Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Experimental and Therapeutic Medicine
Join Editorial Board Propose a Special Issue
Print ISSN: 1792-0981 Online ISSN: 1792-1015
Journal Cover
September-2018 Volume 16 Issue 3

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
September-2018 Volume 16 Issue 3

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Wnt3a‑regulated TCF4/β‑catenin complex directly activates the key Hedgehog signalling genes Smo and Gli1

  • Authors:
    • Youpei Wang
    • Peipei Lin
    • Qing Wang
    • Meiqin Zheng
    • Lingxia Pang
  • View Affiliations / Copyright

    Affiliations: Clinical Laboratory, The Affiliated Eye Hospital of Wenzhou Medical University, Wenzhou, Zhejiang 325000, P.R. China, Central Blood Station of Wenzhou, Wenzhou, Zhejiang 325000, P.R. China, Function Experiment Teaching Center, Wenzhou Medical University, Wenzhou, Zhejiang 325305, P.R. China
  • Pages: 2101-2107
    |
    Published online on: June 29, 2018
       https://doi.org/10.3892/etm.2018.6379
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

The Wnt and Hedgehog signalling pathways serve key roles in diverse developmental processes. However, the molecular associations between these two signalling pathways remains unclear. Previous transcriptome studies on human foreskin fibroblasts have indicated that Wnt signalling activation induces the expression of key Hedgehog signalling genes, including smoothened, frizzled class receptor (Smo) and GLI family zinc finger 1 (Gli1). Reverse transcription‑quantitative polymerase chain reaction (RT‑qPCR) results revealed that Wnt3a treatment induced the expression of the key Hedgehog signalling genes, including Smo, patched (PTCH), Gli1, Gli2 and Gli3. In addition, western blot analyses demonstrated that Wnt3a treatment resulted in the accumulation of cellular Smo and Gli proteins. Furthermore, promoter sequence analysis revealed that the putative β‑catenin/T‑cell factor (TCF)‑4 complex binding motifs (T/AC/GAAAG) were located within 1.5 kb of the Smo and Gli1 promoters. Results of the chromatin immunoprecipitation experiments and yeast‑one hybrid assays revealed that TCF4 directly binds to the Smo and Gli1 promoters, with two binding sites for Smo and a single binding site for Gli1. Further analysis showed that the β‑catenin/TCF4 complex binds to the Smo and Gli1 promoters. To investigate the functions of TCF4 and β‑catenin in transcriptional regulation of Smo and Gli1, TCF4 and β‑catenin were transiently expressed in fibroblast cells. RT‑qPCR results demonstrated that overexpression of TCF4 and β‑catenin induced the expression of Smo and Gli1. In addition, small interfering RNA‑mediated suppression of β‑catenin resulted in the downregulation of Smo and Gli1 expression levels, even under Wnt3a treatment. Suppression of β‑catenin and Gli1 expression inhibited cell proliferation. Taken together, the results of the present study suggested that the β‑catenin/TCF4 complex directly activates Smo and Gli1 by binding to their promoters, which in turn controls cell proliferation in human fibroblasts.

Introduction

The canonical Wnt signalling pathway, also known as the Wnt/β-catenin or the β-catenin/T-cell factor (TCF) pathway (1), modulates diverse biological processes via signal transduction (2–4). The key step in Wnt/β-catenin signalling pathway is the stabilization and accumulation of cytosolic β-catenin. Under normal conditions without stimulation, β-catenin is constantly phosphorylated by the glycogen synthase kinase-3β (GSK3β) complex (5). Phosphorylated β-catenin is subsequently ubiquitinated and targeted for degradation by the 26s proteasome (5,6). Wnt signalling activation leads to the inhibition of GSK3β activity and β-catenin accumulation in the cytosol and nucleus. In the nucleus, β-catenin forms a complex with T-cell factor/lymphoid enhancer binding factor (TCF/LEF) and induces the expression of downstream genes involved in Wnt signalling (5). A genome-wide scan of TCF/LEF binding sites revealed that TCF/LEF binds to the putative cis-elements (T/AC/GAAAG) in the target gene promoters (7).

Hedgehog signalling plays important roles in both vertebrate and invertebrate development (8). Hedgehog was first identified as a secreted signalling protein whose expression is induced in the Drosophila melanogaster embryonic segment (9). The three mammalian Hedgehog (hh) genes, namely, Sonic hedgehog, Indian hedgehog, and Desert hedgehog, are important in the patterning of many tissues and biological structures (9). In addition, abnormal activation of Hedgehog signalling is required for nearly all basal cell carcinomas, medulloblastomas, and rhabdomyosarcomas; however, overactivation of Hedgehog signalling has also been observed in some tumours (8,10–12). In the absence of Hedgehog stimulation, the transmembrane protein Patched1 (Patch1) interacts with Smoothened (Smo), another transmembrane protein that maintains inactivity of the Hedgehog pathway. Sonic hedgehog binds to and inactivates Patch1 after secretion, leading to Smo activation (11,13) and subsequent transcription of downstream genes via the GLI-Kruppel family transcription factors (13). Among the three GLI-Kruppel family members (Glis), Gli1 and Gli2 are positive regulators, while Gli3 is a negative regulator (14). Gli1 overexpression was associated with promoting gastric initiation and progression in patients (14). A previous study identified the novel function of Gli1 in modulating E-cadherin/β-catenin-regulated cancer cell properties. Gli1 was demonstrated to interfere with membrane localization of E-cadherin by upregulating MUC5AC, a gel-forming mucin, which in turn weakens E-cadherin-dependent cell-cell adhesion and promotes cell migration and invasiveness in pancreatic ductal adenocarcinoma (15). In addition, Gli3 deficient showed prevention of premature fusion of calvarial suture in mice via eliminate one allele of a key transcription factor Runx2 (16).

The extracellular matrix (ECM) is the largest component of the dermal skin layer (17). Fibroblasts are known to participate in ECM assembly and remodelling (18,19), demonstrating their important roles in wound repair. More recently, Wnt signalling was found to be involved in human fibroblast repair (20). In our transcriptome study using Wnt3a-stimulated cells, Wnt signalling activation was observed to alter the expression patterns of a large number of genes, including Hedgehog signalling genes (21). In addition, Hedgehog signalling genes have been demonstrated to regulate fibroblast repair and are controlled by β-catenin, a Wnt signalling regulator (22). However, the association between Wnt and Hedgehog signalling pathways remain unclear.

In the present study, we further examined regulation of Hedgehog signalling genes by Wnt signalling by examining the gene expression profiles of Hedgehog signalling genes under Wnt3a stimulation. In addition, promoter sequence analysis combined with ChIP and yeast-one hybrid assays were performed to explore the potential mechanisms that mediate the activation of Smo and Gli1 transcription by β-catenin/TCF4 complex. Next, TCF4 and β-catenin were transiently overexpressed in fibroblasts, after which Smo and Gli1 expression levels were determined. In addition, β-catenin expression was suppressed via siRNA transfection, and Smo and Gli1 levels were monitored. In conclusion, our analyses indicated that the β-catenin/TCF4 complex directly regulates Smo and Gli1 transcription, which provided direct evidence for the link between the Wnt and Hedgehog signalling pathways.

Materials and methods

Human foreskin fibroblast cell culture

Human foreskin samples were isolated from 4 patients in the Department of Dermatology, the First Affiliated Hospital, Wenzhou Medical University (Wenzhou, China). The present study was approved by the Ethics Committee of Wenzhou Medical University (Wenzhou, Zhejiang, China) and written informed consent was obtained from all of the patients involved (21). All the procedures followed for purification and culture of human fibroblasts were described by Xuan et al (23).

Cell culture

Human foreskin fibroblast cells were cultured for 12 h at 37°C in an incubator with 5% CO2 in Petri dishes and subsequently cultured into a monolayer until reaching confluence (23). Afterwards, cells were cultured in DMEM containing 0.5% FBS and treated with Wnt3a (100 ng/ml). Cells were harvested after 0, 1, and 3 h of Wnt3a treatment.

Yeast-one hybrid assay

For the yeast one-hybrid assay, the 1.5-kb promoters of Smo and Gli1 were synthesized by Sangon Biotech (www.sangon.com/) and subsequently cloned into the pHISi vector. The TCF4 ORF sequences were cloned into the pGAD424 yeast expression vector. The pGAD424-TCF4 and pSmo-His, mpSmo-His, pGli1-His, or mpGli1-His were transformed into the yeast one-hybrid bait strain (YM4271). The growth of yeast cells was monitored on synthetic dropout Leu or His.

ChIP assay

Chromatin immunoprecipitation (ChIP) assay was performed using a chromatin immunoprecipitation assay kit (cat no. 17-295, Millipore, Billerica, MA) according to the manufacturer's instructions. Immunoglobulin (1 µg; IgG; Abcam, ab172730), anti-TCF4 antibody (Cell Signaling Technology, 2566), and anti-β-catenin antibody (Abcam, ab32572) were used for immunoprecipitation (24). The immunoprecipitated DNA fragments were analysed via quantitative PCR. Primer sequences used for ChIP-PCR are listed in Table I.

Table I.

Primer sequences.

Table I.

Primer sequences.

PrimerSequences (5′-3′)
Smo F ACCTATGCCTGGCACACTTC
Smo R AGGAAGTAGCCTCCCACGAT
PTCH F CAAACTCCTGGTGCAAACCG
PTCH R CCGGGATTCTCAGCCTTGTT
Gli1 F CCAGAGTTCAAGAGCCTGG
Gli1 R CCTCGCTCCATAAGGCTCAG
Gli2 F GTTCCAAGGCCTACTCTCGCCTG
Gli2 R CTTGAGCAGTGGAGCACGGACAT
Gli3 F GGGTGAACAGCATCAAAATGGAG
Gli3 R CCGATAGCCATGTTGGTGG
TCF4 F AGAGCGACAAGCCCCAGAC
TCF4 R ATTCGCTGCGTCTCCCATC
β-catenin F TCGCCAGGATGATCCCAGC
β-catenin R GCCCATCCATGAGGTCCTG
GAPDH F GACCTGCCGTCTAGAAAAAC
GAPDH R CTGTAGCCAAATTCGTTGTC
Smo F1 F CGTTGAGGGAGACTTGCTTA
Smo F1 R CTTGGATGAATACCTGTGGC3
Smo F2 F CTCTGAGTGACTCCGAGGTTAT
Smo F2 R TAGTTGGTCCTAAGGTTGTTTG
Gli1 F3 F TGAAGTCTTATTCCCTCCCAC
Gli1 F3 R TCCCTCTACCATTTCTTGTTCT

[i] F, forward; R, reverse; Smo, smoothened, frizzled class receptor; Gli, GLI family zinc finger; TCF4, T-cell factor 4; PTCH, patched.

Western blot analysis

Cells were lysed in an ice-cold lysis solution [7 M urea, 2 M thiourea, 2% CHAPS, 40 mM Trizma base, 40 mM dithiothreitol (DTT), and 1% protease inhibitor]. After complete lysis of the cells and centrifugation at 15,000 × g for 15 min, the total protein concentration in the supernatant was measured using a Bradford protein assay kit (Bio-Rad, Richmond, CA, USA). Proteins were separated via SDS-PAGE and electrotransferred onto Immobilon-P Transfer Membranes (Millipore, Tokyo, Japan). Membranes were incubated in TBS containing 5% skim milk and 0.05% Tween-20 for 1 h and subsequently blotted with primary antibodies at 4°C overnight. Anti-Smo antibody (1:1,000, Abcam, ab72130), anti-Gli1 antibody (1:2,000, Abcam, ab49314), and anti-glyceraldehyde 3-phosphate dehydrogenase (GAPDH; Abcam, ab8245) were used as the primary antibodies. Membranes were incubated for 1 h with an anti-mouse or anti-rabbit HRP-linked secondary antibody (1:2,000; Cell Signaling Technology).

Total RNA extraction, cDNA synthesis, and reverse transcription-quantitative polymerase chain reaction (RT-qPCR)

Total RNA (1 µg) was extracted from human foreskin fibroblast cells and reverse-transcribed using a GoScript Reverse Transcription Kit (Reverse Transcription System, Promega) according to the manufacturer's instructions. Gene expression was quantified via RT-qPCR as previously described (25). A SYBR Green Master Mix kit (Bio-Rad Laboratories, Inc., Hercules, CA, USA) was used for performing qPCR on an Illumina Eco 3.0 (Illumina, Inc., San Diego, CA, USA). A typical reaction consisted of an initial denaturation at 95°C for 3 min, followed by 40 cycles of denaturation for 30 sec at 95°C, annealing for 30 sec at 55°C and extension at 72°C for 30 sec, followed by a final extension at 72°C for 5 min. The transcription levels were normalized against those of GAPDH using the 2−ΔΔCq method (26). Primer sequences used for RT-qPCR are listed in Table I.

Overexpression (OX) and RNA interference

Open reading frame (ORF) regions of TCF4 (NM_013685.2, NCBI) and β-catenin (NM_001165902.1, NCBI) were synthesized and cloned into the pcDNA3.1 (+) vector to generate the TCF4 OX and β-catenin OX constructs. siRNA targeting β-catenin (ON-TARGET plus SMART pool, L-004018), siRNA targeting Gli1 (ON-TARGETplus SMART pool, J-041026-05), and negative control siRNA (ON-TARGETplus Non-targeting Control Pool, D-001810) were purchased from Dharmacon RNA Technologies (Chicago, IL, USA). Fibroblast cells were seeded for 12 h before transfection and allowed to reach 30 to 50% confluence at the time of transfection. Afterwards, 30 nM siRNA duplex and 2 µg of TCF4 OX or β-catenin OX plasmids were transfected on day 0 using Lipofectamine 2000 (Invitrogen) and Opti-MEM®I Reduced Serum Medium (Gibco) according to the manufacturer's instructions. Cells reached confluence at 24 h after transfection, and the OX or siRNA solutions were replaced with full growth medium. The transfected cells were used for two experiments, namely, cell migration assay (60–80% confluence at the time of cell migration assay on day 2) and RT-qPCR (up to a density of 80–90% confluence at the time of harvest for RNA preparation on day 3).

Cell proliferation assay

Cell proliferation was examined after siRNA treatment. Proliferation ability was measured using a CCK-8 Kit (Dojindo Bio., Japan) according to the manufacturer's instructions. The cell densities of the β-catenin and Gli1 siRNA-transfected cells were analysed relative to those of the control group as previously described (23).

Statistical analysis

Statistical calculations were performed using GraphPad Prism 5 software (GraphPad Software, Inc., La Jolla, CA, USA). Data are expressed as the mean ± standard deviation. Significant differences between groups were analysed by one-way analysis of variance, followed by Bonferroni's multiple comparison post hoc tests. P<0.05 was considered to indicate a statistically significant difference.

Results

Wnt3a induced the expression of Hedgehog signalling genes

To verify the effect of Wnt3a on the expression of hedgehog signalling genes, human fibroblast cells were treated with Wnt3a (100 ng/ml) for 1 and 3 h. RT-qPCR assay was performed to monitor the expression of Smo, PTCH, Gli1, Gli2, and Gli3. The results indicated that expression of all the above mentioned genes was induced by Wnt3a treatment, and peak expression levels for all genes tested were detected after 3 h of Wnt3a treatment (Fig. 1A). Western blot analysis was performed to verify the results of RT-qPCR analysis. Consistent with the results of RT-qPCR, western blotting results revealed that Smo and Gli1 expression was induced after 3 h of Wnt3a treatment (Fig. 1B).

Figure 1.

Wnt3a treatment induced the expression of Hedgehog signalling genes. (A) Smo, PTCH, Gli1, Gli2 and Gli3 expression levels were analysed following 0, 1 and 3 h of Wnt3a treatment. Data are expressed as means ± standard error (n=3). (B) Western blot analysis was performed to determine Smo and Gli1 levels following 0, 1 and 3 h of Wnt3a treatment. GAPDH was used as the loading control. The experiments were repeated thrice. *P<0.05 and **P<0.01 vs. 0 h. Smo, smoothened, frizzled class receptor; Gli, GLI family zinc finger; PTCH, patched.

The β-catenin/TCF4 complex directly activates Smo and Gli1 transcription

Smo and Gli1 are induced by Wnt3a treatment. Therefore, we next determined whether the key Wnt signalling transcription factor complex β-catenin/TCF4 can directly induce the transcription of Smo and Gli1. Promoter sequence analysis revealed that two and one putative TCF/LEF binding motifs (AGAAAG) (7) was located within 1.5 kb of the Smo and Gli1 promoters, respectively (Fig. 2A). To investigate whether β-catenin/TCF4 directly binds to the putative motifs located in the Smo and Gli1 promoters, ChIP assays were performed using antibodies targeting TCF4 or β-catenin, with IgG as the control. Immunoprecipitated DNA fragments were amplified using the primer pairs targeting the F1, F2, and F3 regions of the Smo and Gli1 promoters (Fig. 2B). Data were normalized using the input DNA as template. ChIP-PCR results showed that β-catenin and TCF4 can bind to the F1, F2, and F3 regions (Fig. 2B). To verify the ChIP findings, yeast one-hybrid assay was performed by co-expressing AD (activation domain)-TCF4, and pSmo-His and mpSmo-His or pGli1-His and mpGli1-His (Fig. 2C). The results indicated that cells transfected with AD-TCF4 co-expressing pSmo-His or pGli1-His were able to grow in the SD medium without histidine, whereas cells transfected with AD-TCF4 co-expressing mpSmo-His or mpGli1-His did not grow. All transformants were normally grown in SD medium without leucine (Fig. 2D). The above findings indicated that TCF4 activates the transcription of Smo and Gli1 by binding to their promoters in yeast cells.

Figure 2.

β-catenin/TCF4 complex directly binds to the Smo and Gli1 promoters. (A) Schematic diagram indicating the locations of the putative TCF binding motifs (grey circles) within 1.5 kb of the Smo and Gli1 promoters. (B) ChIP assay was performed by amplifying immunoprecipitated DNA from the F1, F2 and F3 regions; the relative ratios of immunoprecipitated DNA and input DNA were determined via ChIP-polymerase chain reaction. Data are expressed as means ± standard error (n=3). *P<0.05 vs. IgG. (C) The 1.5-kb regions of the Smo and Gli1 promoters with or without mutations at the TCF4 binding motif were cloned into the pHISi vector, which utilizes His as a reporter gene. Grey circles indicate TCF4 binding motifs, while ‘X’ marks indicate mutations in the TCF4 binding sequences. (D) Yeast one-hybrid assay was performed to analyse the binding of tTCF4 with the Smo and Gli1 promoters. Yeast cells harbouring AD-TCF4 and pSmo-His and mpSmo-His or pGli1-His and mpGli1-His were grown on synthetic defined medium lacking Leu or His. TCF4, antibody; Ab, antibody; IgG, immunoglobulin G; TCF4, T-cell factor 4; Smo, smoothened, frizzled class receptor; Gli, GLI family zinc finger; ChIP, chromatin immunoprecipitation.

Overexpression of TCF4 and β-catenin activated Smo and Gli1

Given that TCF4 and β-catenin bind to the Smo and Gli1 promoters, their expression levels were further analysed in the TCF4- and β-catenin-overexpressing cells. TCF4 and β-catenin were transiently overexpressed (TCF4 OX and β-catenin OX) in human fibroblasts by transformation of the plasmids pcDNA3.1-TCF4 or pcDNA3.1-β-catenin using Lipofectamine 2000 reagent. Gene expression analysis via RT-qPCR revealed that TCF4 and β-catenin were significantly upregulated after 24 h of transfection (Fig. 3). In addition, Smo and Gli1 expression levels showed 2.2- and 2.8-fold upregulation in TCF4 OX cells relative to control cells, respectively (Fig. 3A). In addition, the results showed that Smo and Gli1 expression levels were upregulated by 2.2- and 2.6-fold in β-catenin OX cells relative to control cells, respectively (Fig. 3B).

Figure 3.

Overexpression of TCF4 and β-catenin activates the transcription of Smo and Gli1. (A) Full-length open reading frames of TCF4 and β-catenin were transiently expressed using Lipofectamine 2000 reagent, and the transcription levels of (A) TCF4 and (B) β-catenin were monitored in non-transformed (Control) and transformed cells via reverse transcription-quantitative polymerase chain reaction. Smo and Gli1 levels were analysed in control cells and in cells overexpressing TCF4 or β-catenin. Data are expressed as the mean ± standard error (n=3). GAPDH was used as an internal control. *P<0.05 and ***P<0.001 vs. control. TCF4, T-cell factor 4; Smo, smoothened, frizzled class receptor; Gli, GLI family zinc finger; OX, overexpression.

Suppression of β-catenin reduced Smo and Gli1 levels with or without Wnt3a stimulation

Considering that overexpression of TCF4 and β-catenin induced Smo and Gli1 expression, TCF4 and β-catenin levels were further analysed in the β-catenin siRNA-transfected human fibroblast cells with or without Wnt3a treatment. RT-qPCR results indicated that transfection with β-catenin-specific siRNA significantly downregulated the expression of β-catenin independent of Wnt3a treatment (about 60–70%), and Wnt3a treatment induced β-catenin levels (Fig. 4). Wnt3a treatment also upregulated Smo and Gli1 expression in cells with or without Wnt3a stimuli; however, the relative increases in expression were lower in β-catenin siRNA-transfected cells compared to those of control cells. Furthermore, siRNA suppression of β-catenin expression significantly reduced Smo and Gli1 levels in human fibroblasts (Fig. 4).

Figure 4.

β-catenin suppression downregulates the transcript levels of Smo and Gli1. β-catenin, Smo and Gli1 levels were analysed in cells transfected with control (scrambled) siRNA and β-catenin siRNA with or without Wnt3a stimulation. Data are expressed as the mean ± standard error (n=3). GAPDH was used as an internal control. *P<0.05 vs. control. Smo, smoothened, frizzled class receptor; Gli, GLI family zinc finger; siRNA, small interfering RNA.

Effects of β-catenin and Gli1 suppression on cell proliferation in fibroblasts

Given that the Wnt and Hedgehog signalling pathways have been demonstrated to be involved in cell proliferation, we examined the effects of β-catenin and Gli1 suppression on fibroblast proliferation. Before evaluating cell proliferation ability, fibroblasts were transfected with Gli1 siRNA and control siRNA, after which Gli1 expression levels were measured by RT-qPCR. Gli1 was significantly downregulated in Gli1-siRNA transfected cells relative to those of control cells (Fig. 5A). In addition, cell proliferation rates were determined in β-catenin and Gli1 siRNA-transfected cells relative to those of the control group. Cell density measurements evidently showed that suppression of β-catenin and Gli1 inhibited cell proliferation (Fig. 5B).

Figure 5.

Effects of β-catenin and Gli1 siRNA transfection on the cell proliferation of human foreskin fibroblasts. (A) Gli1 levels were analysed in cells transfected with control (scrambled) siRNA and Gli1 siRNA. Gli1 expression levels were normalized against those of GAPDH. (B) Cell proliferation was monitored in β-catenin and Gli1 siRNA-transfected fibroblasts. Data are expressed as the mean ± standard error (n=3). *P<0.05 vs. control. Gli, GLI family zinc finger; siRNA, small interfering RNA; OD, optical density.

Discussion

The skin is the tissue layer that protects the body from external damage. Fibroblasts are a cell type that play a major role in wound repair. Extensive studies have been conducted to elucidate the regulatory mechanisms underlying fibroblast cell migration and proliferation (20–23). TCF and β-catenin are master transcriptional regulators of Wnt signalling, and nuclear translocation of β-catenin leads to the formation of a TCF/β-catenin transcription factor complex (2–4). GSK3β-β-catenin signalling was reported to regulate cell migration in human fibroblasts via feedback regulation of basic fibroblast signalling (20). Another study demonstrated that key regulators of Hedgehog signalling, including Smo and Gli1, are controlled by β-catenin to modulate fibroblast cell migration (22). In addition, connections between Wnt and hedgehog signalling was reported (27). In colon cancer, GSK3β and CK1α phosphorylate full-length Gli3 (28), leading to the degradation of C-terminal peptides of Gli3 to produce truncated form, Gli3R. Gli3R further inhibits Gli1 activity (29). A negative regulator (kinase) of both Wnt/β-catenin and Hedgehog/Gli signaling pathways, Sufu interacts with β-catenin and Gli1 to modulate their nuclear-cytoplasmic distributions (30,31). However, the relationship between β-catenin and Gli as well as Wnt and hedgehog signalling remains unclear in fibroblasts. Our previous transcriptome study revealed that Wnt3a stimulation in fibroblasts induced the expression of Hedgehog signalling genes, such as Smo, PTCH, and Gli (21). To further confirm the relationship between Wnt and Hedgehog signalling, fibroblast cells were subjected to Wnt3a treatment, and expression patterns of key hedgehog signalling genes were analysed. The results of RT-qPCR and western blot analyses demonstrated that Wnt3a-induced Wnt signalling activation upregulated the expression of Smo, PTCH, Gli1, Gli2, and Gli3 (Fig. 1).

A previous study demonstrated that the TCF/β-catenin complex activates various downstream genes by binding to specific sequences in the promoters of the target genes (7). Interestingly, promoter sequence analysis revealed that the putative TCF/LEF binding motifs (7) to which the TCF/β-catenin complex binds were located within 1.5 kb of the Smo and Gli1 promoters. We next performed ChIP and yeast-one hybrid assays to determine whether the TCF/β-catenin complex directly binds to the Smo and Gli1 promoters. Our findings indicated that the TCF4/β-catenin complex directly binds to two and one TCF/LEF motifs in the Smo and Gli1 promoters, respectively (Fig. 2B).

Given that the TCF4/β-catenin complex binds to the Smo and Gli1 promoters, the expression levels of Smo and Gli1 were examined in the cells overexpressing TCF4 or β-catenin. TCF4 or β-catenin was highly expressed in the cells transfected with pCDNA3.1-TCF4 or pCDNA3.1-β-catenin (Fig. 3). In addition, the results indicated that TCF4 or β-catenin overexpression activated Smo and Gli1 transcription. Moreover, Smo and Gli1 expression levels were examined in β-catenin siRNA-transfected cells. siRNA transfection evidently suppressed β-catenin levels. In addition, Smo and Gli1 levels were lower in β-catenin siRNA-transfected cells compared to those of control cells (Fig. 4), which suggested that β-catenin is located upstream of Smo and Gli1. To confirm whether Wnt3a stimuli-mediated induction of Smo and Gli1 are mediate by β-catenin, control siRNA- and β-catenin siRNA-transfected cells were treated with Wnt3a. The results indicated that Wnt3a induced β-catenin, Smo, and Gli1 expression in both the control siRNA- and β-catenin siRNA-transfected cells (Fig. 4). However, the fold inductions in β-catenin siRNA-transfected cells were lower than those in control cells, suggesting that β-catenin mediates Wnt3a-induced activation of Hedgehog signalling.

We further analysed the biological function of β-catenin as a key regulator of Hedgehog signalling genes. The Wnt signalling pathway is known to regulate cell proliferation (2). Thus, β-catenin and Gli1 expression was suppressed via siRNA transfection of human fibroblasts, and cell proliferation rates were determined. The results suggested that β-catenin and Gli1 participate in the same signalling pathway and act as positive regulators of cell proliferation.

Wnt and Hedgehog signalling play crucial roles in diverse processes involved in mammalian development. In the present study, our findings revealed that the Wnt and Hedgehog signalling pathways directly share a common molecular mechanism, which is the binding of the TCF4/β-catenin complex to Smo and Gli1 promoters in human fibroblasts. Furthermore, β-catenin and Gli1 were demonstrated to positively regulate cell migration and proliferation in human fibroblasts (2; Fig. 5B), thereby demonstrating the strong link between gene regulation and biological function. Previous study showed the post-transcription regulation of Gli family proteins by Wnt signalling regulators GSK3β and CK1α (26–28), but transcriptional regulation between two pathways has not been observed. In this study, we identified a transcriptional regulation between β-catenin and Smo or Gli1, which extended knowledge of Wnt and hedgehog relationship, which could be important for understanding regulatory networks not only in fibroblasts, but also in cancer cells.

Acknowledgements

The authors would like to thank Mr. Rui Wen (Department of Basic Medical Science, Wenzhou Medical University, Zhejiang, China) for their assistance.

Funding

The present study was supported by Wenzhou City Public Welfare Technology Projects (grant no. Y20170033).

Availability of data and materials

The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.

Authors' contributions

YPW, PPL and QW performed the experiments. YPW, MQZ and LXP analyzed and interpreted the data. YPW, MQZ and LXP were the major contributors in writing the manuscript. All authors read and approved the final manuscript.

Ethics approval and consent to participate

The present study was approved by the Ethics Committee of Wenzhou Medical University (Wenzhou, Zhejiang, China) and written informed consent was obtained from all of the patients involved.

Patient consent for publication

The patients provided written informed consent for the publication of any associated data.

Competing interests

The authors declare that they have no competing interests.

References

1 

Shtutman M, Zhurinsky J, Simcha I, Albanese C, D'Amico M, Pestell R and Ben-Ze'ev A: The cyclin D1 gene is a target of the beta-catenin/LEF-1 pathway. Proc Natl Acad Sci USA. 96:5522–5527. 1999. View Article : Google Scholar : PubMed/NCBI

2 

Moon RT, Kohn AD, De Ferrari GV and Kaykas A: WNT and beta-catenin signalling: Diseases and therapies. Nat Rev Genet. 5:691–701. 2004. View Article : Google Scholar : PubMed/NCBI

3 

Clevers H: Wnt/beta-catenin signaling in development and disease. Cell. 127:469–480. 2006. View Article : Google Scholar : PubMed/NCBI

4 

Brack AS, Conboy MJ, Roy S, Lee M, Kuo CJ, Keller C and Rando TA: Increased Wnt signaling during aging alters muscle stem cell fate and increases fibrosis. Science. 317:807–810. 2007. View Article : Google Scholar : PubMed/NCBI

5 

Gordon MD and Nusse R: Wnt signaling: Multiple pathways, multiple receptors, and multiple transcription factors. J Biol Chem. 281:22429–22433. 2006. View Article : Google Scholar : PubMed/NCBI

6 

Aberle H, Bauer A, Stappert J, Kispert A and Kemler R: beta-catenin is a target for the ubiquitin-proteasome pathway. EMBO J. 16:3797–3804. 1997. View Article : Google Scholar : PubMed/NCBI

7 

Schuijers J, Mokry M, Hatzis P, Cuppen E and Clevers H: Wnt-induced transcriptional activation is exclusively mediated by TCF/LEF. EMBO J. 33:146–156. 2014. View Article : Google Scholar : PubMed/NCBI

8 

Bushman W: Hedgehog signaling in development and cancer. Prostate Cancer. 107–118. 2007. View Article : Google Scholar

9 

Taipale J and Beachy PA: The Hedgehog and Wnt signalling pathways in cancer. Nature. 411:349–354. 2001. View Article : Google Scholar : PubMed/NCBI

10 

Beauchamp EM, Ringer L, Bulut G, Sajwan KP, Hall MD, Lee YC, Peaceman D, Ozdemirli M, Rodriguez O, Macdonald TJ, et al: Arsenic trioxide inhibits human cancer cell growth and tumor development in mice by blocking Hedgehog/GLI pathway. J Clin Invest. 121:148–160. 2011. View Article : Google Scholar : PubMed/NCBI

11 

Wang K, Pan L, Che X, Cui D and Li C: Sonic Hedgehog/GLI1 signaling pathway inhibition restricts cell migration and invasion in human gliomas. Neurol Res. 32:975–980. 2010. View Article : Google Scholar : PubMed/NCBI

12 

Huangfu D and Anderson KV: Signaling from Smo to Ci/Gli: Conservation and divergence of Hedgehog pathways from Drosophila to vertebrates. Development. 133:3–14. 2006. View Article : Google Scholar : PubMed/NCBI

13 

Rohatgi R, Milenkovic L and Scott MP: Patched1 regulates hedgehog signaling at the primary cilium. Science. 317:372–376. 2007. View Article : Google Scholar : PubMed/NCBI

14 

Yan R, Peng X, Yuan X, Huang D, Chen J, Lu Q, Lv N and Luo S: Suppression of growth and migration by blocking the Hedgehog signaling pathway in gastric cancer cells. Cell Oncol (Dordr). 36:421–435. 2013. View Article : Google Scholar : PubMed/NCBI

15 

Inaguma S, Kasai K and Ikeda H: GLI1 facilitates the migration and invasion of pancreatic cancer cells through MUC5AC-mediated attenuation of E-cadherin. Oncogene. 30:714–723. 2011. View Article : Google Scholar : PubMed/NCBI

16 

Tanimoto Y, Veistinen L, Alakurtti K, Takatalo M and Rice DP: Prevention of premature fusion of calvarial suture in GLI-Kruppel family member 3 (Gli3)-deficient mice by removing one allele of Runt-related transcription factor 2 (Runx2). J Biol Chem. 287:21429–21438. 2012. View Article : Google Scholar : PubMed/NCBI

17 

Brem H and Tomic-Canic M: Cellular and molecular basis of wound healing in diabetes. J Clin Invest. 117:1219–1222. 2007. View Article : Google Scholar : PubMed/NCBI

18 

Martin P: Wound healing-aiming for perfect skin regeneration. Science. 276:75–81. 1997. View Article : Google Scholar : PubMed/NCBI

19 

Goldin A, Beckman JA, Schmidt AM and Creager MA: Advanced glycation end products: Sparking the development of diabetic vascular injury. Circulation. 114:597–605. 2006. View Article : Google Scholar : PubMed/NCBI

20 

Wang X, Zhu Y, Sun C, Wang T, Shen Y, Cai W, Sun J, Chi L, Wang H, Song N, et al: Feedback activation of basic fibroblast growth factor signaling via the Wnt/β-catenin pathway in skin fibroblasts. Front Pharmacol. 8:322017.PubMed/NCBI

21 

Wang Y, Zheng X, Wang Q, Zheng M and Pang L: Activation of Wnt signaling reduces high-glucose mediated damages on skin fibroblast cells. Iran J Basic Med Sci. 20:944–950. 2017.PubMed/NCBI

22 

Zhu ZX, Sun CC, Zhu Ting Y, Wang Y, Wang T, Chi LS, Cai WH, Zheng JY, Zhou X, Cong WT, et al: Hedgehog signaling contributes to basic fibroblast growth factor-regulated fibroblast migration. Exp Cell Res. 355:83–94. 2017. View Article : Google Scholar : PubMed/NCBI

23 

Xuan YH, Huang BB, Tian HS, Chi LS, Duan YM, Wang X, Zhu ZX, Cai WH, Zhu YT, Wei TM, et al: High-glucose inhibits human fibroblast cell migration in wound healing via repression of bFGF-regulating JNK phosphorylation. PLoS One. 9:e1081822014. View Article : Google Scholar : PubMed/NCBI

24 

Li Y, Wong K, Walsh K, Gao B and Zang M: Retinoic acid receptor β stimulates hepatic induction of fibroblast growth factor 21 to promote fatty acid oxidation and control whole-body energy homeostasis in mice. J Biol Chem. 288:10490–10504. 2013. View Article : Google Scholar : PubMed/NCBI

25 

Zittermann SI and Issekutz AC: Basic fibroblast growth factor (bFGF, FGF-2) potentiates leukocyte recruitment to inflammation by enhancing endothelial adhesion molecule expression. Am J Pathol. 168:835–846. 2006. View Article : Google Scholar : PubMed/NCBI

26 

Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods. 25:402–408. 2001. View Article : Google Scholar : PubMed/NCBI

27 

Song L, Li ZY, Liu WP and Zhao MR: Crosstalk between Wnt/β-catenin and Hedgehog/Gli signaling pathways in colon cancer and implications for therapy. Cancer Biol Ther. 16:1–7. 2015. View Article : Google Scholar : PubMed/NCBI

28 

Tempé D, Casas M, Karaz S, Blanchet-Tournier MF and Concordet JP: Multisite protein kinase A and glycogen synthase kinase 3beta phosphorylation leads to Gli3 ubiquitination by SCFbetaTrCP. Mol Cell Biol. 26:4316–4326. 2006. View Article : Google Scholar : PubMed/NCBI

29 

Wang B and Li Y: Evidence for the direct involvement of {beta}TrCP in Gli3 protein processing. Proc Natl Acad Sci USA. 103:33–38. 2006. View Article : Google Scholar : PubMed/NCBI

30 

Dunaeva M, Michelson P, Kogerman P and Toftgard R: Characterization of the physical interaction of Gli proteins with SUFU proteins. J Biol Chem. 278:5116–5122. 2003. View Article : Google Scholar : PubMed/NCBI

31 

Tukachinsky H, Lopez LV and Salic A: A mechanism for vertebrate Hedgehog signaling: Recruitment to cilia and dissociation of SuFu-Gli protein complexes. J Cell Biol. 191:415–428. 2010. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Wang Y, Lin P, Wang Q, Zheng M and Pang L: Wnt3a‑regulated TCF4/β‑catenin complex directly activates the key Hedgehog signalling genes Smo and Gli1. Exp Ther Med 16: 2101-2107, 2018.
APA
Wang, Y., Lin, P., Wang, Q., Zheng, M., & Pang, L. (2018). Wnt3a‑regulated TCF4/β‑catenin complex directly activates the key Hedgehog signalling genes Smo and Gli1. Experimental and Therapeutic Medicine, 16, 2101-2107. https://doi.org/10.3892/etm.2018.6379
MLA
Wang, Y., Lin, P., Wang, Q., Zheng, M., Pang, L."Wnt3a‑regulated TCF4/β‑catenin complex directly activates the key Hedgehog signalling genes Smo and Gli1". Experimental and Therapeutic Medicine 16.3 (2018): 2101-2107.
Chicago
Wang, Y., Lin, P., Wang, Q., Zheng, M., Pang, L."Wnt3a‑regulated TCF4/β‑catenin complex directly activates the key Hedgehog signalling genes Smo and Gli1". Experimental and Therapeutic Medicine 16, no. 3 (2018): 2101-2107. https://doi.org/10.3892/etm.2018.6379
Copy and paste a formatted citation
x
Spandidos Publications style
Wang Y, Lin P, Wang Q, Zheng M and Pang L: Wnt3a‑regulated TCF4/β‑catenin complex directly activates the key Hedgehog signalling genes Smo and Gli1. Exp Ther Med 16: 2101-2107, 2018.
APA
Wang, Y., Lin, P., Wang, Q., Zheng, M., & Pang, L. (2018). Wnt3a‑regulated TCF4/β‑catenin complex directly activates the key Hedgehog signalling genes Smo and Gli1. Experimental and Therapeutic Medicine, 16, 2101-2107. https://doi.org/10.3892/etm.2018.6379
MLA
Wang, Y., Lin, P., Wang, Q., Zheng, M., Pang, L."Wnt3a‑regulated TCF4/β‑catenin complex directly activates the key Hedgehog signalling genes Smo and Gli1". Experimental and Therapeutic Medicine 16.3 (2018): 2101-2107.
Chicago
Wang, Y., Lin, P., Wang, Q., Zheng, M., Pang, L."Wnt3a‑regulated TCF4/β‑catenin complex directly activates the key Hedgehog signalling genes Smo and Gli1". Experimental and Therapeutic Medicine 16, no. 3 (2018): 2101-2107. https://doi.org/10.3892/etm.2018.6379
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team