International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.
International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.
Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.
Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.
Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.
Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.
Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.
International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.
Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.
Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.
Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.
An International Open Access Journal Devoted to General Medicine.
Prostate cancer is the most commonly diagnosed cancer in males and is also the leading cause of cancer-associated mortality among males (1,2). Even though remarkable progress has been made in the treatment of prostate cancer, most patients are diagnosed with middle- or late-stage disease, which leads to disease progression and a poor prognosis (3). Currently, androgen-deprivation therapy is widely used in the treatment of prostate cancer (4–6); however, many patients develop drug resistance which contributes to a high male mortality rate. Therefore, there is an urgent need to identify novel regulators involved in modulating the progression of prostate cancer and to design more effective therapeutic strategies.
Long non-coding RNAs (lncRNAs) are a class of RNAs processing more than 200 nucleotides without protein-coding capacity (7). Increasing evidence suggests that lncRNAs play important roles in a variety of biological processes via diverse mechanisms, including chromatin regulation, alternative splicing and epigenetic control (8–10). Notably, previous studies have uncovered that lncRNAs act as competing endogenous RNA (ceRNAs) to sponge the function of microRNAs (miRNAs) (11,12). miRNAs are characterized as a group of small (~18–22 nt), single-stranded, non-coding RNAs (13,14). It is well documented that miRNAs negatively regulate the gene expression via binding the 3′-untranslated region (3′-UTR) of target mRNAs, which results in the degradation or translation inhibition of mRNAs (15,16). As important regulators of gene expression, both lncRNAs and miRNAs are widely involved in tumorigenesis (17–19). For example, lncRNA PVT1 was found to function as a ceRNA to regulate the expression of HIF1α via sponging miR-186 in gastric cancer (20). In prostate cancer, lncRNA HOTTIP was found to promote the proliferation and migration of prostate caner cells via sponging miR-216a-5p (21). Additionally, lncRNA RNCR3 was demonstrated to enhance the progression of prostate cancer by targeting miR-185-5p (22). These results highlight the critical roles of lncRNAs in regulating the growth of cancer cells by acting as ceRNAs.
lncRNA histocompatibility leukocyte antigen (HLA) complex P5 (HCP5) is primarily detected in immune cells, including spleen, blood and thymus (23). In addition to its function in autoimmunity, aberrant expression of HCP5 has been found in human cancers (24). A recent study reported that HCP5 is upregulated in glioma tissues (25). HCP5 was found to modulate the proliferation, migration and invasion of glioma cells via binding to miR-139 and to increase the expression of Runt1 (25). Additionally, HCP5 was found to promote the progression of cervical cancer by regulating MACC1 by suppressing miR-15a (24). The HCP5 region was also identified as the susceptibility locus for HCV-related hepatocellular carcinoma (26). However, the function of HCP5 in prostate cancer remains uncharacterized.
In the present study, HCP5 was found to be highly expressed in prostate cancer. Mechanistically, HCP5 was found to promote the proliferation of prostate cancer cells via sponging miR-4656 to upregulate the expression of CEMIP. Our results provide novel insight into clarifying the critical function of HCP5 in regulating the progression of prostate cancer.
Fifty paired prostate cancer tissues and corresponding normal tissues were collected from patients (47–78 years of age) who were diagnosed with prostate cancer and underwent surgery at The People's Hospital of Hanchuan City from August 2012 to May 2014. The samples were reviewed by three pathologists independently. None of the patients were administered local or systemic treatment prior to surgery. Informed consent was provided by all of the enrolled patients, and the study was approved by the Ethics Committee of The People's Hospital of Hanchuan City (accession no. LL2017014).
The prostate cancer cell lines PC3, Du145, PPC-1 and C4-2 were purchased from the Institute of Biochemistry (Shanghai, China). The PPC-1 cell line was authenticated with the STR profile. Cells were cultured in RPMI-1640 medium (Gibco; Thermo Fisher Scientific, Inc.) supplemented with 10% fetal bovine serum (FBS; Gibco; Thermo Fisher Scientific, Inc.), 100 mg/ml streptomycin and 200 U/ml penicillin. The nontumorigenic human prostate epithelial cell line 9 (NHP9) was maintained in PrEBM medium (Clonetics) containing insulin, hydrocortisone, epidermal growth factor and bovine pituitary extract. Cells were maintained in an incubator at 37°C with 5% CO2. For the overexpression of HCP5, the full-length of HCP5 was constructed into the pcDNA vector. miR-4656 mimics (UGGGCUGAGGGCAGGAGGCCUGU; HMI1647) and control-miRNA (GGUUCGUACGUACACUGUUCA; HMC0002) (both from Sigma-Aldrich; Merck KGaA) were transfected (10,000 cells) at the concentration of 25 µM with Lipofectamine 2000 (Invitrogen; Thermo Fisher Scientific, Inc.) for 15 min at room temperature (RT). After transfection for 48 h, the cells were harvested for further analysis. shRNA-HCP5 (0.5 µg) (CCGGGATCTATTACCTGTGCCTGGACTCGAGTCCAGGCACAGGTAATAGATCTTTTTTG; SHCNV-NM_006674; Sigma-Aldrich; Merck KGaA) or control-shRNA (CCTAAGGTTAAGTCGCCCTCGCTCGAGCGAGGGCGACTTAACCTTAGG; #1864, Addgene, USA) were transfected into cells (10,000) with Lipofectamine 2000 for 48 h.
Total RNA from the tissue samples or cells was isolated using Trizol reagent (Takara, Dalian, China). RNA (1 µg) from each sample was used to synthesize the cDNA using the PrimeScript RT Master Mix (Takara, Dalian, China). Quantitative PCR was performed to detect the expression of HCP5 with the One-step SYBR PrimeScript RT-PCR kit (Takara) on the Applied Biosystem 7900 Fast Real-Time PCR System (Thermo Fisher Scientific, Inc.). The level of HCP5 was normalized to that of GAPDH. Primers used in this assay were listed as below: HCP5, forward, 5′-CCGCTGGTCTCTGGACACATACT-3′ and reverse, 5′-CTCACCTGTCGTGGGATTTTGC-3′; GAPDH, forward, 5′-GTCGGTGTGAACGGATTTG-3′ and reverse, 5′-AAGATGGTGATGGGCTTCC-3′. The PCR protocol was set as 95°C for 10 min; 40 cycles at 95°C for 10 sec and 60°C for 1 min. Relative gene expression of HCP5 was calculated using the 2−ΔΔCq method (27).
Prostate cancer cells transfected with the corresponding expression vector were harvested and lysed with RIPA buffer (Beyotime, Shanghai, China). Samples were certificated at 10,000 × g for 10 min at 4°C. The supernatant was collected and the protein concentration was quantified with the BCA kit (Bio-Rad). Protein (20 µg) was separately by 15% SDS-PAGE and then transferred onto PVDF membranes (EMD Millipore). After blocking with 5% nonfat milk, the membranes were incubated with the primary antibody against CEMIP (1:2,000 dilution; XY2112901; XYbscience, Shanghai, China), GAPDH (1:3,000 dilution; ab9485; Abcam, Shanghai, China), Snail (1:1,000 dilution; ab229701; Abcam, Shanghai, China), VEGF (1:1,000 dilution; AV202; Beyotime, Shanghai, China), E-cadherin (1:5,000 dilution; 20874-1-AP; Proteintech Group, Wuhan, China) overnight at 4°C, followed by HRP-conjugated secondary antibody [rabbit anti-mouse IgG H&L (HRP), 1:5,000 dilution; ab6728; Abcam; Shanghai, China; Goat anti-Rabbit IgG H&L (HRP), 1:5,000 dilution; ab6721; Abcam; Shanghai, China] for 2 h at RT. The protein signal was visualized with enhanced chemiluminescence reagent (Bio-Rad).
Cell proliferation was measured with the CCK-8 assay (Dojindo, Tokyo, China) according to the manufacturer's instructions. Briefly, cells transfected with the corresponding expression vector were seeded in a 96-well plate in triplicate at the density of 1,000 cells per well. CCK-8 reagent (10 µl) was added into the cells at the time point of 1, 2, 3, 4 and 5 days and incubated at 37°C for a further 3 h. The absorbance of each well at 450 nm was measured using a microplate reader (Bio-Rad, IQ, USA).
The binding between HCP5 and miR-4656 was predicted with the RNA22 version 2.0 (https://cm.jefferson.edu/rna22). The targets of miR-4656 were predicted using the miRDB database (28).
To detect the binding between HCP5 and miR-4656, the wild-type (WT) or mutant (Mut) HCP5 sequences harboring the predicted binding site of miR-4656 were constructed into the pGL3 reporter vector (Promega). Similarly, to examine the binding for miR-4656 and CEMIP, the WT or Mut 3′-UTR of CEMIP was inserted into the pGL3 reporter vector. Cells cultured in a 96-well plate were transfected with the indicated expressing vectors with Lipofectamine 2000. After transfection for 48 h, cells were harvested and the luciferase activity was measured using the Dual-Luciferase Reporter Assay Kit (Promega) according to the manufacturer's instructions. The assay was performed in triplicate.
PC-3 and PPC-1 cells were transfected with shRNA-control or shRNA-HCP5 for 48 h. The percentage of apoptotic cells was determined using the Annexin V- fluorescein-5-isothiocyanate (FITC) Apoptosis Detection kit (Invitrogen; Thermo Fisher Scientific, Inc.) according to the manufacturer's instructions. Cells were collected and washed twice with pre-cold PBS. The cell pellets were resuspended with Annexin V binding buffer. Cell resuspension (100 µl) (~10,000 cells) was used and stained with FITC-Annexin V and propidium iodide for 15 min at RT in darkness. The cell apoptosis rate was analyzed with the Becton Dickinson FACScan instrument (BD Pharmingen™, USA).
Both PC3 and PPC-1 cells (1×106) harboring the lentivirus vector of the shRNA-control or shRNA-HCP5 were injected subcutaneously into the flank of nude mice (BALB/c, 5–6 weeks of age, female, 23–26 g; N=6 per group) and left to grow for three weeks. All mice were maintained in a specific pathogen-free (SPF) barrier condition with controlled temperature (25±2°C), relative humidity (60±5%), and 12-h light/dark cycle with free access to food and water. The tumor size was measured every three days according to the ethical IACUC guidelines. After that, mice were sacrificed by cervical dislocation and the tumor weight was measured. This experiment was approved by the Animal Research Ethics Committee of The People's Hospital of Hanchuan City. All animals were handled following the ‘Guide for the Care and Use of Laboratory Animals’ and the ‘Principles for the Utilization and Care of Vertebrate Animals’ (29).
Data are presented as mean ± standard deviation (SD) and were analyzed with SPSS 13.0 (SPSS, Inc.). The comparison between two groups was analyzed by the Student's t-test. Comparisons among multiple groups were analyzed with ANOVA followed by a post hoc test. Spearman's rank-order correlation was applied to the correlation analysis. The r-value indicates the strength and direction of the correlation between the two variables. P<0.05 was considered as indicative of a statistically significant difference.
To validate the expression of HCP5 in prostate cancer, the level of HCP5 was analyzed in paired prostate cancer tissues and non-tumor tissues by RT-qPCR. The result showed that HCP5 was significantly upregulated in prostate cancer tissues compared to that noted in the adjacent normal tissues (Fig. 1A). Notably, increased expression of HCP5 was positively correlated with the metastasis of prostate cancer patients (Fig. 1B). The result showed that HCP overexpression was linked to relative poor progression of prostate cancer patients. To support these data, the expression of HCP5 in prostate cancer cell lines including PC3, Du145, PPC-1 and C4-2 and normal control cell line NHP9 was detected. As presented in Fig. 1C, overexpression of HCP was observed in all the prostate cancer cell lines when compared with the expression noted in the normal cells. These results demonstrate the high expression of HCP5 in prostate cancer.
To investigate the effect of HCP5 on the growth of prostate cancer cells, HCP5 was downregulated by transfection of shRNA-HCP5 into PPC-1 and PC3 cells. RT-qPCR assay was performed to confirm the knockdown efficiency, which showed that HCP5 expression was significantly reduced after the transfection of shRNA-HCP5 (Fig. 2A). The influence of HCP5 silencing on the growth of prostate cancer cells was evaluated with the CCK-8 assay. As indicated in Fig. 2B and C, the OD values were significantly decreased with the depletion of HCP5 in both PPC-1 and PC3 cell lines, demonstrating that knockdown of HCP5 inhibited prostate cancer cell proliferation. Consistently, the apoptotic rate (early and late apoptosis) of both PPC-1 and PC3 cell lines was significantly increased with the downregulation of HCP5 in comparison with that of the control group (Fig. 2D). Moreover, the colony formation assay was performed to evaluate the effect of HCP5 on the growth of prostate cancer cells. As presented in Fig. 2E, silencing of HCP5 significantly suppressed the colony formation ability of the PPC-1 and PC3 cells. To further confirm the suppression of growth of prostate cancer tissues with downregulation of HCP5, an in vivo xenograft mouse model was established by injecting PC3 or PPC-1 cells harboring shRNA-control or shRNA-HCP5 into the flank of nude mice. The tumor weight was measured after three weeks and the result showed that depletion of HCP5 significantly decreased the tumor formation (Fig. 2F). Consistently, the tumor diameter and volumes were also decreased upon the silencing of HCP5 (Table SI). These results indicated that the downregulation of HCP5 suppressed the tumorigenesis of prostate cancer.
Mounting evidence suggests that lncRNAs act as competing endogenous RNA to modulate the expression of miRNAs. To further understand the function of HCP5 in regulating the growth of prostate cancer cells, the putative binding partners of HCP5 were predicted. We found that there was a complementary binding sequence to the miR-4656 seed region in HCP5 (Fig. 3A). To confirm whether HCP5 binds to miR-4656, luciferase reporter assay was performed by transfecting the luciferase vector harboring the wild-type (WT) or mutant (Mut) sequence of HCP5, which was the seeding region of miR-4656. The results showed that overexpression of miR-4656 significantly reduced the luciferase reporter activity of WT but not mutant HCP5 (Fig. 3B and C). This observation suggested the interaction between HCP5 and miR-4656 in prostate cancer cells.
To ascertain whether the binding of HCP5 to miR4656 affects the stability of miR-4656, PPC-1 and PC3 cells were transfected with control lncRNA or HCP5 and the level of miR-4656 was detected using the RT-qPCR assay. The data showed that ectopic expression of HCP5 significantly reduced the level of miR-4656 in both PPC-1 and PC3 cell lines (Fig. 3D). In contrast, downregulation of HCP5 promoted the expression of miR-4656 (Fig. 3E). Supporting this observation, the expression of miR-4656 was significantly lower in prostate cancer tissues in comparison with that noted in the normal tissues (Fig. 3F), and expression of miR-4656 was inversely correlated with the level of HCP5 (Fig. 3G). These results indicate that HCP5 acts as the sponge of miR-4656 and reduced the expression of miR-4656 in prostate cancer cells.
To detect the effect of miR-4656 on the growth of prostate cancer cells, both PC-3 and PPC-1 cell lines were transfected with miRNA control or miR-4656 mimic to upregulate the expression of miR-4656 (Fig. 4A). The CCK-8 assay showed that overexpression of miR-4656 significantly decreased the proliferation of both PC-3 and PPC-1 cell lines (Fig. 4B and C). To further understand the molecular mechanisms by which miR-4656 regulates the proliferation of prostate cancer cells, the possible targets of miR-4656 were predicted using the miRDB database. The prediction revealed that CEMIP is a potential binding candidate of miR-4656 (Fig. 4D). Increasing evidence has demonstrated the oncogenic function of CEMIP in promoting tumorigenesis by modulating cancer-related signaling pathways (30–33). The overexpression of CEMIP in tumors provides a novel target for individualized therapy (34). However, the involvement of CEMIP in the malignancy of prostate cancer has not been fully understood. There were three target sites of miR-4656 in the 3′-UTR of CEMIP that were predicted and the first one (seed location 121) was examined for further analysis. To confirm this, luciferase reporter assay was performed by constructing the WT or mutant 3′-UTR which contained the binding sites of miR-4656 into the luciferase reporter vector. The results showed that overexpression of miR-4656 significantly reduced the WT but not the mutant 3′-UTR luciferase activity (Fig. 4E and F). RT-qPCR assay showed that high expression of miR-4656 decreased both the mRNA and protein levels of CEMIP in the PPC-1 and PC3 cell lines (Fig. 4G and H). To check the co-expression of HCP5/miR-4656/CEMIP, cells were transfected with HCP-5 or shRNA-HCP5. The results showed that depletion of HCP5 significantly upregulated the level of miR-4656 and decreased the expression of CEMIP (Fig. 4I). Consistently, overexpression of HCP5 significantly suppressed miR-4656 and increased the abundance of CEMIP (Fig. 4J). Our results identified CEMIP as a target of the HCP5/miR-4656 axis in prostate cancer cells.
To determine whether HCP5 regulates CEMIP via suppression of miR-4656, miR-4656 was overexpressed and the expression of CEMIP was detected. The data showed that rescue of miR-4656 reversed the upregulation of CEMIP by HCP5 (Fig. 5A). To further support the correlation between HCP5 and CEMIP, the mRNA level of CEMIP in paired prostate cancer tissues and adjacent normal tissues was compared via RT-qPCR. The data revealed significantly increased expression of CEMIP in the prostate cancer tissues (Fig. 5B). Meanwhile, the correlation between the abundance of HCP5 and CEMIP was analyzed by Spearman test. As indicated in Fig. 5C, the expression of CEMIP was positively correlated with that of HCP5 in prostate cancer tissues. To verify whether CEMIP mediates the function of HCP5 in prostate cancer, CEMIP was downregulated and HCP5 was overexpressed in both PC-3 and PPC-1 cell lines (Fig. 5D). The CCK-8 assay showed that knockdown of CEMIP reduced the HCP5-promoted proliferation of PC-3 and PPC-1 cells (Fig. 5E and F). These data indicate that CEMIP is regulated by HCP5 and modulates the growth of prostate cancer cells. Increasing studies have demonstrated that CEMIP orchestrates tumorigenesis via regulating Wnt/β-catenin signaling (33). To further demonstrate the functional mechanism of CEMIP in prostate cancer, we evaluated the expression of several targets of the Wnt/β-catenin pathway including Snail, E-cadherin, and VEGF. The results showed that overexpression of HCP5 upregulated Snail and VEGF, and inhibited the level of E-cadherin in both PC3 and PPC1 cell lines (Fig. 5G). These data provide the possible mechanism underlying the regulatory function of CEMIP in prostate cancer.
Accumulating evidence indicates the important roles of long noncoding RNAs (lncRNAs) in the initiation and development of human cancers (9,35). Considering the high occurrence of prostate cancer in the male population and the high mortality rate of prostate cancer patients, understanding the molecular mechanism of lncRNAs in regulating the growth of prostate cancer cells may provide new therapeutic strategies for the treatment of prostate cancer. In the present study, we identified that lncRNA histocompatibility leukocyte antigen (HLA) complex P5 (HCP5) is overexpressed in prostate cancer tissues and cell lines. Mechanistically, HCP5 was found to promote the proliferation of prostate cancer cells via sponging miR-4656 to upregulate the expression of CEMIP.
HCP5 is located on chromosome 6p21.3, and the function of HCP5 is not fully understood (36). A recent study demonstrated that HCP5 is overexpressed in glioma tissues and is positively correlated with the histopathological grade of glioma cancer patients (25). Knockdown of HCP5 was found to inhibit the malignancy of glioma cells by upregulating miR-139. These data suggest the oncogenic function of HCP5 in glioma. Increased expression of HCP5 was also identified in follicular thyroid carcinoma (FTC). HCP5 was found to promote the tumorigenesis of FTC (37). Mechanistic experiments indicated that HCP5 functions as a ceRNA to sponge miR-22-3p, miR-186-5p and miR-216-5p, which triggers activity of alpha-2, 6-siallyltransferase 2 in FTC cells (37). Consistently, our results showed the upregulation of the expression of HCP5 in prostate cancer, which was associated with the worse prognosis of prostate cancer patients. Functional experiments showed that downregulation of HCP5 suppressed the proliferation and induced the apoptosis of prostate cancer cell lines. To further explore the molecular mechanism by which HCP5 regulates the tumorigenesis of prostate cancer, the miRNA targets of HCP5 were predicted with the miRDB database. The results identified miR-4656 as a potential target of HCP5. Overexpression of HCP5 significantly decreased the abundance of miR-4656 in prostate cancer cells. Our data uncovered the critical involvement of the HCP5/miR-4656 axis in prostate cancer.
The function of miRNAs in regulating the growth of cancer cells occurs mainly by inhibiting the expression of downstream target genes. The involvement of miR-4656 in cancer is not fully understood. Recent research showed that miR-4656 is aberrantly expressed in glioma tissues and is correlated with the prognosis of glioma cancer patients (38). In the present study, to further understand the functional mechanism of miR-4656 in prostate cancer, downstream targets of miR-4656 were predicted. The data showed that miR-4656 bound the 3′-UTR of CEMIP and suppressed the expression of CEMIP. CEMIP was primary identified as a hearing loss-related gene (39). Interestingly, increased expression of CEMIP has been identified in a variety of human cancer (31,32,39–41). For example, upregulated expression of CEMIP may be a valuable biomarker for the detection of pancreatic cancer at an early stage (39). A recent study showed that overexpression of CEMIP is triggered by the AMPK/GSK3β/β-catenin cascade and promotes the invasion and migration of prostate cancer cells via elevating metabolic reprogramming. These results demonstrated that the targeting of CEMIP may be a promising strategy for the treatment of advanced prostate cancer patients (42). The oncogenic function of CEMIP was also found in colorectal cancer (31,40,41). In this study, overexpression of HCP5 enhanced the abundance of CEMIP. These results provided the possible mechanism by which HCP5 regulates the growth of prostate cancer cells.
In conclusion, our data revealed that HCP5 is overexpressed in prostate cancer tissues, and is correlated with a worse prognosis of cancer patients. For further study, immunostaining of prostate cancer tissues is necessary to evaluate the cancer grade and neovascularization using fresh samples. Functional mechanistic investigation uncovered that HCP5 promotes the growth of prostate cancer cells via acting as the sponge of miR-4656 and consequently upregulated the expression of CEMIP. HCP5 may be a potential target for designing a novel therapeutic strategy for prostate cancer.
Not applicable.
No funding was received.
The datasets used during the present study are available from the corresponding authors upon reasonable request.
RH and ZL designed the experiments. RH performed the experiments. RH and ZL analyzed the data and wrote the manuscript.
The study was approved by the Ethics Committee of The People's Hospital of Hanchuan City (accession no. LL2017014). Informed consents were received from all the patients.
Not applicable.
The authors declare that they have no competing interests.
|
Jemal A, Bray F, Center MM, Ferlay J, Ward E and Forman D: Global cancer statistics. CA Cancer J Clin. 61:69–90. 2011. View Article : Google Scholar : PubMed/NCBI | |
|
Yamamoto S, Kawakami S, Yonese J, Fujii Y, Urakami S, Masuda H, Numao N, Ishikawa Y, Kohno A and Fukui I: Long-term oncological outcome and risk stratification in men with high-risk prostate cancer treated with radical prostatectomy. Jpn J Clin Oncol. 42:541–547. 2012. View Article : Google Scholar : PubMed/NCBI | |
|
Hoang DT, Iczkowski KA, Kilari D, See W and Nevalainen MT: Androgen receptor-dependent and -independent mechanisms driving prostate cancer progression: Opportunities for therapeutic targeting from multiple angles. Oncotarget. 8:3724–3745. 2017. View Article : Google Scholar : PubMed/NCBI | |
|
Jeong CW, Kang M, Il Jung S, Kim TH, Park SW, Joung JY, Jeon SS, Hong JH, Lee JY, Chung BH, et al: Importance of androgen-deprivation therapy during enzalutamide treatment in men with metastatic castration-resistant prostate cancer following chemotherapy: Results from retrospective, multicenter data. Prostate Cancer Prostatic Dis. 22:150–158. 2019. View Article : Google Scholar : PubMed/NCBI | |
|
Onozawa M, Akaza H, Hinotsu S, Oya M, Ogawa O, Kitamura T, Suzuki K, Naito S, Namiki M, Nishimura K, et al: Combined androgen blockade achieved better oncological outcome in androgen deprivation therapy for prostate cancer: Analysis of community-based multi-institutional database across Japan using propensity score matching. Cancer Med. 7:4893–4902. 2018. View Article : Google Scholar : PubMed/NCBI | |
|
Siddiqui ZA and Krauss DJ: Adjuvant androgen deprivation therapy for prostate cancer treated with radiation therapy. Transl Androl Urol. 7:378–389. 2018. View Article : Google Scholar : PubMed/NCBI | |
|
Wu Z, Liu X, Liu L, Deng H, Zhang J, Xu Q, Cen B and Ji A: Regulation of lncRNA expression. Cell Mol Biol Lett. 19:561–575. 2014. View Article : Google Scholar : PubMed/NCBI | |
|
Khorkova O, Hsiao J and Wahlestedt C: Basic biology and therapeutic implications of lncRNA. Adv Drug Deliv Rev. 87:15–24. 2015. View Article : Google Scholar : PubMed/NCBI | |
|
Balas MM and Johnson AM: Exploring the mechanisms behind long noncoding RNAs and cancer. Noncoding RNA Res. 3:108–117. 2018. View Article : Google Scholar : PubMed/NCBI | |
|
Yang S, Sun Z, Zhou Q, Wang W, Wang G, Song J, Li Z, Zhang Z, Chang Y, Xia K, et al: MicroRNAs, long noncoding RNAs, and circular RNAs: Potential tumor biomarkers and targets for colorectal cancer. Cancer Manag Res. 10:2249–2257. 2018. View Article : Google Scholar : PubMed/NCBI | |
|
Olgun G, Sahin O and Tastan O: Discovering lncRNA mediated sponge interactions in breast cancer molecular subtypes. BMC Genomics. 19:6502018. View Article : Google Scholar : PubMed/NCBI | |
|
Paraskevopoulou MD and Hatzigeorgiou AG: Analyzing MiRNA-LncRNA Interactions. Methods Mol Biol. 1402:271–286. 2016. View Article : Google Scholar : PubMed/NCBI | |
|
Bartel DP: MicroRNAs: Genomics, biogenesis, mechanism, and function. Cell. 116:281–297. 2004. View Article : Google Scholar : PubMed/NCBI | |
|
Mohr AM and Mott JL: Overview of microRNA biology. Semin Liver Dis. 35:3–11. 2015. View Article : Google Scholar : PubMed/NCBI | |
|
Ambros V: The functions of animal microRNAs. Nature. 431:350–355. 2004. View Article : Google Scholar : PubMed/NCBI | |
|
Fabian MR, Sonenberg N and Filipowicz W: Regulation of mRNA translation and stability by microRNAs. Annu Rev Biochem. 79:351–379. 2010. View Article : Google Scholar : PubMed/NCBI | |
|
Ye S, Yang L, Zhao X, Song W, Wang W and Zheng S: Bioinformatics method to predict two regulation mechanism: TF-miRNA-mRNA and lncRNA-miRNA-mRNA in pancreatic cancer. Cell Biochem Biophys. 70:1849–1858. 2014. View Article : Google Scholar : PubMed/NCBI | |
|
Hao NB, He YF, Li XQ, Wang K and Wang RL: The role of miRNA and lncRNA in gastric cancer. Oncotarget. 8:81572–81582. 2017. View Article : Google Scholar : PubMed/NCBI | |
|
Zhang G, Pian C, Chen Z, Zhang J, Xu M, Zhang L and Chen Y: Identification of cancer-related miRNA-lncRNA biomarkers using a basic miRNA-lncRNA network. PLoS One. 13:e01966812018. View Article : Google Scholar : PubMed/NCBI | |
|
Huang T, Liu HW, Chen JQ, Wang SH, Hao LQ, Liu M and Wang B: The long noncoding RNA PVT1 functions as a competing endogenous RNA by sponging miR-186 in gastric cancer. Biomed Pharmacother. 88:302–308. 2017. View Article : Google Scholar : PubMed/NCBI | |
|
Yang B, Gao G, Wang Z, Sun D, Wei X, Ma Y and Ding Y: Long non-coding RNA HOTTIP promotes prostate cancer cells proliferation and migration by sponging miR-216a-5p. Biosci Rep. 38(pii): BSR201805662018. View Article : Google Scholar : PubMed/NCBI | |
|
Tian C, Deng Y, Jin Y, Shi S and Bi H: Long non-coding RNA RNCR3 promotes prostate cancer progression through targeting miR-185-5p. Am J Transl Res. 10:1562–1570. 2018.PubMed/NCBI | |
|
Liu Y, Helms C, Liao W, Zaba LC, Duan S, Gardner J, Wise C, Miner A, Malloy MJ, Pullinger CR, et al: A genome-wide association study of psoriasis and psoriatic arthritis identifies new disease loci. PLoS Genet. 4:e10000412008. View Article : Google Scholar : PubMed/NCBI | |
|
Yu Y, Shen HM, Fang DM, Meng QJ and Xin YH: LncRNA HCP5 promotes the development of cervical cancer by regulating MACC1 via suppression of microRNA-15a. Eur Rev Med Pharmacol Sci. 22:4812–4819. 2018.PubMed/NCBI | |
|
Teng H, Wang P, Xue Y, Liu X, Ma J, Cai H, Xi Z, Li Z and Liu Y: Role of HCP5-miR-139-RUNX1 feedback loop in regulating malignant behavior of glioma cells. Mol Ther. 24:1806–1822. 2016. View Article : Google Scholar : PubMed/NCBI | |
|
Lange CM, Bibert S, Dufour JF, Cellerai C, Cerny A, Heim MH, Kaiser L, Malinverni R, Müllhaupt B, Negro F, et al: Comparative genetic analyses point to HCP5 as susceptibility locus for HCV-associated hepatocellular carcinoma. J Hepatol. 59:504–509. 2013. View Article : Google Scholar : PubMed/NCBI | |
|
Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods. 25:402–408. 2001. View Article : Google Scholar : PubMed/NCBI | |
|
Wong N and Wang X: miRDB: An online resource for microRNA target prediction and functional annotations. Nucleic Acids Res. 43 (Database Issue):D146–D152. 2015. View Article : Google Scholar : PubMed/NCBI | |
|
U.S. National Institutes of Health, . Laboratory animal welfare; proposed U.S. government principles for the utilization and care of vertebrate animals used in testing, research and training. Fed Regist. 49:29350–29351. 1984.PubMed/NCBI | |
|
Shen F, Zong ZH, Liu Y, Chen S, Sheng XJ and Zhao Y: CEMIP promotes ovarian cancer development and progression via the PI3K/AKT signaling pathway. Biomed Pharmacother. 114:1087872019. View Article : Google Scholar : PubMed/NCBI | |
|
Fink SP, Myeroff LL, Kariv R, Platzer P, Xin B, Mikkola D, Lawrence E, Morris N, Nosrati A, Willson JK, et al: Induction of KIAA1199/CEMIP is associated with colon cancer phenotype and poor patient survival. Oncotarget. 6:30500–30515. 2015. View Article : Google Scholar : PubMed/NCBI | |
|
Liang G, Fang X, Yang Y and Song Y: Knockdown of CEMIP suppresses proliferation and induces apoptosis in colorectal cancer cells: Downregulation of GRP78 and attenuation of unfolded protein response. Biochem Cell Biol. 96:332–341. 2018. View Article : Google Scholar : PubMed/NCBI | |
|
Liang G, Fang X, Yang Y and Song Y: Silencing of CEMIP suppresses Wnt/β-catenin/Snail signaling transduction and inhibits EMT program of colorectal cancer cells. Acta Histochem. 120:56–63. 2018. View Article : Google Scholar : PubMed/NCBI | |
|
Li L, Yan LH, Manoj S, Li Y and Lu L: Central role of CEMIP in tumorigenesis and its potential as therapeutic target. J Cancer. 8:2238–2246. 2017. View Article : Google Scholar : PubMed/NCBI | |
|
Corra F, Agnoletto C, Minotti L, Baldassari F and Volinia S: The network of Non-coding RNAs in cancer drug resistance. Front Oncol. 8:3272018. View Article : Google Scholar : PubMed/NCBI | |
|
Medici M, Porcu E, Pistis G, Teumer A, Brown SJ, Jensen RA, Rawal R, Roef GL, Plantinga TS, Vermeulen SH, et al: Identification of novel genetic Loci associated with thyroid peroxidase antibodies and clinical thyroid disease. PLoS Genet. 10:e10041232014. View Article : Google Scholar : PubMed/NCBI | |
|
Liang L, Xu J, Wang M, Xu G, Zhang N, Wang G and Zhao Y: LncRNA HCP5 promotes follicular thyroid carcinoma progression via miRNAs sponge. Cell Death Dis. 9:3722018. View Article : Google Scholar : PubMed/NCBI | |
|
Shou J, Gu S and Gu W: Identification of dysregulated miRNAs and their regulatory signature in glioma patients using the partial least squares method. Exp Ther Med. 9:167–171. 2015. View Article : Google Scholar : PubMed/NCBI | |
|
Lee HS, Jang CY, Kim SA, Park SB, Jung DE, Kim BO, Kim HY, Chung MJ, Park JY, Bang S, et al: Combined use of CEMIP and CA 19-9 enhances diagnostic accuracy for pancreatic cancer. Sci Rep. 8:33832018. View Article : Google Scholar : PubMed/NCBI | |
|
Zhang D, Zhao L, Shen Q, Lv Q, Jin M, Ma H, Nie X, Zheng X, Huang S, Zhou P, et al: Down-regulation of KIAA1199/CEMIP by miR-216a suppresses tumor invasion and metastasis in colorectal cancer. Int J Cancer. 140:2298–2309. 2017. View Article : Google Scholar : PubMed/NCBI | |
|
Evensen NA, Li Y, Kuscu C, Liu J, Cathcart J, Banach A, Zhang Q, Li E, Joshi S, Yang J, et al: Hypoxia promotes colon cancer dissemination through up-regulation of cell migration-inducing protein (CEMIP). Oncotarget. 6:20723–20739. 2015. View Article : Google Scholar : PubMed/NCBI | |
|
Zhang P, Song Y, Sun Y, Li X, Chen L, Yang L and Xing Y: AMPK/GSK3β/β-catenin cascade-triggered overexpression of CEMIP promotes migration and invasion in anoikis-resistant prostate cancer cells by enhancing metabolic reprogramming. FASEB J. 32:3924–3935. 2018. View Article : Google Scholar : PubMed/NCBI |