinicopathological stage in colorectal cancer. Oncol Lett. 2:899–903. 2011.PubMed/NCBI

63 

Feng S, Xiong L, Ji Z, Cheng W and Yang H: Correlation between increased ND2 expression and demethylated displacement loop of mtDNA in colorectal cancer. Mol Med Rep. 6:125–130. 2012.PubMed/NCBI

64 

van Osch FH, Voets AM, Schouten LJ, Gottschalk RW, Simons CC, van Engeland M, Lentjes MH, van den Brandt PA, Smeets HJ and Weijenberg MP: Mitochondrial DNA copy number in colorectal cancer: Between tissue comparisons, clinicopathological characteristics and survival. Carcinogenesis. 36:1502–1510. 2015.PubMed/NCBI

65 

Cui H, Huang P, Wang Z, Zhang Y, Zhang Z, Xu W, Wang X, Han Y and Guo X: Association of decreased mitochondrial DNA content with the progression of colorectal cancer. BMC Cancer. 13:1102013. View Article : Google Scholar : PubMed/NCBI

66 

Sanchez-Pino MJ, Moreno P and Navarro A: Mitochondrial dysfunction in human colorectal cancer progression. Front Biosci. 12:1190–1199. 2007. View Article : Google Scholar : PubMed/NCBI

67 

Phan LM, Yeung SC and Lee MH: Cancer metabolic reprogramming: Importance, main features, and potentials for precise targeted anti-cancer therapies. Cancer Biol Med. 11:1–19. 2014.PubMed/NCBI

68 

Yoshida GJ: Metabolic reprogramming: The emerging concept and associated therapeutic strategies. J Exp Clin Cancer Res. 34:1112015. View Article : Google Scholar : PubMed/NCBI

69 

Ward PS and Thompson CB: Metabolic reprogramming: A cancer hallmark even warburg did not anticipate. Cancer Cell. 21:297–308. 2012. View Article : Google Scholar : PubMed/NCBI

70 

Koukourakis MI, Giatromanolaki A, Sivridis E, Gatter KC and Harris AL; Tumor and Angiogenesis Research Group, : Pyruvate dehydrogenase and pyruvate dehydrogenase kinase expression in non small cell lung cancer and tumor-associated stroma. Neoplasia. 7:1–6. 2005. View Article : Google Scholar : PubMed/NCBI

71 

Zheng J: Energy metabolism of cancer: Glycolysis versus oxidative phosphorylation (Review). Oncol Lett. 4:1151–1157. 2012.PubMed/NCBI

72 

Vyas S, Zaganjor E and Haigis MC: Mitochondria and cancer. Cell. 166:555–566. 2016. View Article : Google Scholar : PubMed/NCBI

73 

Ahn CS and Metallo CM: Mitochondria as biosynthetic factories for cancer proliferation. Cancer Metab. 3:12015. View Article : Google Scholar : PubMed/NCBI

74 

Shen YA, Wang CY, Hsieh YT, Chen YJ and Wei YH: Metabolic reprogramming orchestrates cancer stem cell properties in nasopharyngeal carcinoma. Cell Cycle. 14:86–98. 2015. View Article : Google Scholar : PubMed/NCBI

75 

Shen YA, Lin CH, Chi WH, Wang CY, Hsieh YT, Wei YH and Chen YJ: Resveratrol impedes the stemness, epithelial-mesenchymal transition, and metabolic reprogramming of cancer stem cells in nasopharyngeal carcinoma through p53 activation. Evid Based Complement Alternat Med. 2013:5903932013. View Article : Google Scholar : PubMed/NCBI

76 

Guha M, Srinivasan S, Ruthel G, Kashina AK, Carstens RP, Mendoza A, Khanna C, Van Winkle T and Avadhani NG: Mitochondrial retrograde signaling induces epithelial-mesenchymal transition and generates breast cancer stem cells. Oncogene. 33:5238–5250. 2014. View Article : Google Scholar : PubMed/NCBI

77 

Chang CJ, Yin PH, Yang DM, Wang CH, Hung WY, Chi CW, Wei YH and Lee HC: Mitochondrial dysfunction-induced amphiregulin upregulation mediates chemo-resistance and cell migration in HepG2 cells. Cell Mol Life Sci. 66:1755–1765. 2009. View Article : Google Scholar : PubMed/NCBI

78 

Yoshida Y, Hasegawa J, Nezu R, Kim YK, Hirota M, Kawano K, Izumi H and Kohno K: Clinical usefulness of mitochondrial transcription factor A expression as a predictive marker in colorectal cancer patients treated with FOLFOX. Cancer Sci. 102:578–582. 2011. View Article : Google Scholar : PubMed/NCBI

79 

Nakayama Y, Yamauchi M, Minagawa N, Torigoe T, Izumi H, Kohno K and Yamaguchi K: Clinical significance of mitochondrial transcription factor A expression in patients with colorectal cancer. Oncol Rep. 27:1325–1330. 2012.PubMed/NCBI

80 

Barbour JA and Turner N: Mitochondrial stress signaling promotes cellular adaptations. Int J Cell Biol. 2014:1560202014. View Article : Google Scholar : PubMed/NCBI

81 

da Cunha FM, Torelli NQ and Kowaltowski AJ: Mitochondrial retrograde signaling: Triggers, pathways, and outcomes. Oxid Med Cell Longev. 2015:4825822015. View Article : Google Scholar : PubMed/NCBI

82 

Guha M and Avadhani NG: Mitochondrial retrograde signaling at the crossroads of tumor bioenergetics, genetics and epigenetics. Mitochondrion. 13:577–591. 2013. View Article : Google Scholar : PubMed/NCBI

83 

Murphy MP: How mitochondria produce reactive oxygen species. Biochem J. 417:1–13. 2009. View Article : Google Scholar : PubMed/NCBI

84 

St-Pierre J, Drori S, Uldry M, Silvaggi JM, Rhee J, Jäger S, Handschin C, Zheng K, Lin J, Yang W, et al: Suppression of reactive oxygen species and neurodegeneration by the PGC-1 transcriptional coactivators. Cell. 127:397–408. 2006. View Article : Google Scholar : PubMed/NCBI

85 

Dröge W: Free radicals in the physiological control of cell function. Physiol Rev. 82:47–95. 2002. View Article : Google Scholar : PubMed/NCBI

86 

Alfadda AA and Sallam RM: Reactive oxygen species in health and disease. J Biomed Biotechnol. 2012:9364862012. View Article : Google Scholar : PubMed/NCBI

87 

Eisele HJ, Markart P and Schulz R: Obstructive sleep apnea, oxidative stress, and cardiovascular disease: Evidence from human studies. Oxid Med Cell Longev. 2015:6084382015. View Article : Google Scholar : PubMed/NCBI

88 

Sabharwal SS and Schumacker PT: Mitochondrial ROS in cancer: Initiators, amplifiers or an Achilles' heel? Nat Rev Cancer. 14:709–721. 2014. View Article : Google Scholar : PubMed/NCBI

89 

Lu F: Reactive oxygen species in cancer, too much or too little? Med Hypotheses. 69:1293–1298. 2007. View Article : Google Scholar : PubMed/NCBI

90 

Kondoh H, Lleonart ME, Gil J, Wang J, Degan P, Peters G, Martinez D, Carnero A and Beach D: Glycolytic enzymes can modulate cellular life span. Cancer Res. 65:177–185. 2005.PubMed/NCBI

91 

Li F, Wang Y, Zeller KI, Potter JJ, Wonsey DR, O'Donnell KA, Kim JW, Yustein JT, Lee LA and Dang CV: Myc stimulates nuclearly encoded mitochondrial genes and mitochondrial biogenesis. Mol Cell Biol. 25:6225–6234. 2005. View Article : Google Scholar : PubMed/NCBI

92 

Papandreou I, Cairns RA, Fontana L, Lim AL and Denko NC: HIF-1 mediates adaptation to hypoxia by actively downregulating mitochondrial oxygen consumption. Cell Metab. 3:187–197. 2006. View Article : Google Scholar : PubMed/NCBI

93 

Buzzai M, Bauer DE, Jones RG, Deberardinis RJ, Hatzivassiliou G, Elstrom RL and Thompson CB: The glucose dependence of Akt-transformed cells can be reversed by pharmacologic activation of fatty acid beta-oxidation. Oncogene. 24:4165–4173. 2005. View Article : Google Scholar : PubMed/NCBI

94 

Düvel K, Yecies JL, Menon S, Raman P, Lipovsky AI, Souza AL, Triantafellow E, Ma Q, Gorski R, Cleaver S, et al: Activation of a metabolic gene regulatory network downstream of mTOR complex 1. Mol Cell. 39:171–183. 2010. View Article : Google Scholar : PubMed/NCBI

95 

Fields J, Hanisch JJ, Choi JW and Hwang PM: How does p53 regulate mitochondrial respiration? IUBMB Life. 59:682–684. 2007. View Article : Google Scholar : PubMed/NCBI

96 

Ni J, Jiang Z, Shen L, Gao L, Yu M, Xu X, Zou S, Hua D and Wu S: β3GnT8 regulates the metastatic potential of colorectal carcinoma cells by altering the glycosylation of CD147. Oncol Rep. 31:1795–1801. 2014. View Article : Google Scholar : PubMed/NCBI

97 

Cai K, Mulatz K, Ard R, Nguyen T and Gee SH: Increased diacylglycerol kinase ζ expression in human metastatic colon cancer cells augments Rho GTPase activity and contributes to enhanced invasion. BMC Cancer. 14:2082014. View Article : Google Scholar : PubMed/NCBI

98 

Schimanski CC, Schwald S, Simiantonaki N, Jayasinghe C, Gönner U, Wilsberg V, Junginger T, Berger MR, Galle PR and Moehler M: Effect of chemokine receptors CXCR4 and CCR7 on the metastatic behavior of human colorectal cancer. Clin Cancer Res. 11:1743–1750. 2005. View Article : Google Scholar : PubMed/NCBI

99 

Kusakai G, Suzuki A, Ogura T, Miyamoto S, Ochiai A, Kaminishi M and Esumi H: ARK5 expression in colorectal cancer and its implications for tumor progression. Am J Pathol. 164:987–995. 2004. View Article : Google Scholar : PubMed/NCBI

100 

Friedl P and Alexander S: Cancer invasion and the microenvironment: Plasticity and reciprocity. Cell. 147:992–1009. 2011. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Lin C, Liu L, Ou L, Pan S, Lin C and Wei Y: Role of mitochondrial function in the invasiveness of human colon cancer cells. Oncol Rep 39: 316-330, 2018.
APA
Lin, C., Liu, L., Ou, L., Pan, S., Lin, C., & Wei, Y. (2018). Role of mitochondrial function in the invasiveness of human colon cancer cells. Oncology Reports, 39, 316-330. https://doi.org/10.3892/or.2017.6087
MLA
Lin, C., Liu, L., Ou, L., Pan, S., Lin, C., Wei, Y."Role of mitochondrial function in the invasiveness of human colon cancer cells". Oncology Reports 39.1 (2018): 316-330.
Chicago
Lin, C., Liu, L., Ou, L., Pan, S., Lin, C., Wei, Y."Role of mitochondrial function in the invasiveness of human colon cancer cells". Oncology Reports 39, no. 1 (2018): 316-330. https://doi.org/10.3892/or.2017.6087
Copy and paste a formatted citation
x
Spandidos Publications style
Lin C, Liu L, Ou L, Pan S, Lin C and Wei Y: Role of mitochondrial function in the invasiveness of human colon cancer cells. Oncol Rep 39: 316-330, 2018.
APA
Lin, C., Liu, L., Ou, L., Pan, S., Lin, C., & Wei, Y. (2018). Role of mitochondrial function in the invasiveness of human colon cancer cells. Oncology Reports, 39, 316-330. https://doi.org/10.3892/or.2017.6087
MLA
Lin, C., Liu, L., Ou, L., Pan, S., Lin, C., Wei, Y."Role of mitochondrial function in the invasiveness of human colon cancer cells". Oncology Reports 39.1 (2018): 316-330.
Chicago
Lin, C., Liu, L., Ou, L., Pan, S., Lin, C., Wei, Y."Role of mitochondrial function in the invasiveness of human colon cancer cells". Oncology Reports 39, no. 1 (2018): 316-330. https://doi.org/10.3892/or.2017.6087
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team