Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Oncology Reports
Join Editorial Board Propose a Special Issue
Print ISSN: 1021-335X Online ISSN: 1791-2431
Journal Cover
October-2018 Volume 40 Issue 4

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
October-2018 Volume 40 Issue 4

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article Open Access

miR‑590‑5p inhibits tumor growth in malignant melanoma by suppressing YAP1 expression

  • Authors:
    • Kuanhou Mou
    • Meiling Ding
    • Dan Han
    • Yan Zhou
    • Xin Mu
    • Wenli Liu
    • Lijuan Wang
  • View Affiliations / Copyright

    Affiliations: Department of Dermatology, The First Affiliated Hospital of Xi'an Jiaotong University, Xi'an, Shaanxi 710061, P.R. China, State Key Laboratory of Cancer Biology, National Clinical Research Center for Digestive Disease, Xijing Hospital of Digestive Diseases, The Fourth Military Medical University, Xi'an, Shaanxi 710069, P.R. China, Department of Dermatology, The First Affiliated Hospital of Xi'an Jiaotong University, Xi'an, Shaanxi 710061, P.R. China
    Copyright: © Mou et al. This is an open access article distributed under the terms of Creative Commons Attribution License.
  • Pages: 2056-2066
    |
    Published online on: August 7, 2018
       https://doi.org/10.3892/or.2018.6633
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

The microRNAs (miRNAs/miRs) involved in the carcinogenesis and progression of malignant melanoma (MM) remain unclear. In the present study, miR‑590‑5p was identified to be upregulated in MM cells compared with human melanocytes using a reverse transcription‑quantitative polymerase chain reaction to screen established oncogenic and tumor suppressor miRNAs. miR‑590‑5p was demonstrated to inhibit the cell proliferation and tumor growth of MM cells in vitro and in vivo by performing Cell Counting Kit‑8 and tumour xenograft assays, respectively. In addition, flowcytometry assays indicated that miR‑590‑5p induced cell apoptosis and cell cycle arrest at the G1 stage in MM cells. Finally, luciferase assays and western blot analysis results confirmed that the transcriptional regulator Yes‑associated protein 1 (YAP1) is upregulated and inversely associated with miR‑590‑5p expression in MM cells, and is the direct target and functional mediator of miR‑590‑5p in MM. Altogether these results reveal the functional and mechanistic link between miR‑590‑5p and YAP1 in the progression of MM. Therefore, miR‑590‑5p is a potential therapeutic target in MM.

Introduction

Malignant melanoma (MM) is one of the most aggressive forms of cutaneous neoplasms, and its incidence is notably increasing (1). It is estimated that there will be 87,110 newly diagnosed MM cases and 9,730 MM-associated mortalities in 2017 in the United States (2). Despite substantial improvement in the diagnosis and treatment of MM in previous years, the prognosis remains poor for patients with MM diagnosed at metastatic stages, with a median survival time of 6–9 months and a 5-year survival rate of <15% (3–6). Thus, identifying effective biomarkers for the early detection and efficient evaluation of prognosis of MM following surgery is crucial.

MicroRNAs (miRNAs/miRs) comprise a group of small non-coding RNAs (~22 nucleotides in length) (7). These miRNAs regulate the expression of a wide variety of target genes through repressing translation or inducing mRNA degradation by binding to complementary sites in 3′-untranslated regions (3′-UTRs) (8). Aberrantly expressing miRNAs may function as tumor suppressors or oncogenes, depending on the functions of their target genes (9–11). Increasingly, miRNAs have been observed in various types of cancer, and have been revealed to be involved in modulating cancer cell behavior, including cell proliferation (12), cell apoptosis (13), cell cycle (14), cell migration (15) and cell invasion (16). Previously, a number of aberrantly-expressed serum and tissue miRNAs have been employed as diagnostic or prognostic indicators in MM (11,17,18).

The expression and function of miR-590-5p varies in different types of tumor. miR-590-5p was previously demonstrated to function as an oncogene, and promote the proliferation, migration and G1-S phase transition by directly inhibiting the transforming growth factor beta receptor II (TGF-βRII) in vulvar squamous cell carcinoma (19). Conversely, miR-590-5p serves a tumor suppressor role in breast cancer, and inhibits cancer cell stemness and metastasis by targeting SRY-box 2 (20). Previously, it was revealed that miR-590-5p was downregulated in human melanoma A375 cells, and inhibited their migration and invasion ability (21). However, the precise functions and underlying mechanisms of miR-590-5p on the proliferation and apoptosis of MM cells remain unclear.

In the present study, a reverse transcription-quantitative polymerase chain reaction (RT-qPCR) was performed to detect established oncogenic and tumor suppressor miRNAs in MM cells and normal human melanocytes (HMs). Furthermore, Cell Counting Kit-8 (CCK-8), flow cytometry and tumor xenograft assays were performed to detect the effects of miR-590-5p on the proliferation and apoptosis of MM cells in vitro, and tumor growth in vivo. Finally, luciferase assays and western blot analysis were performed to investigate whether Yes-associated protein 1 (YAP1) was the functional mediator of miR-590-5p in MM cells.

Materials and methods

Cell culture

Human MM cell lines A2058, A375, normal epidermal melanocytes HEMa-LP and 293 cells were obtained from the Cell Bank of the Chinese Academy of Sciences (Shanghai, China), where they were characterized by mycoplasma detection, DNA-fingerprinting, isozyme detection and cell vitality detection, performed by the Cell Bank of the Chinese Academy of Sciences. A2058 and A375 cells were cultured in Dulbecco's modified Eagle's medium (DMEM; Invitrogen; Thermo Fisher Scientific, Inc., Waltham, MA, USA) supplemented with 10% fetal bovine serum (HyClone; GE Healthcare Life Sciences, Logan, UT, USA) at 37°C in a humidified atmosphere of 95% air and 5% CO2. HMs isolated from human foreskin specimens from patients who received circumcision at the First Affiliated Hospital of Xi'an Jiaotong University and provided written informed consent for the use of their excised foreskin. Ethical approval was obtained from the Ethics Committee of Xi'an Jiaotong University (Xi'an, China). HM and HEMa-LP cells were cultured in Medium 254 (Invitrogen; Thermo Fisher Scientific, Inc.) supplemented with HM growth supplement at 37°C in a humidified atmosphere of 95% air and 5% CO2.

Oligonucleotide transfection

miR-590-5p negative control (NC; sequence, GUCCAGUGAAUUCCCAG), miR-590-5p inhibitors (sequence, GACGUAAAAUACUUAUUCGAG), miR-590-5p mimics (sequence, GAGCUUAUUCAUAAAAUGCAG), YAP1 NC (antisense, CCGGTAAATTTCTGAAATTTATTTCAAGAGATTTCTAAATCTCATCCTGAGTCTCTCTTTTTG and sense, AATTCAAAAAGACAGGACTTTAGAAATTCTCTTGAAATCCATCAGGAAGAGGACCTGTTTG) and YAP1 small interfering RNA (siRNA; antisense, CCGGCAGGCCTCCTCTTCCTGATGGATTTCAGAGAATCCATCAGGAAGAGGACCTGTTTG and sense, AATTCAAAACAGGTCCTCTTCCTGATGGATTCTCTTGAAATCCATCAGGAAGAGGACCTGTTTTG) were purchased from Shanghai GenePharma Co., Ltd. (Shanghai, China). When the confluence of A375 and A2058 cells reached 50–60% in a 6-well plate, oligonucleotides (50 nmol) were mixed with 5 µl Lipofectamine® 2000 (Thermo Fisher Scientific, Inc.) in 500 µl serum-free DMEM (Life Technologies; Thermo Fisher Scientific, Inc.). The transfection solutions were added to each well containing 500 µl serum-free DMEM (Life Technologies; Thermo Fisher Scientific, Inc.). Once the cells were incubated with oligonucleotides for 24 h, the culture medium was changed to to DMEM (Invitrogen; Thermo Fisher Scientific, Inc.) supplemented with 10% fetal bovine serum (HyClone; GE Healthcare Life Sciences). Following transfection, cell samples were collected at 48 h for further analyses.

RT-qPCR

For miR590-5p quantification, total miRNA was extracted from A375 and A2058 cells using the miRNeasy RNA isolation kit (Qiagen GmbH, Hilden, Germany) according to the manufacturer's protocol. Total miRNA samples were reverse-transcribed into cDNA using the miScript Reverse Transcription kit (Qiagen GmbH, Hilden, Germany) according to the manufacturer's protocol with a miR-590-5p specific primer and universal small nuclear U6 RNA was used as an internal loading control. RT was performed at 45°C for 60 min and 70°C for 10 min. TaqMan miRNA RT-qPCR (Applied Biosystems; Thermo Fisher Scientific, Inc.) were used to detect and quantify miR-590-5p and U6 expression. For YAP1 quantification, total RNA was extracted from the cells using TRIzol reagent (Sigma-Aldrich; Merck KGaA, Darmstadt, Germany) according to the manufacturer's protocol. RNA samples were then reverse-transcribed into cDNA using PrimeScript™ RT Master Mix (Takara Bio, Inc., Otsu, Japan) according to the manufacturer's protocol with a YAP1 specific primer and U6 RNA was used as an internal loading control. SYBR Mix (Takara Bio, Inc.) was used to detect and quantify YAP1 and β-actin expression. RT-qPCR assays were performed under the following thermocycling conditions: 95°C for 5 min, followed by 45 cycles of 95°C for 15 sec, 60°C for 30 sec and 72°C for 30 sec. Data were analyzed with 7500 software v.2.0.1 (Applied Biosystems; Thermo Fisher Scientific, Inc.), with the automatic Cq setting for adapting the baseline and threshold for Cq determination (22). Each sample was examined in triplicate. The primer sequences used in the present study are listed in Table I.

Table I.

Primers used for reverse transcription-quantitative polymerase chain reaction.

Table I.

Primers used for reverse transcription-quantitative polymerase chain reaction.

Gene nameForward primer 5′-3′Reverse primer 5′-3′
Yes-associated protein 1 ACCCACAGCTCAGCATCTTCG TGGCTTGTTCCCATCCATCAG
β-actin CGTCTTCCCCTCCATCGT GAAGGTGTGGTGCCAGATTT
microRNA-590-5p GGAATTCTTCAGTTGTAACCCAG CGGGATCCTTGAGATGTCACCAA
U6 CTCGCTTCGGCAGCACA AACGCTTCACGAATTTGCGT
CCK-8

A2058 cells transfected with miR-590-5p NC and miR-590-5p mimics (used 24 h after transfection) and A375 cells transfected with miR-590-5p NC and miR-590-5p inhibitors (used 24 h after transfection) were seeded in a 96-well culture plate at a density of 2,000 cells per well. Each group was established in nine wells. CCK-8 reagents (MedChemExpress, Monmouth Junction, NJ, USA) were added into each well 24, 48, 72, 96 and 120 h after seeding, and each group was cultured for 50 min at 37°C in a humidified atmosphere of 95% air and 5% CO2. The OD values were measured at 490 nm in a Microplate Reader.

Flow cytometry

A375 and A2058 cells in 6 well culture plate were harvested by trypsinization at 37°C for 5 min, and wash three times with PBS. For cell apoptosis, cells were suspended in 500 µl binding buffer at a density of 2×106 cells/ml, and incubated with Annexin V-fluorescien isothiocyanate and propidium iodide (PI; BD Biosciences, San Jose, CA, USA) for 15 min in the dark at room temperature. For cell cycle analysis, 2×106 cells/ml A2058 and A375 cells were fixed using 75% ethanol at 4°C for 12 h. PI was added into A2058 and A375 cells transfected with miR-590-5p NC, inhibitors or mimics and incubated for 20 min in the dark at room temperature. Cell apoptosis and cell cycle was then analyzed using a flow cytometer and Kaluza Analysis Software version 2.0 (Beckman Coulter, Inc., Brea, CA, USA).

Western blot analysis

A375 and A2058 cells were washed in PBS three times prior to proteins being extracted. Then the cells were lysed using RIPA buffer for 30 min on ice (Xi'an Jing Cai Biological Technology Co., Ltd., Xi'an, China), each protein sample (30 µg) was denatured in SDS sample buffer and separated via 10% SDS/PAGE gel. Separated proteins were transferred onto polyvinylidene fluoride membranes (EMD Millipore, Billerica, MA, USA) blocked with 5% bovine serum albumin (Beyotime Institute of Biotechnology, Haimen, China) for 2 h at room temperature, and incubated overnight with primary antibodies at 4°C. Blotting was performed with primary antibodies against YAP1 (1:300; cat no. 14074; Cell Signaling Technology, Inc., Danvers, MA, USA). Goat anti-rabbit immunoglobulin horseradish peroxidase-conjugated F(ab)2 fragments (1:5,000; cat no. TA130071; OriGene Technologies, Inc., Rockville, MD, USA) were used as secondary antibodies and incubated for 2 h at room temperature. β-actin (1:4,000; cat no. ab8226; Abcam, Cambridge, UK) was used as a loading control and incubated overnight at 4°C. Blots were then washed three times (10 min/wash) in tris buffered saline with 0.1% Tween-20 and developed using an enhanced chemiluminescence system (Xi'an Jing Cai Biological Technology Co., Ltd.). ImageJ 1.8.0 (National Institutes of Health, Bethesda, MD, USA) was used to analyze the gray values of each blot.

Tumour xenograft assays

For tumorigenesis assays, A2058 cells were engineered to stably overexpress miR-590-5p and luciferase, using a lentiviral-based system (cat no. 73153; pLenti6.3; Shanghai GeneChem, Inc., Shanghai, China) In brief, pri-miR-590-5p sequence was cloned into pLenti6.3 vector (Shanghai GeneChem, Inc.). Then, pLenti-miR-590-5p-Luci (50 nmol) was co-transfected into 293 cells with psPAX2 and PMD2G by using Lipofectamine 2000® (Thermo Fisher Scientific, Inc.) according to the manufacturer's protocol. Once the 293 cells were incubated with oligonucleotides for 8 h at 37°C, the culture medium was changed to DMEM (Invitrogen; Thermo Fisher Scientific, Inc.) supplemented with 10% fetal bovine serum (HyClone; GE Healthcare Life Sciences). Following transfection, viral particles were collected at 48 h, and centrifuged together at 1,000 × g for 5 min at 4°C, then filtered through 0.45 nm filter. Xenograft tumors were generated by the subcutaneous injection of A2058 cells (5×106), including A2058 pLenti-Luciferase and A2058 pLenti-miR-590-5p-Luciferase, into the hind limbs of 4–6 weeks old Balb/C female athymic nude mice (nu/nu; Animal Center of Xi'an Jiaotong University, Xi'an, China; n=5 for each group). All mice were housed and maintained under specific pathogen-free conditions at 18–22°C, with 20% humidity, a 12-h light and 12-h dark cycle and ad libitum access to food. The tumor size was measured using an Xenogen IVIS Kinetic imaging system and vernier caliper. Tumor volume was determined by the formula: 0.5×AxB2, where A represents the diameter of the base of the tumor and B represents the corresponding perpendicular value. When the mean diameter reach 1.2 cm or progressive tumor growth was evident, the mice were euthanasized by placing mice in sealed chambers where 5% isoflurane was introduced. Then, the tumors were collected and weighed. All experiments were ethically approved by the Animal Care and Use Committee of Xi'an Jiaotong University and performed in accordance with institutional guidelines (23).

Luciferase assays

A total of 5,000 293 cells were seeded in a 96-well plate at 70% confluence. The YAP1 wild type (WT) 3′-UTR firefly luciferase construct (pMir-YAP1 WT- 3′-UTR) was generated by inserting YAP1 WT 3′-UTR into pMir-Report vector (Ambion; Thermo Fisher Scientific, Inc.). Mutations were introduced in potential miR-590-5p binding sites using the QuikChange site-directed mutagenesis kit (Stratagene; Agilent Technologies, Inc., Santa Clara, CA, USA) according to the manufacturer's protocol. Then, a final concentration of 100 nM miR-590-5p NC or mimics were transfected into 293 cells along with 30 ng pMir-YAP1 WT or mutant 3′-UTR luciferase reporter and 10 ng Renilla luciferase reporter using Lipofectamine® 2000, as previously stated. Cells were collected 48 h post-transfection, and luciferase assays were performed using a Photinus pyralis-Renilla reniformis dual luciferase reporter assay system (Promega Corporation, Madison, WI, USA) according to the manufacturer's protocol. The ratio of Photinus pyramid to Renilla of each lysate luciferase activity was determined by an Orion II Microplate Illuminometer (Titertek-Berthold, South San Francisco, CA, USA). Relative activities were expressed as the fold change in luciferase activity.

Statistical analysis

Statistical analysis was performed using IBM SPSS statistical software (version 21.0; IBM Corp., Armonk, NY, USA). A volcano plot of established oncogenic and tumor suppressor miRNA profiles in A375 cells compared with HM controls was produced, and an adjusted P-value for each miRNA was analyzed by Bonferroni's correction. Potential targets of miR-590-5p were determined by integrating the results of multiple prediction algorithms of TargetScan [TargetScan human 7.2 (24), www.targetscan.org/], PicTar [PicTar (25), https://pictar.mdc-berlin.de/] and miRNAda [miRNAda (26), http://www.microrna.org/; search term used, miR-590-5p mammal) accessed on the 12th December 2016. The differences in characteristics between 2 groups were examined using a paired Student's t-test. The differences in characteristics between 3 groups was examined using one-way analysis of variance followed by a least significant difference-t-test to detect the differences between every 2 groups. The differences of miRNA expressions in A375 and HM cells was examined by hierarchical cluster analysis. All P-values were determined from 2-sided tests. P-value <0.05 was considered to indicate a statistically significant difference. The data were presented as the mean ± standard deviation from three independent experiments.

Results

miR-590-5p is downregulated in MM cells

To identify the miRNAs involved in the carcinogenesis and progression of MM, established oncogenic and tumor suppressor miRNA screening was detected in normal HMs and the MM cell line A375 by RT-qPCR (Table II). Hierarchical cluster analysis identified that miR-590-5p was commonly downregulated in A375 cells compared with the representative controls (Fig. 1A). A volcano plot revealed a significant difference in the expression of miR-590-5p in A375 cells compared with the controls (>4-fold change; P<0.0001; Fig. 1B). The significant downregulation of miR-590-5p was further confirmed using RT-qPCR in MM cell lines compared with HEMa-LP (P<0.05; Fig. 1C).

Figure 1.

miR-590-5p is downregulated in A375 and A2058 cells. (A) Hierarchical cluster analysis of all established oncogenic or tumor suppressor miRNAs identified through miRNA screening in A375 cells and normal HM. (B) Volcano plot of established oncogenic and tumor suppressor miRNA profiles in A375 cells compared with HM controls. The x-axis presents the Log2 FC in miRNA expression between A375 and HM, while the y-axis presents the Log10 of the adjusted P-value for each miRNA. Above the red line on y-axis indicates statistical significance. P<0.05 following Bonferroni's correction. (C) Relative expression of miR-590-5p in normal epidermal melanocytes and MM cells. Data are from three experiments and presented as the mean ± standard deviation. *P<0.05 vs. HEMa-LP cells (Student's t-test). miR/miRNA, microRNA; HM, human melanocytes; FC, fold change; MM, malignant meloma.

Table II.

Established miRNAs detected in the present study.

Table II.

Established miRNAs detected in the present study.

miRNA nameFunctionPMID
miR-590-5pTumor suppressor28433598
miR-663Oncogene28765921
miR-33aTumor suppressor28763799
miR-137Tumor suppressor28757416
miR-30aTumor suppressor28757413
miR-200cTumor suppressor28727734
miR-378Tumor suppressor28725241
miR-7Tumor suppressor28693382
miR-215Tumor suppressor28693279
miR-195Tumor suppressor28693232
miR-30a-5pTumor suppressor28672911
miR-874Tumor suppressor28670493
miR-1180Tumor suppressor28670370
miR-136Tumor suppressor28656883
miR-497Tumor suppressor28656286
miR-31Tumor suppressor28656284
miR-503Tumor suppressor28656281
miR-202Tumor suppressor28656198
miR-105-5pTumor suppressor28654905
miR-139-5pTumor suppressor28653604
miR-539Tumor suppressor28653599
miR-30dTumor suppressor28651493
miR-493Tumor suppressor28651234
miR-491Tumor suppressor28648665
miR-337Tumor suppressor28641487
miR-26aTumor suppressor28640257
miR-199a-3pTumor suppressor28639901
miR-557Tumor suppressor28639890
miR-195Tumor suppressor28639885
miR-455-3pTumor suppressor28633632
miR-187Tumor suppressor28627639
miR-320Tumor suppressor28627594
miR-101Tumor suppressor28609840
miR-193a-3pTumor suppressor28600480
miR-4728-3pTumor suppressor28594651
miR-564Tumor suppressor28588702
miR-18aTumor suppressor28588697
miR-17-5pTumor suppressor28588663
miR-186Tumor suppressor28587405
miR-148aTumor suppressor28586066
miR-497Tumor suppressor28586056
miR-1247-5pTumor suppressor28586038
miR-378Tumor suppressor28575858
miR-144-3pTumor suppressor28574724
miR-211-5pTumor suppressor28571042
miR-146a-5pTumor suppressor28560455
miR-143-3pTumor suppressor28559978
miR-1271Tumor suppressor28551819
miR-186Tumor suppressor28550686
miR-193bTumor suppressor28542597
miR-126Tumor suppressor28536606
miR-30b-5pTumor suppressor28536082
miR-15aOncogene28758198
miR-483-5pOncogene28727371
miR-210-3pOncogene28693852
miR-193a-3pOncogene28693273
miR-215Oncogene28689850
miR-1271Oncogene28682437
miR-944Oncogene28680805
miR-138Oncogene28677784
miR-492Oncogene28677719
miR-605Oncogene28673012
miR-661Oncogene28656235
miR-30e-5pOncogene28653805
miR-137Oncogene28610956
miR-96-5pOncogene28588711
miR-216aOncogene28579808
miR-142-5pOncogene28559989
miR-214Oncogene28559385
miR-141-3pOncogene28543175
miR-425-5pOncogene28537672
miR-582Oncogene28713947
miR-210-3pOncogene28693582
miR-20aOncogene28693582
miR-34aOncogene28599485
miR-146b-5pOncogene28560062
miR-126Oncogene28536606
miR-205Oncogene28476165
miR-18a-5pOncogene28471447
miR-141Oncogene28454307
miR-103Oncogene28445396
miR-556-3pOncogene28440444
miR-495Oncogene28401017
miR-221Oncogene28392366
miR-155Oncogene28338193
miR-27aOncogene28327189
miR-181Oncogene28224609
miR-844Oncogene28224609
miR-182Oncogene28122586
miR-125Oncogene28053194
miR-346Oncogene27913185
miR-19aOncogene27830963

[i] miR/miRNA, microRNA; PMID, PubMed-Indexed for MEDLINE.

Effect of miR-590-5p on the proliferation and apoptosis of MM cells

To investigate the functional role of miR-590-5p in MM cells, gain- and loss-of function experiments were performed by transfecting miR-590-5p mimics into A2058 cells and miR-590-5p inhibitors into A375 cells. CCK-8 assays revealed that the proliferation of A2058 cells transfected with miR-590-5p mimics was significantly inhibited compared with the normal control (P<0.05; Fig. 2A). Additionally, the proliferation of A375 cells transfected with miR-590p-5p inhibitors was significantly enhanced compared with the normal control (NC) cells (P<0.05; Fig. 2B). Cell apoptosis assays revealed that the percentages of early apoptotic cells significantly increased in A2058 cells transfected with miR-590-5p mimics compared with NCs (P<0.05), and decreased in A375 cells transfected with miR-590-5p inhibitors compared with NCs (P<0.05; Fig. 2C and D).

Figure 2.

Effects of miR-590-5p on the cell proliferation and apoptosis of MM cells. (A) Effect of miR-590-5p mimics on the proliferation of A2058 cells were detected by CCK-8 assays. (B) Effect of miR-590-5p inhibitors on the proliferation of A375 cells were detected by CCK-8 assays. (C) Effect of miR-590-5p on the cell apoptosis of MM cells were detected by flow cytometry using Annexin V-FITC/PI kit and (D) quantified. Data are from three experiments and presented as mean ± standard deviation. *P<0.05 vs. respective NC group. (Student's t-test). miR, microRNA; CCK-8, cell counting kit-8; NC, normal control; MM, malignant myeloma; FITC, fluorescien isothiocyanate; PI, propdium iodide.

Effects of miR-590-5p on the cell cycle and tumorigenic ability of MM cells

Flow cytometry assays were performed to determine the effects of miR-590-5p on the distribution of cells at the various stages of the cell cycle. Compared to NCs, A2058 cells transfected with miR-590-5p mimics displayed a significant increase in the percentage of cells at the G1 stage (P<0.05) and a significant decrease in the percentage of cells at the S stage (P<0.05; Fig. 3A and B). Meanwhile, the proportion of cells at the G1 stage significantly decreased and the proportion of cells at the S stage significantly increased in A375 cells transfected with miR-590-5p inhibitors compared with NCs (P<0.05; Fig. 3C).

Figure 3.

Effects of miR-590-5p on cell cycle and tumorigenic ability of malignant myeloma cells. (A) Effect of miR-590-5p on the cell cycle distribution of A2058 and A375 cells were detected using flow cytometry using PI. (B) Effect of miR-590-5p on the cell cycle distribution of A2058 cells. (C) Effect of miR-590-5p on the cell cycle distribution of A375 cells. (D) Tumor sizes were measured by a Xenogene IVIS Kinetic imaging system and vernier caliper every 7 days subsequent to the injection of A2058 pLenti-miR-590-5p-luciferase cells and A2058 pLenti-luciferase cells into the flanks of nude mice. (E) Tumor growth curve of A2058 pLenti-miR-590-5p-luciferase cells and A2058 pLenti-luciferase cells in nude mice. (F) Tumor weight of A2058 pLenti-miR-590-5p-luciferase groups and A2058 pLenti-luciferase groups at day 35. Data are from three experiments and presented as the mean ± standard deviation. *P<0.05 vs. respective NC group. (Student's t-test). miR, microRNA; PI, propidium iodide; NC, normal control.

Next, the functional roles of miR-590-5p on the tumorigenic ability of MM cells in vivo were examined. A2058 cells were engineered to stably upregulate miR-590-5p and luciferase expression and performed tumorigenesis assays in nude mice. The cells (5×106) were injected into the flanks of nude mice, and tumor sizes were measured by Xenogen IVIS Kinetic imaging systems and vernier calipers every 7 days. After 35 days, the mice were sacrificed and the tumors were collected and weighed. It was revealed that miR-590-5p exhibited substantial tumor growth-inhibitory effects as assessed by the Xenogen IVIS200 System (Fig. 3D). In addition, a significant reduction of tumor sizes (P<0.05; Fig. 3E) and tumor weight (P<0.05; Fig. 3F) was observed in the pLenti-miR-590-5p group compared with the NC group. Altogether these results indicated miR-590-5p was downregulated in MM cells and could repress cell proliferation and tumor growth in vitro and in vivo.

YAP1 is the direct target of miR-590-5p

To identify the potential targets of miR-590-5p that may contribute to its tumor growth-inhibitory effects, an unbiased computational screening was performed by integrating the results of multiple prediction algorithms (TargetScan, PicTar and miRNAda). YAP1, which contains a putative miR-590-5p target site, was selected as a potential target of miR-590-5p in MM cells. YAP1 WT 3′-UTR and Mut 3′-UTR were cloned separately into a luciferase reporter vector (Fig. 4A). Luciferase reporter assays demonstrated that 293 cells co-transfected with YAP1 WT 3′-UTR and miR-590-5p mimics revealed a >60% significant decrease in the relative luciferase activity compared with NCs (P<0.05). Conversely, 293 cells co-transfected with YAP1 Mut 3′-UTR and miR-590-5p resulted in imperceptible changes in relative luciferase activity compared with the NC (Fig. 4B).

Figure 4.

YAP1 is the direct target of miR-590-5p. (A) miR-590-5p and its putative binding sequence in the 3′-UTR of YAP1, a diagrammatic representation of the luciferase reporter plasmids with WT and MT YAP13′-UTR. (B) Relative luciferase activity in 293 cells following transfection with WT or Mut YAP13′-UTR plasmids co-transfected with miR-590-5p mimics. (C) Relative expression of YAP1 mRNA in normal epidermal melanocytes and MM cells. (D) Relative expression of YAP1 mRNA in MM cells transfected with miR-590-5p mimics or inhibitors. (E) Western blot analysis of YAP1 protein in MM cells transfected with miR-590-5p mimics or inhibitors. Data are from three experiments and presented as the mean ± standard deviation. *P<0.05 vs. respective NC group. (Student's t-test). YAP1, Yes-associated protein 1; WT, wild type; Mut, mutant; UTR, untranslated region; NC, normal control; miR, microRNA; MM, malignant myeloma.

Next. whether YAP1 expression was inversely associated with miR-590-5p in MM cells was examined. It was revealed that YAP1 expression was significantly upregulated in the two MM cell lines used compared with HEMa-LP cells (P<0.05; Fig. 4C). Furthermore, RT-qPCR and western blot results revealed that the mRNA expression levels of YAP1 were significantly decreased (P<0.05), and the protein expression of YAP1 decreased in A2058 cells transfected with miR-590-5p mimics compared with NCs. Conversely, the expression of YAP1 at the mRNA expression level was significantly upregulated (P<0.05) and YAP1 protein expression was upregulated in A375 cells transfected with miR-590-5p inhibitors (Fig. 4D and E).

YAP1 is a functional mediator of miR-590-5p in MM

To determine whether YAP1 is a functional mediator of miR-590-5p, YAP1 siRNA or NC and miR-590-5p inhibitors were transfected into A375 cells. As expected, silencing the expression of YAP1 in A375 cells transfected with miR-590-5p inhibitors attenuated the effects on cell proliferation (P<0.05; Fig. 5A). In addition, the percentages of early apoptotic cells were increased in A375 cells transfected with YAP1 siRNA and miR-590-5p inhibitors compared with A375 cells transfected with YAP1 NC and miR-590-5p inhibitors (P<0.05; Fig. 5B and C). It was also demonstrated that silencing YAP1 may rescue the effects of miR-590-5p inhibitors on the cell cycle progression of A375 cells (P<0.05; Fig. 5D and E) in addition to tumor growth (P<0.05; Fig. 5F and G).

Figure 5.

YAP1 was identified as a functional mediator of miR-590-5p in MM. (A) Silencing YAP1 counteracted the effects of miR-590-5p inhibitors on the cell proliferation of A375 cells. (B) Silencing YAP1 rescues the anti-apoptotic effects of miR590-5p inhibitors in A375 cells. (C) Quantification of (B). (D) Silencing YAP1 is able to rescue the effects of miR-590-5p inhibitors on cell cycle of A375 cells. (E) Quantification of (D). F, Silencing YAP1 may rescue the effects of miR-590-5p inhibitors on tumor growth of A375 cells. (G) Silencing YAP1 may rescue the effects of miR-590-5p inhibitors on tumor weight of A375 cells. Data are from three experiments and presented as the mean ± standard deviation. *P<0.05 vs. respective NC group (Student's t-test). YAP1, Yes-associated protein 1; MM, malignant myeloma; miR, microRNA; NC, negative control; siRNA, small interfering RNA.

Discussion

In the present study, miR-590-5p was identified to be downregulated in MM cells by screening established oncogenic and tumor suppressor miRNAs and RT-qPCR. It was confirmed that miR-590-5p overexpression is able to significantly inhibit cell proliferation and induce cell cycle arrest and apoptosis in MM cells. It was also identified that miR-590-5p may inhibit MM tumor growth in vivo. Finally, it was demonstrated that YAP1 was upregulated and inversely associated with miR-590-5p expression in MM cells and that YAP1 is the direct target and functional mediator of miR-590-5p in these cells.

Dysregulated miRNAs serve notable roles in the regulation of carcinogenesis and the progression of multiple types of cancer (10,27), including MM (11,28,29); however, the underlying mechanism is poorly understood. Depending on their different targets, certain miRNAs may function as tumor suppressors, whilst others function as oncogenes. For example, miR-21 is upregulated in primary cutaneous melanomas associated with benign nevi (30,31) and may promote cell invasion by negatively regulating tissue inhibitor of metalloprotinease-3 (32). Alternatively, miR-125b is downregulated in the sera of patients with MM and MM cells compared with healthy volunteers and human epidermal melanocytes, respectively (33–35). In the present study, it was demonstrated that miR-590-5p was downregulated in MM cells. As it was revealed that miR-590-5p inhibited proliferation and induced apoptosis and cell cycle arrest in MM cells, miR-590-5p may function as a tumor suppressor gene in MM.

Previously, it was reported that miR-590-5p was downregulated and functions as a tumor suppressor gene in various cancer types, including colorectal cancer (36,37) and breast cancer (20). Meanwhile, miR-590-5p was demonstrated to be upregulated and function as an oncogene in cervical cancer (38), clear cell renal carcinoma (39) and gastric cancer (40). In hepatocellular carcinoma, there have been conflicting reports concerning the expression and function of miR-590-5p. Shan et al (41) reported that miR-590-5p was downregulated in six hepatocellular carcinoma cell lines, inhibited cell growth, induced cell cycle G1 arrest in HepG2 cells by suppressing Wnt family member 5α, c-Myc, and cyclin D1 and increasing the phosphorylation of β-catenin and the expression of caspase-3. On the other hand, Jiang et al (42) demonstrated that miR-590-5p levels were higher in HepG2 cells compared with the normal hepatocellular cell line L-O2, and functioned as an oncogene to promote the tumor proliferation and invasion of hepatocellular carcinoma cells by directly targeting TGF-βRII. The results of the present study support the tumor suppressor role of miR-590-5p in MM in the following ways: Firstly, miR-590-5p was downregulated in MM cell lines; secondly, miR-590-5p exerted anti-tumor effects in vitro and in vivo; and third, YAP1-which was identified as an oncogene and upregulated in various types of cancer (43,44)-was confirmed as the direct target and functional mediator of miR-590-5p in MM cells.

YAP1 is the key downstream effector of Hippo pathways (45). YAP1 functions as an oncogene and modulates numerous biological phenotypes of cancer cells, including proliferation (46), invasion (47), cell cycle progression (48) and cell differentiation (49). YAP1 was identified to be overexpressed in numerous types of cancer, and is an independent prognostic predictor of cancer (50,51). In MM, YAP1-enhanced tumor progression and metastasis through interacting with the TEA domain transcription factor/TEF, PAR BZIP transcription factor family of transcription factors (52). Furthermore, the high expression of YAP1 was significantly associated with the poor outcome of patients with MM (53). Gene variants of YAP1 also proved to be independently associated with survival in patients with cutaneous melanoma (54). Consistent with these previous studies, the present study revealed that YAP1 was upregulated in MM cells. Furthermore, YAP1 was identified to be the direct target and functional mediator of miR-590-5p in MM cells.

It was previously reported miR-590-5p may inhibit the migration and invasion of cancer cells via the suppression of YAP1 expression (21). The focus of this previous study was the effects of miR-590-5p on the migration and invasion of A375 cells. Though it provided preliminarily evidence that the functions of miR-590-5p on the migration and invasion of A375 cells may be mediated by YAP1, this hypothesis was not confirmed through the use of rescue experiments. In the present study, the roles of miR-590-5p on the proliferation of A375 and A2058 cells were investigated in detail. Rescue experiments were also performed to confirm that the effect of miR-590-5p on the proliferation of MM cells was mediated by YAP1. It was revealed that silencing YAP1 is able rescue the effects of miR-590-5p inhibitors on the cell cycle and tumor growth of A375 cells. Therefore, in addition to the results of the previous study, present understanding of the role of YAP1 in the carcinogenesis and progression of MM was furthered.

In conclusion, the present study provided evidence that miR-590-5p directly inhibits YAP1 to reduce the proliferation and induce apoptosis of MM cells in vitro and is able to suppress tumor growth in vivo. Enhanced understanding of the process including cell proliferation and apoptosis that are regulated by miR-590-5p, and the identification of critical targets for miR-590-5p including YAP1, provides novel insight into the mechanism of carcinogenesis and progression in MM.

Acknowledgements

Not applicable.

Funding

The present study was supported by the Foundation of the First Affiliated Hospital of Xi'an Jiaotong University (grant no. 2016QN-06), the Fundamental Research Fund for Central Universities (grant no. xjj2018122) and the Shaanxi Nature Science Foundation (grant no. 2018JQ8027).

Avaliability of data and materials

The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.

Author contributions

LW conceived and designed the experiments. KM, MD and DH performed the experiments. XM and YZ analyzed the data. WL contributed reagents, materials and analysis tools. KM and LW wrote the manuscript.

Ethics approval and consent to participate

The experimental study was approved by the Ethics Committee of Xi'an Jiaotong University (Xi'an, China), and informed consent forms were obtained when the patients who received circumcision at the First Affiliated Hospital of Xi'an Jiaotong University were accepted for the study. All procedures performed in the study involving human foreskin specimens were in accordance with the ethical standards of the Institutional and/or National Research Committee and with the 1964 Helsinki declaration and its later amendments or comparable ethical standards. All the patients enrolled in this study provided written informed consent for the use of their excised foreskin.

Patient consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

Glossary

Abbreviations

Abbreviations:

MM

malignant melanoma

miRNA/miR

microRNA

3′-UTRs

3′-untranslated regions

HM

human melanocytes

YAP1

Yes-associated protein 1

References

1 

Coricovac D, Dehelean C, Moaca EA, Pinzaru I, Bratu T, Navolan D and Boruga O: Cutaneous melanoma-A long road from experimental models to clinical outcome: A review. Int J Mol Sci. 19:E15662018. View Article : Google Scholar : PubMed/NCBI

2 

Siegel RL, Miller KD and Jemal A: Cancer statistics, 2017. CA Cancer J Clin. 67:7–30. 2017. View Article : Google Scholar : PubMed/NCBI

3 

Balch CM, Gershenwald JE, Soong SJ, Thompson JF, Atkins MB, Byrd DR, Buzaid AC, Cochran AJ, Coit DG, Ding S, et al: Final version of 2009 AJCC melanoma staging and classification. J Clin Oncol. 27:6199–6206. 2009. View Article : Google Scholar : PubMed/NCBI

4 

Roukos DH: PLX4032 and melanoma: Resistance, expectations and uncertainty. Expert Rev Anticancer Ther. 11:325–328. 2011. View Article : Google Scholar : PubMed/NCBI

5 

Tsai J, Lee JT, Wang W, Zhang J, Cho H, Mamo S, Bremer R, Gillette S, Kong J, Haass NK, et al: Discovery of a selective inhibitor of oncogenic B-Raf kinase with potent antimelanoma activity. Proc Natl Acad Sci USA. 105:3041–3046. 2008. View Article : Google Scholar : PubMed/NCBI

6 

Eggermont AM, Spatz A and Robert C: Cutaneous melanoma. Lancet. 383:816–827. 2014. View Article : Google Scholar : PubMed/NCBI

7 

Adams BD, Parsons C, Walker L, Zhang WC and Slack FJ: Targeting noncoding RNAs in disease. J Clin Invest. 127:761–771. 2017. View Article : Google Scholar : PubMed/NCBI

8 

Moreno-Moya JM, Vilella F and Simón C: MicroRNA: Key gene expression regulators. Fertil Steril. 101:1516–1523. 2014. View Article : Google Scholar : PubMed/NCBI

9 

Su Z, Yang Z, Xu Y, Chen Y and Yu Q: MicroRNAs in apoptosis, autophagy and necroptosis. Oncotarget. 6:8474–8490. 2015. View Article : Google Scholar : PubMed/NCBI

10 

Zhou K, Liu M and Cao Y: New insight into microRNA functions in cancer: Oncogene-microRNA-tumor suppressor gene network. Front Mol Biosci. 4:462017. View Article : Google Scholar : PubMed/NCBI

11 

Wozniak M, Mielczarek A and Czyz M: miRNAs in melanoma: Tumor suppressors and oncogenes with prognostic potential. Curr Med Chem. 23:3136–3153. 2016. View Article : Google Scholar : PubMed/NCBI

12 

Wang Z, Zheng C, Jiang K, He J, Cao X and Wu S: MicroRNA-503 suppresses cell proliferation and invasion in osteosarcoma via targeting insulin-like growth factor 1 receptor. Exp Ther Med. 14:1547–1553. 2017. View Article : Google Scholar : PubMed/NCBI

13 

Xu L, Xu Q, Li X and Zhang X: MicroRNA-21 regulates the proliferation and apoptosis of cervical cancer cells via tumor necrosis factor-α. Mol Med Rep. 16:4659–4663. 2017. View Article : Google Scholar : PubMed/NCBI

14 

Markopoulos GS, Roupakia E, Tokamani M, Vartholomatos G, Tzavaras T, Hatziapostolou M, Fackelmayer FO, Sandaltzopoulos R, Polytarchou C and Kolettas E: Senescence-associated microRNAs target cell cycle regulatory genes in normal human lung fibroblasts. Exp Gerontol. 96:110–122. 2017. View Article : Google Scholar : PubMed/NCBI

15 

Qin W, Rong X, Dong J, Yu C and Yang J: miR-142 inhibits the migration and invasion of glioma by targeting Rac1. Oncol Rep. 38:1543–1550. 2017. View Article : Google Scholar : PubMed/NCBI

16 

Guo W, Wang H, Yang Y, Guo S, Zhang W, Liu Y, Yi X, Ma J, Zhao T, Liu L, et al: Down-regulated miR-23a contributes to the metastasis of cutaneous melanoma by promoting autophagy. Theranostics. 7:2231–2249. 2017. View Article : Google Scholar : PubMed/NCBI

17 

Bai M, Zhang M, Long F, Yu N, Zeng A and Zhao R: Circulating microRNA-194 regulates human melanoma cells via PI3K/AKT/FoxO3a and p53/p21 signaling pathway. Oncol Rep. 37:2702–2710. 2017. View Article : Google Scholar : PubMed/NCBI

18 

Guo S, Guo W, Li S, Dai W, Zhang N, Zhao T, Wang H, Ma J, Yi X, Ge R, et al: Serum miR-16: A potential biomarker for predicting melanoma prognosis. J Invest Dermatol. 136:985–993. 2016. View Article : Google Scholar : PubMed/NCBI

19 

Yang X and Wu X: miRNA expression profile of vulvar squamous cell carcinoma and identification of the oncogenic role of miR-590-5p. Oncol Rep. 35:398–408. 2016. View Article : Google Scholar : PubMed/NCBI

20 

Zhou L, Zhao LC, Jiang N, Wang XL, Zhou XN, Luo XL and Ren J: MicroRNA miR-590-5p inhibits breast cancer cell stemness and metastasis by targeting SOX2. Eur Rev Med Pharmacol Sci. 21:87–94. 2017.PubMed/NCBI

21 

Wang L, Shi S, Zhou Y, Mu X, Han D, Ge R and Mu K: miR-590-5p inhibits A375 cell invasion and migration in malignant melanoma by directly inhibiting YAP1 expression. Xi Bao Yu Fen Zi Mian Yi Xue Za Zhi. 33:326–330. 2017.(In Chinese). PubMed/NCBI

22 

Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods. 25:402–408. 2001. View Article : Google Scholar : PubMed/NCBI

23 

Workman P, Aboagye EO, Balkwill F, Balmain A, Bruder G, Chaplin DJ, Double JA, Everitt J, Farningham DA, Glennie MJ, et al: Guidelines for the welfare and use of animals in cancer research. Br J Cancer. 102:1555–1577. 2010. View Article : Google Scholar : PubMed/NCBI

24 

Agarwal V, Bell GW, Nam JW and Bartel DP: Predicting effective microRNA target sites in mammalian mRNAs. Elife. 2015. View Article : Google Scholar

25 

Chen K and Rajewsky N: Natural selection on human microRNA binding sites inferred from SNP data. Nat Genet. 38:1452–1456. 2006. View Article : Google Scholar : PubMed/NCBI

26 

Enright AJ, John B, Gaul U, Tuschl T, Sander C and Marks DS: MicroRNA targets in Drosophila. Genome Biol. 5:R12003. View Article : Google Scholar : PubMed/NCBI

27 

Legras A, Pécuchet N, Imbeaud S, Pallier K, Didelot A, Roussel H, Gibault L, Fabre E, Le Pimpec-Barthes F, Laurent-Puig P and Blons H: Epithelial-to-mesenchymal transition and MicroRNAs in lung cancer. Cancers. 9:E1012017. View Article : Google Scholar : PubMed/NCBI

28 

Varamo C, Occelli M, Vivenza D, Merlano M and Nigro Lo C: MicroRNAs role as potential biomarkers and key regulators in melanoma. Genes Chromosomes Cancer. 56:3–10. 2017. View Article : Google Scholar : PubMed/NCBI

29 

Deng Z, Hao J, Lei D, He Y, Lu L and He L: Pivotal MicroRNAs in melanoma: A mini-review. Mol Diagn Ther. 20:449–455. 2016. View Article : Google Scholar : PubMed/NCBI

30 

Grignol V, Fairchild ET, Zimmerer JM, Lesinski GB, Walker MJ, Magro CM, Kacher JE, Karpa VI, Clark J, Nuovo G, et al: miR-21 and miR-155 are associated with mitotic activity and lesion depth of borderline melanocytic lesions. Br J Cancer. 105:1023–1029. 2011. View Article : Google Scholar : PubMed/NCBI

31 

Satzger I, Mattern A, Kuettler U, Weinspach D, Niebuhr M, Kapp A and Gutzmer R: microRNA-21 is upregulated in malignant melanoma and influences apoptosis of melanocytic cells. Exp Dermatol. 21:509–514. 2012. View Article : Google Scholar : PubMed/NCBI

32 

del Campo Martin SE, Latchana N, Levine KM, Grignol VP, Fairchild ET, Jaime-Ramirez AC, Dao TV, Karpa VI, Carson M, Ganju A, et al: MiR-21 enhances melanoma invasiveness via inhibition of tissue inhibitor of metalloproteinases 3 expression: In vivo effects of MiR-21 inhibitor. PloS One. 10:e01159192015. View Article : Google Scholar : PubMed/NCBI

33 

Zhang J, Lu L, Xiong Y, Qin W, Zhang Y, Qian Y, Jiang H and Liu W: MLK3 promotes melanoma proliferation and invasion and is a target of microRNA-125b. Clin Exp Dermatol. 39:376–384. 2014. View Article : Google Scholar : PubMed/NCBI

34 

Kappelmann M, Kuphal S, Meister G, Vardimon L and Bosserhoff AK: MicroRNA miR-125b controls melanoma progression by direct regulation of c-Jun protein expression. Oncogene. 32:2984–2991. 2013. View Article : Google Scholar : PubMed/NCBI

35 

Alegre E, Sanmamed MF, Rodriguez C, Carranza O, Martin-Algarra S and Gonzalez A: Study of circulating microRNA-125b levels in serum exosomes in advanced melanoma. Arch Pathol Lab Med. 138:828–832. 2014. View Article : Google Scholar : PubMed/NCBI

36 

Ou C, Sun Z, Li X, Li X, Ren W, Qin Z, Zhang X, Yuan W, Wang J, Yu W, et al: MiR-590-5p, a density-sensitive microRNA, inhibits tumorigenesis by targeting YAP1 in colorectal cancer. Cancer Lett. 399:53–63. 2017. View Article : Google Scholar : PubMed/NCBI

37 

Zhou Q, Zhu Y, Wei X, Zhou J, Chang L, Sui H, Han Y, Piao D, Sha R and Bai Y: MiR-590-5p inhibits colorectal cancer angiogenesis and metastasis by regulating nuclear factor 90/vascular endothelial growth factor A axis. Cell Death Dis. 7:e24132016. View Article : Google Scholar : PubMed/NCBI

38 

Chu Y, Ouyang Y, Wang F, Zheng A, Bai L, Han L, Chen Y and Wang H: MicroRNA-590 promotes cervical cancer cell growth and invasion by targeting CHL1. J Cell Biochem. 115:847–853. 2014. View Article : Google Scholar : PubMed/NCBI

39 

Xiao X, Tang C, Xiao S, Fu C and Yu P: Enhancement of proliferation and invasion by MicroRNA-590-5p via targeting PBRM1 in clear cell renal carcinoma cells. Oncol Res. 20:537–544. 2013. View Article : Google Scholar : PubMed/NCBI

40 

Shen B, Yu S, Zhang Y, Yuan Y, Li X, Zhong J and Feng J: miR-590-5p regulates gastric cancer cell growth and chemosensitivity through RECK and the AKT/ERK pathway. Onco Targets Ther. 9:6009–6019. 2016. View Article : Google Scholar : PubMed/NCBI

41 

Shan X, Miao Y, Fan R, Qian H, Chen P, Liu H, Yan X, Li J and Zhou F: MiR-590-5P inhibits growth of HepG2 cells via decrease of S100A10 expression and inhibition of the Wnt pathway. Int J Mol Sci. 14:8556–8569. 2013. View Article : Google Scholar : PubMed/NCBI

42 

Jiang X, Xiang G, Wang Y, Zhang L, Yang X, Cao L, Peng H, Xue P and Chen D: MicroRNA-590-5p regulates proliferation and invasion in human hepatocellular carcinoma cells by targeting TGF-β RII. Mol Cells. 33:545–551. 2012. View Article : Google Scholar : PubMed/NCBI

43 

Zanconato F, Cordenonsi M and Piccolo S: YAP/TAZ at the Roots of Cancer. Cancer Cell. 29:783–803. 2016. View Article : Google Scholar : PubMed/NCBI

44 

Zanconato F, Battilana G, Cordenonsi M and Piccolo S: YAP/TAZ as therapeutic targets in cancer. Curr Opin Pharmacol. 29:26–33. 2016. View Article : Google Scholar : PubMed/NCBI

45 

Shibata M, Ham K and Hoque MO: A time for YAP1: Tumorigenesis, immunosuppression and targeted therapy. Int J Cancer. Apr 26–2018.(Epub ahead of print). doi: 10.1002/ijc.31561. View Article : Google Scholar

46 

Seo WI, Park S, Gwak J, Ju BG, Chung JI, Kang PM and Oh S: Wnt signaling promotes androgen-independent prostate cancer cell proliferation through up-regulation of the hippo pathway effector YAP. Biochem Biophys Res Commun. 486:1034–1039. 2017. View Article : Google Scholar : PubMed/NCBI

47 

Lee HJ, Diaz MF, Price KM, Ozuna JA, Zhang S, Sevick-Muraca EM, Hagan JP and Wenzel PL: Fluid shear stress activates YAP1 to promote cancer cell motility. Nat Commun. 8:141222017. View Article : Google Scholar : PubMed/NCBI

48 

Strnadel J, Choi S, Fujimura K, Wang H, Zhang W, Wyse M, Wright T, Gross E, Peinado C, Park HW, et al: eIF5A-PEAK1 signaling regulates YAP1/TAZ protein expression and pancreatic cancer cell growth. Cancer Res. 77:1997–2007. 2017. View Article : Google Scholar : PubMed/NCBI

49 

Fan Y, Gao Y, Rao J, Wang K, Zhang F and Zhang C: YAP-1 promotes tregs differentiation in hepatocellular carcinoma by enhancing TGFBR2 transcription. Cell Physiol Biochem. 41:1189–1198. 2017. View Article : Google Scholar : PubMed/NCBI

50 

Lee K, Lee KB, Jung HY, Yi NJ, Lee KW, Suh KS and Jang JJ: The correlation between poor prognosis and increased yes-associated protein 1 expression in keratin 19 expressing hepatocellular carcinomas and cholangiocarcinomas. BMC Cancer. 17:4412017. View Article : Google Scholar : PubMed/NCBI

51 

Hu X, Chen J and Fu Q: Downregulation of YAP in clear cell renal cell carcinoma contributes to poor prognosis and progressive features. Ann Clin Lab Sci. 47:36–39. 2017.PubMed/NCBI

52 

Lamar JM, Stern P, Liu H, Schindler JW, Jiang ZG and Hynes RO: The Hippo pathway target, YAP, promotes metastasis through its TEAD-interaction domain. Proc Natl Acad Sci USA. 109:E2441–E2450. 2012. View Article : Google Scholar : PubMed/NCBI

53 

Menzel M, Meckbach D, Weide B, Toussaint NC, Schilbach K, Noor S, Eigentler T, Ikenberg K, Busch C, Quintanilla-Martinez L, et al: In melanoma, Hippo signaling is affected by copy number alterations and YAP1 overexpression impairs patient survival. Pigment Cell Melanoma Res. 27:671–673. 2014. View Article : Google Scholar : PubMed/NCBI

54 

Yuan H, Liu H, Liu Z, Zhu D, Amos CI, Fang S, Lee JE and Wei Q: Genetic variants in Hippo pathway genes YAP1, TEAD1 and TEAD4 are associated with melanoma-specific survival. Int J Cancer. 137:638–645. 2015. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Mou K, Ding M, Han D, Zhou Y, Mu X, Liu W and Wang L: miR‑590‑5p inhibits tumor growth in malignant melanoma by suppressing YAP1 expression. Oncol Rep 40: 2056-2066, 2018.
APA
Mou, K., Ding, M., Han, D., Zhou, Y., Mu, X., Liu, W., & Wang, L. (2018). miR‑590‑5p inhibits tumor growth in malignant melanoma by suppressing YAP1 expression. Oncology Reports, 40, 2056-2066. https://doi.org/10.3892/or.2018.6633
MLA
Mou, K., Ding, M., Han, D., Zhou, Y., Mu, X., Liu, W., Wang, L."miR‑590‑5p inhibits tumor growth in malignant melanoma by suppressing YAP1 expression". Oncology Reports 40.4 (2018): 2056-2066.
Chicago
Mou, K., Ding, M., Han, D., Zhou, Y., Mu, X., Liu, W., Wang, L."miR‑590‑5p inhibits tumor growth in malignant melanoma by suppressing YAP1 expression". Oncology Reports 40, no. 4 (2018): 2056-2066. https://doi.org/10.3892/or.2018.6633
Copy and paste a formatted citation
x
Spandidos Publications style
Mou K, Ding M, Han D, Zhou Y, Mu X, Liu W and Wang L: miR‑590‑5p inhibits tumor growth in malignant melanoma by suppressing YAP1 expression. Oncol Rep 40: 2056-2066, 2018.
APA
Mou, K., Ding, M., Han, D., Zhou, Y., Mu, X., Liu, W., & Wang, L. (2018). miR‑590‑5p inhibits tumor growth in malignant melanoma by suppressing YAP1 expression. Oncology Reports, 40, 2056-2066. https://doi.org/10.3892/or.2018.6633
MLA
Mou, K., Ding, M., Han, D., Zhou, Y., Mu, X., Liu, W., Wang, L."miR‑590‑5p inhibits tumor growth in malignant melanoma by suppressing YAP1 expression". Oncology Reports 40.4 (2018): 2056-2066.
Chicago
Mou, K., Ding, M., Han, D., Zhou, Y., Mu, X., Liu, W., Wang, L."miR‑590‑5p inhibits tumor growth in malignant melanoma by suppressing YAP1 expression". Oncology Reports 40, no. 4 (2018): 2056-2066. https://doi.org/10.3892/or.2018.6633
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team