Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Oncology Reports
Join Editorial Board Propose a Special Issue
Print ISSN: 1021-335X Online ISSN: 1791-2431
Journal Cover
August-2021 Volume 46 Issue 2

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
August-2021 Volume 46 Issue 2

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML

  • Supplementary Files
    • Supplementary_Data.pdf
Article Open Access

Endothelin-1 induces changes in the expression levels of steroidogenic enzymes and increases androgen receptor and testosterone production in the PC3 prostate cancer cell line

  • Authors:
    • María José Torres
    • Fernanda López-Moncada
    • Daniela Herrera
    • Sebastián Indo
    • Alejandro Lefian
    • Paola Llanos
    • Julio Tapia
    • Enrique A. Castellón
    • Héctor R. Contreras
  • View Affiliations / Copyright

    Affiliations: Department of Basic and Clinical Oncology, Faculty of Medicine, University of Chile, Santiago 8380453, Chile, Laboratory of Endocrinology and Reproductive Biology, University of Chile Clinical Hospital, Faculty of Medicine, University of Chile, Santiago 838 0000, Chile, Department of Medical Technology, Faculty of Medicine, University of Chile, Santiago 8380453, Chile, Institute for Research in Dental Sciences, Faculty of Dentistry, University of Chile, Santiago 8380544, Chile, Institute of Biomedical Sciences, Faculty of Medicine, University of Chile, Santiago 8380453, Chile
    Copyright: © Torres et al. This is an open access article distributed under the terms of Creative Commons Attribution License.
  • Article Number: 171
    |
    Published online on: June 23, 2021
       https://doi.org/10.3892/or.2021.8122
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

Endothelin‑1 (ET‑1) is involved in the regulation of steroidogenesis. Additionally, patients with castration‑resistant prostate cancer (PCa) have a higher ET‑1 plasma concentration than those with localized PCa and healthy individuals. The aim of the present study was to evaluate the effect of ET‑1 on steroidogenesis enzymes, androgen receptor (AR) and testosterone (T) production in PCa cells. The expression levels of endothelin receptors in prostate tissue from patients with localized PCa by immunohistochemistry, and those in LNCaP and PC3 cells were determined reverse transcription‑quantitative PCR (RT‑qPCR) and western blotting. Furthermore, the expression levels of ET‑1 were determined in LNCaP and PC3 cells by RT‑qPCR and western blotting. The ET‑1 receptor activation was evaluated by intracellular calcium measurement, the expression levels of AR and enzymes participating in steroidogenesis [cytochrome P450 family 11 subfamily A member 1 (CyP11A1), cytochrome P450 family 17 subfamily A member 1, aldo‑keto reductase family member C2 and 3β‑hydroxysteroid dehydrogenase/isomerase 2 (3β HSD2)] were determined by western blotting and T concentration was determined by ELISA using PC3 cells. The present results revealed higher expression levels of endothelin A receptor (ETAR) in tissues obtained from samples of patients with PCa with a low Gleason Score. No changes were identified for endothelin B receptor (ETBR). PC3 cells expressed higher levels of ET‑1 and ETAR, while LNCaP cells exhibited higher expression levels of ETBR. Blocking of ETAR and endothelin B receptor decreased the expression levels of CyP11A1 and 3β HSD2 enzymes and AR in PC3 cells, as well as T secretion. These findings suggested that ET‑1 has a potential role in modulating the intratumoral steroidogenesis pathway and might have relevance as a possible therapeutic target.

Introduction

Prostate cancer (PCa) is the fifth most common cause of cancer-associated mortality among men worldwide (1). Digital rectal examination and determination of prostate-specific antigen levels within the blood are techniques that are commonly used to screen for PCa (2). If these techniques suggest the presence of PCa, the diagnosis is confirmed using a transrectal biopsy analysis (2,3). Current treatments for clinically localized or advanced PCa include radical prostatectomy, cryoablation, radiation therapy, brachytherapy and androgen deprivation therapy (ADT) (2,4).

The androgens [testosterone (T) and dihydrotestosterone] are hormones, which are required for the development of the reproductive system and male secondary sex characteristics (4,5). These hormones exert their physiological actions via interaction with the androgen receptor (AR), which is a ligand-dependent transcriptional factor belonging to the superfamily of nuclear receptors (5). Androgens serve an important role in the development and growth of a normal prostate gland and in the proliferation of PCa cells (6,7). Therefore, ADT is often used as a first line treatment to control advanced PCa (8). However, after 2–3 years of treatment, PCa develops resistance to ADT, resulting in castration-resistant PCa (CRPC) (8). Hypersensitivity, mutations, splicing variants or amplification of the AR and intratumoral steroidogenesis have been indicated to be mechanisms that may lead to androgen resistance (6). Steroidogenesis begins with the translocation of cholesterol to the inner membrane of the mitochondria via steroidogenic acute regulatory protein (9). In addition, cytochrome P450 family 11 subfamily A member 1 (CyP11A1), cytochrome P450 family 17 subfamily A member 1 (CyP17A1), 3β hydroxysteroid dehydrogenase type 2 (3β HSD2), 17β-hydroxysteroid dehydrogenase type 3 and 5α reductase type 1 and 2 are the main enzymes that are required to complete androgen de novo synthesis from cholesterol (9).

A number of previous studies have demonstrated that steroidogenic cells expressing endothelin receptor increase steroidogenesis when stimulated with endothelin-1 (ET-1) (10–12). Furthermore, patients with metastatic CRPC have been reported to exhibit increased ET-1 plasma levels compared with patients with localized PCa and healthy individuals (13–17), suggesting that ET-1 may contribute to the transition from androgen-dependent PCa to CRPC. ET-1, which is a potent vasoconstrictor peptide containing 21 amino acid residues, is associated with a number of aspects of PCa progression, including proliferation, escape from apoptosis, invasion, angiogenesis and new bone formation (16,18,19).

Leydig cells have been indicated to express high levels of endothelin receptors (12) and increase basal T secretion when stimulated with ET-1 (10,11). Additionally, endothelin receptor A (ETAR) activation by ET-1 has been revealed to increase AR mRNA expression via c-myc in androgen-independent LNCaP cells, contributing to androgenic independence (20). However, to the best of our knowledge, the role of endothelin receptors in non-steroidogenic cells, including PCa cells, has not yet been described. In the present study, an ET-1-dependent increase in the expression levels of steroidogenic enzymes and an increase in AR and T production in PCa cells were observed.

Materials and methods

Chemicals and materials

ET-1 was purchased from Sigma-Aldrich; Merck KGaA. ET-1 receptor antagonists, 2-[(3R,6R,9S,12R,15S)-6-(1H-indol-3-ylmethyl)-9-(2-methylpropyl)-2,5,8,11,14-pentaoxo-12-propan-2-yl-1,4,7,10,13-pentazabicyclo[13.3.0]octadecan-3-yl] acetic acid or cyclo(D-tryptamine-D-aspartic acid-L-proline-D-valine-L-leucine) (BQ123) and 2,6-Dimethylpiperidinecarbonyl-γ-Methyl-Leu-Nin-(Methoxycarbonyl)-D-Trp-D-Nle,-N-[N-[N-[(2,6-Dimethyl-1-piperidinyl)carbonyl]-4-methyl-L-leucyl]-1-(methoxycarbonyl)-D-tryptophyl]-D-norleucine sodium salt (BQ788) were purchased from Cayman Chemical Company and bosentan was purchased from Sigma-Aldrich; Merck KGaA. The salts, chloroform and alcohols were obtained from MilliporeSigma and Hank's buffer was obtained from Thermo Fisher Scientific, Inc.

Endothelin receptor and AR blockade

Cells were incubated with BQ123 (ETAR selective antagonist; 1 µM), BQ788 [endothelin B receptor (ETBR) selective antagonist; 1 µM] or bosentan (ETAR and ETBR dual antagonist; 1 µM) for 30 min at 37°C with 5% CO2. In all experiments, DMSO 0.1% was used.

Cell culture

PCa cells from androgen-dependent lymph nodal metastases (LNCaP) and PCa cells from bone metastases (PC3) were obtained from American Type Culture Collection. LNCaP cells, clone FDG (CRL1740), were maintained in RPMI-1640 medium (Gibco; Thermo Fisher Scientific, Inc.) and PC3 cells (CRL1435) were maintained in DMEM F12 medium (Gibco; Thermo Fisher Scientific, Inc.). Both media were supplemented with 10% FBS (Thermo Fisher Scientific, Inc.), 1% penicillin, 1% streptomycin and 0.05% amphotericin B (Corning, Inc.). All cell cultures were maintained at 37°C in a humidified atmosphere with 5% CO2. The media of PC3 cells were replaced with phenol red-free RPMI (Gibco; Thermo Fisher Scientific, Inc.) supplemented with 10% activated charcoal (Sigma-Aldrich; Merck KGaA)-treated FBS, 1% streptomycin, 0.05% amphotericin B and 1% penicillin 24 h before the different treatments. Afterwards, cells were washed with PBS three times and harvested.

Tissue microarrays (TMAs)

A TMA was constructed with 5-µm sections of formalin (10% v/v)-fixed for 24 h at room temperature and paraffin-embedded PCa samples from male patients (age range, 47–80 years; mean age, 63.7 years) with different Gleason Score (GS) (21) from the biopsy archive of our institutional Pathology Department (Clinical Hospital of the University of Chile, Santiago, Chile). All samples were diagnosis biopsies collected in different years (March 2016-January 2018) with a confirmed diagnosis and GS. The sample inclusion criterion was: PCa confirmed. All protocols for tissue archive use and processing have been approved by the institutional Ethical Committee of Faculty of Medicine, University of Chile (approval nos. 135-2015 and 083-2020). For diagnosis biopsies, patients were asked to sign a general consent when biopsies were obtained. For the use of the archive of biopsies from the Pathology Service, a signed authorization of the director of the Department of Pathology, University of Chile (authorization 03012016; Santiago, Chile) is required. TMAs with cores of 1 mm in diameter, including 7 samples with a low GS (GS<7), 14 samples with an intermediate GS (GS=7) and 11 samples with a high GS (GS>7) were obtained and evaluated by a pathologist.

Immunohistochemistry

TMA tissue sections were deparaffinized and rehydrated in decreasing concentrations of ethanol and distilled water [xylene (×2), ethanol 100% (×2), ethanol 95%, ethanol 70% and distilled water], and incubated for 40 min at 95°C in antigen recovery buffer (10 mM citrate buffer, pH 6.0). After cooling, endogenous peroxidase was inhibited by incubation with 0.3% H2O2 for 30 min and samples were blocked with 2.5% horse serum (Vector Laboratories, Inc.) for 30 min at room temperature. Then, sections were incubated with primary antibody against ETAR (dilution, 1:300; cat. no. PA3-065; Thermo Fisher Scientific, Inc.) or ETBR (dilution, 1:800; cat. no. PA3-066; Thermo Fisher Scientific, Inc.) overnight at 4°C. Subsequently, the samples were washed and incubated with secondary antibody conjugated to the HRP enzyme for 1 h at room temperature (ready to use; anti-rabbit-mouse-IgG; cat. no. PK-7200; Vector Laboratories, Inc.). Then, samples were washed and incubated with ABC amplification system for 30 min at room temperature (ready to use; cat. no. PK-7 200; Vector Laboratories, Inc.). Finally, the chromogenic substrate 3,3′-diaminobenzidine (DAB) was added. Furthermore, the nuclei were stained with hematoxylin (ScyTek Laboratories, Inc.) for 1 min at room temperature. Images were obtained using a Leica DM2500 light microscope (Leica Microsystems GmbH), digitized and the DAB signal was quantified by ImageJ 1.51w software (National Institutes of Health), using the IHC toolbox plugin (https://imagej.nih.gov/ij/plugins/ihc-toolbox/index.html) and plotted using GraphPad Prism version 7.1 (GraphPad Software, Inc.). For semi-quantitative analysis of immunohistochemistry results, the gray level transformation method was implemented, using the logarithmic transformation technique. The digitized images were processed through gray level transformation techniques, since it operates directly on the pixels. The image involves 256 levels of gray, so in the histogram on the horizontal axis it ranges from 0 to 255 levels of gray. On the other hand, the vertical axis differs from the number of pixels in the image. The Log (255/average color/grays in the selected area) was determined as previously described (22).

RNA extraction and quantification

Total RNA was isolated from cells using TRIzol® (Thermo Fisher Scientific, Inc.), chloroform, isopropanol and 75% ethanol. Subsequently, nuclease free water (diethylpyrocarbonate-treated) was used to re-suspend extracted RNA. The purity and concentration of RNA were determined by spectrophotometry at 260/280 nm using a BioTeK Synergy HT plate reader (BioTek Instruments, Inc.).

Reverse transcription-quantitative PCR (RT-qPCR)

A total of 1,000 ng total RNA from each sample was used for cDNA synthesis using the 5X All-In-One RT MasterMix kit (25°C for 10 min, 42°C for 15 min and 85°C for 5 min, 1 cycle; Applied Biological Materials Inc.). Subsequently, 50 ng/ml were amplified by qPCR using the Brilliant II SYBR Green qPCR Master Mix kit (95°C for 10 min, 1 cycle; 95°C for 15 min, 60°C for 15 min and 72°C for 15 min, 40 cycles; 95°C for 15 min, 65°C for 15 min and 95°C for 15 min, 1 cycle; Agilent Technologies, Inc.). RT-qPCR oligonucleotides are shown in Table I. The housekeeping gene Pumilio was used to normalize data and the results were analyzed using the ΔΔCq method (23). To facilitate comparison, data were referred to those cells that express the highest levels of the receptor. PC3 cells expressed the highest levels of ETAR mRNA and protein, so the expression levels of ETAR of LNCaP cells were compared with PC3 cells. By contrast, LNCaP cells expressed the highest levels of ETBR mRNA and protein, so ETBR expression levels of PC3 cells were compared with LNCaP cells.

Table I.

Reverse transcription-quantitative PCR oligonucleotides.

Table I.

Reverse transcription-quantitative PCR oligonucleotides.

GeneForward (5′-3′)Reverse (5′-3′)
ETAR GAACATCTTAAGCAGCGTCGAG ACCGATGTAATCCATGAGCAGT
ETBR GCTTGCTTCATCCCGTTCAGA CTTCCCGTCTCTGCTTTAGGTG
ET-1 CAGGGCTGAAGACATTATGGAGA CATGGTCTCCGACCTGGTTT
Pumilio CGGTCGTCCTGAGGATAAAA CGTACGTGAGGCGTGAGTAA

[i] ETAR, endothelin A receptor; ETBR, endothelin B receptor; ET-1, endothelin-1.

Intracellular calcium measurement

PC3 cells were grown on 25-mm diameter glass coverslips and kept in DMEM F12 medium for 24 h. Subsequently, the cells were washed with PBS and loaded with 2 µM Fluor-4 acetoxymethyl ester (Fluo4/AM; Thermo Fisher Scientific, Inc.) at room temperature for 15 min. Subsequently, the cells were maintained in Hank's Balanced Salt Solution at a final volume of 500 µl containing 142 mM NaCl, 5.6 mM KCl, 1 mM MgCl2, 2 mM CaCl2, 0.34 mM Na2HPO4, 0.44 mM KH2PO4, 4.2 mM NaHCO3, 10 mM HEPES and 5.6 mM glucose. On the one hand, 100 nM ET-1 was added at 60 sec after reaction was initiated with Fluo4/AM, at room temperature, to cells previously incubated with DMSO or with selective antagonists for endothelin receptors, at 37°C for 30 min. In all experiments DMSO (0.1%) was used. On the other hand, 17 mM carbachol (positive control) was added at 245 sec after reaction was initiated with Fluo4AM, at room temperature, to cells preincubated with BQ123 at 37°C for 30 min. The kinetics recording was carried out for 300 sec and the fluorescence intensity was measured in an AxioCam MRm (Carl Zeiss AG) coupled to a Carl Zeiss AG inverted fluorescence microscope AxioVert. A1 equipped for epifluorescence and the ImageJ 1.51w software (National Institutes of Health) was used.

Indirect immunofluorescence

PC3 and LNCaP cells were grown on 12-mm diameter glass coverslips seeded at a confluence of 60–70%. After 24–48 h, the cells were fixed with a fixing solution (4% paraformaldehyde) for 30 min at room temperature, washed and blocked with 3% BSA (Winkler, Ltd.) in PBS-glycine for 30 min at room temperature. Cells were incubated overnight at 4°C with the primary antibodies against ETAR (dilution, 1:200; cat. no. PA3-065; Thermo Fisher Scientific, Inc.) and ETBR (dilution, 1:200; cat. no. PA3-066; Thermo Fisher Scientific, Inc.), washed and incubated for 30 min at 37°C with the secondary antibody Alexa Fluor 594 (dilution, 1:500; cat. no. A21207; Thermo Fisher Scientific, Inc.). DAPI (dilution, 1:10,000; cat. no. sc3598; Santa Cruz Biotechnology, Inc.) was used for nuclear staining for 7 min at room temperature. The images were obtained using a Leica D2500 fluorescence microscope (Leica Microsystems GmbH).

Western blotting

Proteins obtained from cell lines were extracted using RIPA buffer (20 mM Tris-HCl, 150 mM NaCl, 1 mM EDTA, 1% v/v NP-40, 1% w/v sodium deoxycholate, 2.5 mM Na3PO4, 1 mM b-glycerophosphate and 1 mM Na3VO4, pH 7.4) with a protease inhibitor cocktail (Roche Diagnostics). The homogenate was centrifuged at 16,708 × g for 15 min at 4°C. Finally, the supernatant was quantified using a Bradford assay. A total of 25 µg of protein was loaded per lane, separated by SDS-PAGE (10 or 12% polyacrylamide for ETAR and ETBR), and transferred to a nitrocellulose membrane, except for detection of 3β HSD2, for which protein was transferred to a PVDF membrane. The membranes were blocked at room temperature with 5% BSA (Winkler, Ltd.) or milk of 0.2% TBS-Tween for 90 min and exposed to the primary antibody overnight at 4°C. After washing, the binding of the primary antibodies was detected with secondary antibodies conjugated with the HRP enzyme for 90 min at room temperature, and detected using EZ-ECL chemiluminescence kit (Biological Industries) and a Vilber Lourmat equipment (Fusion FX5-XT 826.WL/superbright serial number 15200393; Vilber). Primary and secondary antibodies for western blotting are shown in Tables II and III, respectively. The densitometric analysis of western blot bands was performed using ImageJ v1.51 software (National Institutes of Health).

Table II.

Primary antibodies for western blotting.

Table II.

Primary antibodies for western blotting.

Primary antibodySupplierCat. no.SpeciesDilution
ETARThermo Fisher Scientific, Inc.PA3-065Rabbit anti-human1:1,000
ETBRThermo Fisher Scientific, Inc.PA3-066Rabbit anti-human1:1,000
ET-1Santa Cruz Biotechnology, Inc.sc-517436Mouse anti-human1:500
CyP11A1Abcamab-75497Rabbit anti-human1:1,000
CyP17A1Merck KGaA.ABC392Rabbit anti-human1:1,000
AKR1C2Thermo Fisher Scientific, Inc.PA5-36572Rabbit anti-human1:500
3β HSD2Thermo Fisher Scientific, Inc.PA5-27791Rabbit anti-human1:1,000
ARAbcamab-9474Mouse anti-human1:1,000
ActinMP Biomedicals, LLC691002Mouse anti-human1:5,000

[i] ETAR, endothelin A receptor; ETBR, endothelin B receptor; ET-1, endothelin-1; CyP11A1, cytochrome P450 family 11 subfamily A member 1; CyP17A1, cytochrome P450 family 17 subfamily A member 1; AKR1C2, aldo-keto reductase family member C2; 3β HSD2, 3β-hydroxysteroid dehydrogenase/isomerase 2; AR, androgen receptor.

Table III.

Secondary antibodies.

Table III.

Secondary antibodies.

Secondary antibodySupplierCat. no.Dilution
Anti-rabbitJackson ImmunoResearch Laboratories, Inc.111-035-0031:10,000
Anti-mouseJackson ImmunoResearch Laboratories, Inc.115-035-0031:10,000
Determination of T levels in cell culture medium

PC3 cells were grown on 6-well plates in RPMI medium free of phenol red with 10% androgen-free FBS. After 24 h, DMSO (control) or endothelin receptor antagonist was added for 30 min at 37°C, and then 100 nM ET-1 was added every 24 h at 37°C. In all experiments, DMSO (0.1%) was used. After 96 h, the culture medium was removed and centrifuged at 1,000 × g for 5 min at room temperature. The number of viable cells was quantified in each condition. Parameter Testosterone Assay (cat. no. KGE010; R&D Systems, Inc.) was used for T determination in culture supernatant according to the manufacturer's protocols. The assay was based on a competitive binding technique. A total of 50 µl of a monoclonal antibody specific for T (excluding non-specific binding wells) was added for binding the anti-mouse antibody coated microplate and incubated with shaking for 1 h at room temperature. After three washes with wash buffer (400 µl), 100 µl calibrator (non-specific binding wells and B0, zero standard), 100 µl standard, control or sample (remaining wells) were added. Subsequently, 50 µl conjugated T was incorporated into each well, and incubated for 3 h at room temperature on a horizontal orbital microplate shaker at 37 × g After three washes with wash buffer, 200 µl of the substrate were added for 30 min at room temperature. Afterwards, 50 µl of the stop solution was added to stop the reaction. Finally, the optical density was determined within 30 min by spectrophotometry at 450 nm using the BioTeK Synergy HT plate reader (BioTek Instruments, Inc.).

Statistical analysis

Plots were obtained using the GraphPad Prism 7.1 software (GraphPad Software, Inc.). Data are presented as the mean ± SD of at least three independent experiments for RT-qPCR and western blotting. Mann Whitney or Kruskal-Wallis (Dunn's multiple comparisons test) test was carried out. The box plots represent the signal intensity of ETAR and ETBR in each group. The points outside the box represent the outliers. The number of samples analyzed was 32 for low GS (<7), 14 for intermediate GS (=7) and 11 for high GS (>7). The bar shows the mean ± SD. P≤0.05 was considered to indicate a statistically significant difference.

Results

Expression levels of ETAR and ETBR in TMAs of samples

In the present study, quantitative immunohistochemistry for ETAR and ETBR was performed on constructed TMAs. Intracellular staining of ETAR and ETBR was observed in PCa samples (Fig. 1A and C). Furthermore, semi-quantification analysis indicated that the intensity of ETAR immunostaining was significantly higher in samples with low GS (Kruskal-Wallis test; P<0.05) compared with in samples with intermediate GS (Fig. 1A and B). No changes in ETBR were observed to be associated with GS in primary tumor samples (Fig. 1C and D). However, in benign prostatic hyperplasia samples, used as a non-neoplastic control, ETAR was revealed to be located in epithelial and stromal cells (Fig. S1A), and ETBR was revealed to be primarily located in epithelial cells (Fig. S1B).

Figure 1.

Expression levels of ETAR/ETBR in TMAs from PCa samples. The images indicate the expression levels of ETAR/ETBR in TMAs of PCa samples with low, intermediate, and high GS. (A) Immunohistochemistry analysis of ETAR. (B) Semi-quantification of the DAB signal. (C) Immunohistochemistry analysis of ETBR. (D) Semi-quantification of the DAB signal. The box plots represent the signal intensity of ETAR and ETBR in each group. The points outside the box represent the outliers. Total number of samples analyzed, n=32; low GS (<7), n=7; intermediate GS (=7), n=14; and high GS (>7), n=11. The box plots show the mean ± SD. *P<0.05 (Kruskal-Wallis test/Dunn's multiple comparisons test). Scale bar, 100 µm. PCa, prostate cancer; GS, Gleason Score; ETAR, endothelin A receptor; ETBR, endothelin B receptor; ET-1, endothelin-1; TMA, tissue microarray; DAB, 3,3′-diaminobenzidine; Interm, intermediate.

Expression levels of ET-1, ETAR and ETBR in PCa cell lines

Basal expression levels of ET-1, ETAR and ETBR in LNCaP and PC3 cells were determined using RT-qPCR and western blotting. In addition, ETAR and ETBR levels were also determined by immunofluorescence. PC3 cells were demonstrated to exhibit the highest levels of ETAR and ET-1 expression at the mRNA (ETAR; Mann-Whitney test; P=0.05; Fig. 2A; ET-1; Mann-Whitney test; P=0.05; Fig. 3A) and protein levels (ETAR; Mann-Whitney test; P<0.05; Fig. 2B and E; ET-1 Mann-Whitney; P=0.05; Fig. 3B). By contrast, LNCaP cells were revealed to express increased levels of ETBR mRNA (ETBR; Mann-Whitney test; P=0.05; Fig. 2C) and protein (ETBR; Mann-Whitney test; P=0.05; Fig. 2D and F) compared with PC3 cells. Negative controls are shown in Fig. 2G.

Figure 2.

ETAR and ETBR expression in prostate cancer cells. (A) ETAR mRNA expression normalized to Pumilio compared with PC3 cells. (B) ETAR protein expression in PC3 and LNCaP cells. Quantification was normalized to β-actin and PC3 cells. (C) ETBR mRNA expression normalized to Pumilio compared with LNCaP cells. (D) ETBR protein expression in PC3 and LNCaP cells normalized to Pumilio compared with LNCaP cells. Immunofluorescence analysis of (E) ETAR and (F) ETBR in PC3 and LNCaP cells. (G) Negative controls. Data are presented as the mean ± SD (n=3 independent experiments) of arbitrary units. *P<0.05 (Mann-Whitney test). Scale bar, 20 µm. The values 55, 56 and 40 correspond to mass units (kDa). ETAR, endothelin A receptor; ETBR, endothelin B receptor; Neg., negative.

Figure 3.

ET-1 expression and effect of ET-1 on calcium signaling in PCa cells. (A) Prepro-ET-1 mRNA expression normalized to Pumilio compared with PC3 cells. (B) ET-1 protein expression in PC3 and LNCaP cells. Quantification was normalized to β-actin and PC3 cells. (C) Addition of 100 nM ET-1. (D) Cells were incubated with 1 µM BQ123 and stimulated with ET-1. After 240 sec, cells were stimulated with carbachol. (E) Cells were incubated with 1 µM Bosentan and stimulated with ET-1. Data are presented as the mean ± SD (n=3 independent experiments). *P<0.05 (Mann-Whitney test). The values 35 and 40 correspond to mass units (kDa). F/F0, relative fluorescence intensity; PCa, prostate cancer; ET-1, endothelin-1; BQ123, 2-[(3R,6R,9S,12R,15S)-6-(1H-indol-3-ylmethyl)-9-(2-methylpropyl)-2,5,8,11,14-pentaoxo-12-propan-2-yl-1,4,7,10,13-pentazabicyclo[13.3.0]octadecan-3-yl] acetic acid.

Intracellular Ca2+ measurement revealed that activity of ETAR is induced by ET-1 in PC3 cells

Since ETAR is a Gq protein-coupled receptor (15,17), the activity of this receptor was evaluated via intracellular calcium measurement. The results in Fig. 3C indicated that activation of ETAR by ET-1 induced an intracellular Ca2+ transient signal, which was reflected as an increase in relative fluorescence intensity (F/F0) when adding ET-1 at 60 sec compared with carbachol (positive control; Fig. 3D), suggesting the exit of calcium from the endoplasmic reticulum and/or the subsequent entry of calcium from the extracellular medium. This effect was inhibited by a selective antagonist for ETAR, BQ123 (Fig. 3D), and the non-selective antagonist Bosentan (Fig. 3E).

Effect of ET-1 on the expression levels of steroidogenic pathway enzymes and AR in PC3 cells

In the present study, the effect of ET-1 on the enzymes of the steroidogenic pathway in PC3 cells was investigated. The effect was not determined in LNCaP cells since PC3 cells expressed higher levels of ET-1 and ETAR. Therefore, by using PC3 cells, the effects could be observed more clearly. It was demonstrated that ET-1 treatment increased the expression levels of CyP11A1 (Kruskal-Wallis test; P<0.05; Fig. 4A and B-D), 3β HSD2 (Kruskal-Wallis test; P<0.05; Fig. 4A and H-J) and AR (Kruskal-Wallis test; P<0.05; Fig. 5A-C) in PC3 cells compared with the control without ET-1. Blocking ET-1 receptors with BQ123 and/or Bosentan prevented the stimulatory effect of ET-1 on the expression of CyP11A1 (ET-1/BQ123 + ET-1; Kruskal-Wallis test; P<0.001; Fig. 4B), 3β HSD2 (ET-1/Bosentan + ET-1; Kruskal-Wallis test; P<0.05; Fig. 4J) and AR (ET-1/BQ123 + ET-1; Kruskal-Wallis test; P<0.01; Fig. 5B; ET-1/Bosentan + ET-1; Kruskal-Wallis test; P<0.05; Fig. 5D). Additionally, blocking ETBR with BQ788 decreased, with respect to ET-1, the expression levels of 3β HSD2 (ET-1/BQ788 + ET-1; Kruskal-Wallis test; P<0.05; Fig. 4I). There were no changes observed in CyP17A1 and aldo-keto reductase family member C2 (AKR1C2) protein expression in the three antagonist treatment groups, with respect to ET-1 (Fig. 4E-G and K-M). The aforementioned results demonstrated that ET-1 may regulate the protein expression levels of CyP11A1, 3β HSD2 and AR via ETAR or ETBR.

Figure 4.

Effect of ET-1 on the expression levels of steroidogenic enzymes. (A) Lysed PC3 cells were analyzed by western blotting and membranes were incubated with antibodies against CyP11A1, CyP17A1, 3β HSD2, AKR1C2 and β-actin. (B) Protein expression levels of CyP11A1 in the presence or absence of BQ123. (C) Protein expression levels of CyP11A1 in the presence or absence of BQ788. (D) Protein expression levels of CyP11A1 in the presence or absence of BOSE. (E) Protein expression levels of CyP17A1 in the presence or absence of BQ123. (F) Protein expression levels of CyP17A1 in the presence or absence of BQ788. (G) Protein expression levels of CyP17A1 in the presence or absence of BOSE. (H) Protein expression levels of 3β HSD2 in the presence or absence of BQ123. (I) Protein expression levels of 3β HSD2 in the presence or absence of BQ788. (J) Protein expression levels of 3β HSD2 in the presence or absence of BOSE. (K) Protein expression levels of AKR1C2 in the presence or absence of BQ123. (L) Protein expression levels of AKR1C2 in the presence or absence of BQ788. (M) Protein expression levels of AKR1C2 in the presence or absence of BOSE. Quantification was normalized to β-actin and control PC3 cells. Data are presented as the mean ± SD (n=3 independent experiments). *P<0.05, **P<0.01, ***P<0.001 (Kruskal Wallis test/Dunn's multiple comparisons test). The values 51, 50, 43, 26 and 40 correspond to mass units (kDa). ET-1, endothelin-1; BQ123, 2-[(3R,6R,9S,12R,15S)-6-(1H-indol-3-ylmethyl)-9-(2-methylpropyl)-2,5,8,11,14-pentaoxo-12-propan-2-yl-1,4,7,10,13-pentazabicyclo[13.3.0]octadecan-3-yl] acetic acid; BQ788, 2,6-Dimethylpiperidinecarbonyl-γ-Methyl-Leu-Nin-(Methoxycarbonyl)-D-Trp-D-Nle,-N-[N-[N-[(2,6-Dimethyl-1-piperidinyl)carbonyl]-4-methyl-L-leucyl]-1-(methoxycarbonyl)-D-tryptophyl]-D-norleucine sodium salt; BOSE, bosentan; CyP11A1, cytochrome P450 family 11 subfamily A member 1; CyP17A1, cytochrome P450 family 17 subfamily A member 1; AKR1C2, aldo-keto reductase family member C2; 3β HSD2, 3β-hydroxysteroid dehydrogenase/isomerase 2.

Figure 5.

Effect of ET-1 on expression levels of AR and testosterone secretion. (A) Lysed PC3 cells were analyzed by western blotting and membranes were incubated with antibodies against AR and β-actin. (B) Protein expression levels of AR in the presence or absence of BQ123. (C) Protein expression levels of AR in the presence or absence of BQ788. (D) Protein expression levels of AR in the presence or absence of BOSE. Quantification was normalized to β-actin and control PC3 cells. The cells were stimulated with 100 nM ET-1 and previously incubated with BQ123 or BQ788 for 96 h. (E) Testosterone secretion in presence or absence of BQ123. (F) Testosterone secretion in presence or absence of BQ788. Data are presented as the mean ± SD (n=3 independent experiments). *P<0.05, **P<0.01 (Kruskal Wallis test/Dunn's multiple comparisons test). Quantification was normalized to control PC3 cells. The values 180 and 40 correspond to mass units (kDa). ET-1, endothelin-1; BQ123, 2-[(3R,6R,9S,12R,15S)-6-(1H-indol-3-ylmethyl)-9-(2-methylpropyl)-2,5,8,11,14-pentaoxo-12-propan-2-yl-1,4,7,10,13-pentazabicyclo[13.3.0]octadecan-3-yl] acetic acid; BQ788, 2,6-Dimethylpiperidinecarbonyl-γ-Methyl-Leu-Nin-(Methoxycarbonyl)-D-Trp-D-Nle,-N-[N-[N-[(2,6-Dimethyl-1-piperidinyl)carbonyl]-4-methyl-L-leucyl]-1-(methoxycarbonyl)-D-tryptophyl]-D-norleucine sodium salt; BOSE, bosentan; AR, androgen receptor.

Effect of ET-1 on T secretion in PC3 cells

To determine if the increase in the expression levels of steroidogenic enzymes was associated with the steroidogenic process, T production was evaluated in PC3 cells. Blocking of endothelin receptors was indicated to induce a decrease in T concentration (ET-1/BQ123 + ET-1; Kruskal-Wallis test; P<0.05; Fig. 5E; ET-1/BQ788 + ET-1; Kruskal-Wallis test; P<0.05; Fig. 5F).

Discussion

ADT is the first-line treatment for patients with localized and advanced PCa (4). However, patients with PCa may develop resistance and this can lead to CRPC (8,9). Upregulation of the expression levels of androgen biosynthesis enzymes has been identified in tissues from patients with CRPC (9). Additionally, high plasma concentrations of ET-1 have been reported in patients with CRPC (13–17). It has been previously proposed that ET-1 may contribute to the transition from androgen-sensitive PCa to CRPC (24). However, to the best of our knowledge, the factors that may promote androgen resistance are yet to be determined. In 2009, Lee et al (20) demonstrated that ET-1 increases c-myc expression via ETAR, leading to increased AR expression in PCa cells within androgen-free medium. Furthermore, steroidogenic cell lines expressing endothelin receptor have been previously indicated to increase basal T secretion following ET-1 stimulation (10,11).

The present study determined the expression levels of ETAR and ETBR in PCa TMAs, including in samples with different GSs (<7, 7 and >7). The results demonstrated that low GS samples exhibited higher ETAR expression compared with intermediate GS samples, indicating that in primary tumors from patients without treatment, the expression levels of ETAR were decreased and may be associated with the progression of PCa. Upregulation of ETAR and ET-1 expression has been demonstrated in the early stages of PCa (16) and higher expression levels of ETAR and ET-1 are associated with advanced tumor stage (25). Furthermore, androgen-sensitive cells (LNCaP) cultured in androgen-deprived medium for 5 months have been indicated to exhibit increased levels of ETAR and ET-1 mRNA, suggesting that this axis may serve an important role in the progression of PCa to CRPC (26). However, in the present study, no variation of ETBR was observed in PCa samples with different GSs. Previous immunohistochemical studies of prostate adenocarcinoma tissue have revealed the decreased expression of ETBR compared with ETAR levels (27,28).

In the present study, the expression levels of ETAR, ETBR and ET-1 were also measured in PCa cell lines, indicating that the androgen-insensitive cell line PC3 expressed the highest mRNA and protein levels of ETAR and ET-1. LNCaP cells expressed higher levels of ETBR compared with PC3 cells. ETBR is a receptor, which is mainly expressed in prostatic epithelial cells and is associated with the regulation of extracellular ET-1 via lysosomal degradation (29). The present study indicated that androgen-sensitive LNCaP cells expressed lower levels of ET-1 but higher levels of ETBR compared with PC3 cells, which was in agreement with previous studies (17,30). These results suggested that the ET-1 axis may serve a role in PCa progression and may contribute to the development of androgen resistance.

The activity of ETs is mediated by the activation of ETAR and ETBR, which are Gq protein-coupled receptors (15,17). Therefore, the present study revealed an expected increase in intracellular calcium in ET-1-stimulated PC3 cells. Accordingly, this effect was suppressed by preincubating the cells with endothelin receptor antagonists (BQ123 and Bosentan).

The ET-1 signaling pathway may be associated with the transition to an androgen-insensitive stage in patients with PCa (24). This can be hypothesized as an increase in AR expression in LNCaP cells after 3 months of androgen deprivation has been previously reported (20). However, the effect of ET-1 on steroidogenesis in non-steroidogenic cells, such as PCa cells, is yet to be determined. Therefore, the basal expression of steroidogenic pathway enzymes in PCa cell lines was examined in the present study.

Steroidogenesis is a physiological process, which mainly occurs in the adrenal glands and gonads (31,32), and different enzymes, including CyP11A1, CyP17A1, 3β HSD2, 17β-hydroxysteroid dehydrogenase type 3 and steroid 5 α-reductase 1, are involved in T production. Steroidogenesis can be acute or chronically regulated depending on the tissue type, and both types of regulation are controlled by different factors or hormones (31,33). An increase in the expression levels of enzymes that are involved in the synthesis of androgens, including CyP11A1, CyP17A1 and 3β HSD1, has been demonstrated in samples from patients with advanced PCa (9,34,35). Therefore, the effect of ET-1 on CyP11A1, CyP17A1, AKR1C2, 3β HSD2 and AR was evaluated in the present study. The results indicated that CyP11A1, 3β HSD2 and AR protein expression increased with ET-1 treatment and this effect was attenuated by a selective (BQ123) and non-selective antagonist (Bosentan) of the endothelin receptor. Other enzymes of the steroidogenic pathway could be tested, and this point could be considered a limitation of the present study. However, the enzymes evaluated in the present study are those showing significant expression changes in tissues of patients with CRPC (9). In addition, endothelin receptor blockade induces a decrease of T concentration in the culture medium of PC3 cells. In 2006, Alimirah et al (36), reported that both PC3 and DU145 cells effectively express AR. Their study revealed that this receptor does not have the same characteristics of normal AR and, depending on the antibodies used, which bind to different regions of AR, it is possible to find double bands in these cell lines (36). Some of the results regarding the levels of the AR and T may be reproduced in DU145 cells (PCa cells from brain metastasis), since they express ETAR (data not shown) and AR and produce T (37). To the best of our knowledge, the aforementioned results are the first to indicate that ET-1 regulates steroidogenesis via ETAR or ETBR in PC3 cells. On the other hand, there are cell lines derived from vertebral (VCaP) and lymphonodular (LAPC4) metastases of patients with PCa refractory to hormone therapy; however, these cell lines exhibit high levels of AR and androgen sensitivity (38). The objective of the present study was to analyze the effect of ET-1 in an androgen-insensitive cell line (PC3), in which high expression levels of ETAR were observed.

The results of the present study indicated that ET-1 may serve an important role in the production of T in PCa cells via the canonical pathway as the main pathway for T synthesis in PCa. Changes in the protein expression levels of steroidogenic enzymes may be induced by ET-1 or ETAR via two potential mechanisms: A cyclic AMP (cAMP)/protein kinase A (PKA)-dependent signaling pathway or a cAMP-independent signaling pathway with protein kinase C involvement. These signaling pathways may allow phosphorylation of transcriptional factors (steroidogenic factor 1, GATA binding protein 4 or cAMP responsive element binding protein), which are associated with the transcription of encoding genes for steroidogenic enzymes (31,39,40). However, cAMP/PKA signaling has been indicated to be the main regulatory mechanism for steroidogenesis, since the cAMP-independent pathways are usually associated with the modulation or enhancement of the biosynthetic process, acting synergistically with PKA (31,33).

These findings suggested that ET-1, via the activation of its receptors, may be actively associated with T production in PCa. This mechanism may contribute to the progression of PCa to CRPC, which indicated that ET-1 and its receptors may be potential therapeutic targets that can be used in the treatment of advanced PCa.

Supplementary Material

Supporting Data

Acknowledgements

The authors would like to thank Ms. Graciela Caroca (Department of Basic and Clinical Oncology, Faculty of Medicine, University of Chile, Santiago 8380453, Chile) for their excellent technical assistance.

Funding

The present study was supported by the following grants: FONDECYT grant nos. 1151214, 1140417, 1201704, 1160889 and 1190406. URedes grant no. URC-007/17, University of Chile grant nos. ENL22/19 and ENL23/19, and scholarships from the National Research and Development Agency (ANID) 21160703 and 21160886.

Availability of data and materials

The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.

Authors' contributions

MJT performed the experimental design, experiments and statistical analysis, and wrote the manuscript. FLM participated in the design of testosterone measurement and drafted the manuscript. DH helped with the experimental design and writing of the manuscript. SI designed and helped in the immunohistochemical assays. AL assisted in the performance of some reverse transcription-quantitative PCR experiments of enzymes of the steroidogenic pathway. PL participated in intracellular calcium measurement design. EAC participated in the experimental design and helped to draft the manuscript. JT helped with the experimental design. HRC designed the general study and assisted in the writing of the manuscript. HRC and EAC confirm the authenticity of all the raw data. All authors read and approved the final manuscript.

Ethics approval and consent to participate

All protocols for tissue collection, use and processing have been approved by the institutional Ethical Committee of Faculty of Medicine, University of Chile (approvals nos. 135-2015 and 083-2020; Authorization for biopsy archive use of the Department of Pathology, University of Chile, 03012016, Santiago, Chile).

Patient consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

References

1 

Bray F, Ferlay J, Soerjomataram I, Siegel RL, Torre LA and Jemal A: Global cancer statistics 2018: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J Clin. 68:394–424. 2018. View Article : Google Scholar : PubMed/NCBI

2 

Shah RB and Zhou M: Recent advances in prostate cancer pathology: Gleason grading and beyond. Pathol Int. 66:260–272. 2016. View Article : Google Scholar : PubMed/NCBI

3 

Shariat SF and Roehrborn CG: Using biopsy to detect prostate cancer. Rev Urol. 10:262–280. 2008.PubMed/NCBI

4 

Perlmutter MD and Lepor M: Androgen deprivation therapy in the treatment of advanced prostate cancer. Rev Urol. 9 (Suppl 1):S3–S8. 2007.PubMed/NCBI

5 

Kaarbø M, Klokk TI and Saatcioglu F: Androgen signaling and its interactions with other signaling pathways in prostate cancer. Bioessays. 29:1227–1238. 2007. View Article : Google Scholar

6 

Anantharaman A and Friedlander TW: Targeting the androgen receptor in metastatic castrate-resistant prostate cancer: A review. Urol Oncol. 34:356–367. 2016. View Article : Google Scholar : PubMed/NCBI

7 

Lonergan PE and Tindall DJ: Androgen receptor signaling in prostate cancer development and progression. J Carcinog. 10:202011. View Article : Google Scholar : PubMed/NCBI

8 

Shore ND, Abrahamsson PA, Anderson J, Crawford ED and Lange P: New considerations for ADT in advanced prostate cancer and the emerging role of GnRH antagonists. Prostate Cancer Prostatic Dis. 16:7–15. 2012. View Article : Google Scholar : PubMed/NCBI

9 

Armandari I, Hamid AR, Verhaegh G and Schalken J: Intratumoral steroidogenesis in castration-resistant prostate cancer : A target for therapy. Prostate Int. 2:105–113. 2014. View Article : Google Scholar : PubMed/NCBI

10 

Conte D, Questino P, Fillo S, Nordio M, Isidori A and Romanelli F: Endothelin stimulates testosterone secretion by rat leydig cells. J Endocrinol. 136:R1–R4. 1993. View Article : Google Scholar : PubMed/NCBI

11 

Stojilkovic SS: Endothelin receptors and gonadal function: An invited commentary. Eur J Endocrinol. 135:391–393. 1996. View Article : Google Scholar : PubMed/NCBI

12 

Ergün S, Harneit S, Paust HJ, Mukhopadhyay AK and Holstein AF: Endothelin and endothelin receptors A and B in the human testis. Anat Embryol (Berl). 199:207–214. 1999. View Article : Google Scholar

13 

Kopetz ES, Nelson JB and Carducci MA: Endothelin-1 as a target for therapeutic intervention in prostate cancer. Invest New Drugs. 20:173–182. 2002. View Article : Google Scholar : PubMed/NCBI

14 

Grant K, Loizidou M and Taylor I: Endothelin-1: A multifunctional molecule in cancer. Br J Cancer. 88:163–166. 2003. View Article : Google Scholar : PubMed/NCBI

15 

Zonnenberg BA and Voest EE: The role of endothelin in hormone-refractory prostate cancer. Eur Urol. (Suppl 2):9–14. 2003. View Article : Google Scholar

16 

Montironi R, Mazzucchelli R, Barbisan F, Stramazzotti D, Santinelli A, Lòpez Beltran A, Cheng L, Montorsi F and Scarpelli M: Immunohistochemical expression of Endothelin-1 and Endothelin-A and Endothelin-B receptors in high-grade prostatic intraepithelial neoplasia and prostate cancer. Eur Urol. 52:1682–1690. 2007. View Article : Google Scholar : PubMed/NCBI

17 

Niko B: Involvement of ion channels in Endothelin-1-induced signalling in human prostate cancer cells. J Clin Toxicol. 02:1–13. 2012.

18 

Russell FD and Davenport AP: Secretory pathways in endothelin synthesis. Br J Pharmacol. 126:391–398. 1999. View Article : Google Scholar : PubMed/NCBI

19 

Barton M and Yanagisawa M: Endothelin: 20 years from discovery to therapy. Can J Physiol Pharmacol. 86:485–498. 2008. View Article : Google Scholar : PubMed/NCBI

20 

Lee JG, Zheng R, McCafferty-Cepero JM, Burnstein KL, Nanus DM and Shen R: Endothelin-1 enhances the expression of the androgen receptor via activation of the c-myc pathway in prostate cancer cells. Mol Carcinog. 48:141–149. 2009. View Article : Google Scholar : PubMed/NCBI

21 

Gleason DF: Histologic grading of prostate cancer: A perspective. Hum Pathol. 23:273–279. 1992. View Article : Google Scholar : PubMed/NCBI

22 

Baidoo E and Kontoh AK: Implementation of gray level image transformation techniques. Int J Mod Educ Comput Sci. 10:44–53. 2018. View Article : Google Scholar

23 

Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods. 25:402–408. 2001. View Article : Google Scholar : PubMed/NCBI

24 

Whyteside AR, Hinsley EE, Lambert LA, McDermott PJ and Turner AJ: ECE-1 influences prostate cancer cell invasion via ET-1-mediated FAK phosphorylation and ET-1-independent mechanisms. Can J Physiol Pharmacol. 88:850–854. 2010. View Article : Google Scholar : PubMed/NCBI

25 

Papanikolaou S, Bravou V, Papadaki H and Gyftopoulos K: The role of the endothelin axis in promoting epithelial to mesenchymal transition and lymph node metastasis in prostate adenocarcinoma. Urol Ann. 9:372–379. 2017. View Article : Google Scholar : PubMed/NCBI

26 

D'Antonio JM, Ma C, Monzon FA and Pflug BR: Longitudinal analysis of androgen deprivation of prostate cancer cells identifies pathways to androgen independence. Prostate. 68:698–714. 2008. View Article : Google Scholar

27 

Godara G, Pecher S, Jukic DM, D'Antonio JM, Akhavan A, Nelson JB and Pflug BR: Distinct patterns of endothelin axis expression in primary prostate cancer. Urology. 70:209–215. 2007. View Article : Google Scholar : PubMed/NCBI

28 

Gohji K, Kitazawa S, Tamada H, Katsuoka Y and Nakajima M: Expression of endothelin receptor a associated with prostate cancer progression. J Urol. 165:1033–1036. 2001. View Article : Google Scholar : PubMed/NCBI

29 

Nelson JB and Carducci MA: The role of endothelin-1 and endothelin receptor antagonists in prostate cancer. BJU Int. 85 (Suppl 2):S45–S48. 2000. View Article : Google Scholar : PubMed/NCBI

30 

Liu J and Liu X: Knockdown of ET-1 gene can inhibit the proliferation, invasion of human prostate cancer cell. Biomed Res. 28:3377–3382. 2017.PubMed/NCBI

31 

Miller WL: Steroidogenic enzymes. Endocr Dev. 13:1–18. 2008. View Article : Google Scholar : PubMed/NCBI

32 

Yazawa T, Imamichi Y, Sekiguchi T, Miyamoto K, Uwada J, Khan MRI, Suzuki N, Umezawa A and Taniguchi T: Transcriptional regulation of ovarian steroidogenic genes: Recent findings obtained from stem cell-derived steroidogenic cells. Biomed Res Int. 2019:89730762019. View Article : Google Scholar : PubMed/NCBI

33 

Stocco DM, Wang XJ, Jo Y and Manna PR: Multiple signaling pathways regulating steroidogenesis and steroidogenic acute regulatory protein expression: More complicated than we thought. Mol Endocrinol. 19:2647–2659. 2005. View Article : Google Scholar : PubMed/NCBI

34 

Bennett NC, Hooper JD, Lambie D, Lee CS, Yang T, Vesey DA, Samaratunga H, Johnson DW and Gobe GC: Evidence for steroidogenic potential in human prostate cell lines and tissues. Am J Pathol. 181:1078–1087. 2012. View Article : Google Scholar : PubMed/NCBI

35 

Mostaghel EA, Solomon KR, Pelton K, Freeman MR and Montgomery RB: Impact of circulating cholesterol levels on growth and intratumoral androgen concentration of prostate tumors. PLoS One. 7:e300622012. View Article : Google Scholar : PubMed/NCBI

36 

Alimirah F, Chen J, Basrawala Z, Xin H and Choubey D: DU-145 and PC-3 human prostate cancer cell lines express androgen receptor: Implications for the androgen receptor functions and regulation. FEBS Lett. 580:2294–2300. 2006. View Article : Google Scholar : PubMed/NCBI

37 

Herrera D, Orellana-Serradell O, Villar P, Torres MJ, Paciucci R, Castellón EA and Contreras HR: Silencing of the transcriptional factor ZEB1 alters the steroidogenic pathway, and increases the concentration of testosterone and DHT in DU145 cells. Oncol Rep. 41:1275–1283. 2019.PubMed/NCBI

38 

van Bokhoven A, Varella-Garcia M, Korch C, Johannes WU, Smith EE, Miller HL, Nordeen SK, Miller GJ and Lucia MS: Molecular characterization of human prostate carcinoma cell lines. Prostate. 57:205–225. 2003. View Article : Google Scholar : PubMed/NCBI

39 

Ruggiero C and Lalli E: Impact of ACTH signaling on transcriptional regulation of steroidogenic genes. Front Endocrinol (Lausanne). 7:242016. View Article : Google Scholar : PubMed/NCBI

40 

Bremer AA and Miller WL: Regulation of steroidogenesis. Cell Endocrinol Heal Dis. 207–227. 2014. View Article : Google Scholar

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Torres MJ, López-Moncada F, Herrera D, Indo S, Lefian A, Llanos P, Tapia J, Castellón EA and Contreras HR: Endothelin-1 induces changes in the expression levels of steroidogenic enzymes and increases androgen receptor and testosterone production in the PC3 prostate cancer cell line. Oncol Rep 46: 171, 2021.
APA
Torres, M.J., López-Moncada, F., Herrera, D., Indo, S., Lefian, A., Llanos, P. ... Contreras, H.R. (2021). Endothelin-1 induces changes in the expression levels of steroidogenic enzymes and increases androgen receptor and testosterone production in the PC3 prostate cancer cell line. Oncology Reports, 46, 171. https://doi.org/10.3892/or.2021.8122
MLA
Torres, M. J., López-Moncada, F., Herrera, D., Indo, S., Lefian, A., Llanos, P., Tapia, J., Castellón, E. A., Contreras, H. R."Endothelin-1 induces changes in the expression levels of steroidogenic enzymes and increases androgen receptor and testosterone production in the PC3 prostate cancer cell line". Oncology Reports 46.2 (2021): 171.
Chicago
Torres, M. J., López-Moncada, F., Herrera, D., Indo, S., Lefian, A., Llanos, P., Tapia, J., Castellón, E. A., Contreras, H. R."Endothelin-1 induces changes in the expression levels of steroidogenic enzymes and increases androgen receptor and testosterone production in the PC3 prostate cancer cell line". Oncology Reports 46, no. 2 (2021): 171. https://doi.org/10.3892/or.2021.8122
Copy and paste a formatted citation
x
Spandidos Publications style
Torres MJ, López-Moncada F, Herrera D, Indo S, Lefian A, Llanos P, Tapia J, Castellón EA and Contreras HR: Endothelin-1 induces changes in the expression levels of steroidogenic enzymes and increases androgen receptor and testosterone production in the PC3 prostate cancer cell line. Oncol Rep 46: 171, 2021.
APA
Torres, M.J., López-Moncada, F., Herrera, D., Indo, S., Lefian, A., Llanos, P. ... Contreras, H.R. (2021). Endothelin-1 induces changes in the expression levels of steroidogenic enzymes and increases androgen receptor and testosterone production in the PC3 prostate cancer cell line. Oncology Reports, 46, 171. https://doi.org/10.3892/or.2021.8122
MLA
Torres, M. J., López-Moncada, F., Herrera, D., Indo, S., Lefian, A., Llanos, P., Tapia, J., Castellón, E. A., Contreras, H. R."Endothelin-1 induces changes in the expression levels of steroidogenic enzymes and increases androgen receptor and testosterone production in the PC3 prostate cancer cell line". Oncology Reports 46.2 (2021): 171.
Chicago
Torres, M. J., López-Moncada, F., Herrera, D., Indo, S., Lefian, A., Llanos, P., Tapia, J., Castellón, E. A., Contreras, H. R."Endothelin-1 induces changes in the expression levels of steroidogenic enzymes and increases androgen receptor and testosterone production in the PC3 prostate cancer cell line". Oncology Reports 46, no. 2 (2021): 171. https://doi.org/10.3892/or.2021.8122
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team