Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Oncology Letters
Join Editorial Board Propose a Special Issue
Print ISSN: 1792-1074 Online ISSN: 1792-1082
Journal Cover
January-2019 Volume 17 Issue 1

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
January-2019 Volume 17 Issue 1

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article Open Access

miR-29 promotes osteosarcoma cell proliferation and migration by targeting PTEN

  • Authors:
    • Qiuliang Liu
    • Peishuo Geng
    • Longyan Shi
    • Qi Wang
    • Pengliang Wang
  • View Affiliations / Copyright

    Affiliations: Department of Pediatric Surgery, The First Affiliated Hospital of Zhengzhou University, Zhengzhou, Henan 450052, P.R. China
  • Pages: 883-890
    |
    Published online on: October 31, 2018
       https://doi.org/10.3892/ol.2018.9646
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

Osteosarcoma (OS) is an aggressive malignant neoplasm that arises from primitively transformed cells of mesenchymal origin, and that exhibits osteoblastic differentiation and produces malignant osteoid. MicroRNAs (miRNAs) have been widely reported to have important regulatory roles in various human tumors, including OS. However, the potential mechanism of miR-29 in OS remains largely unknown. miR-29 was highly expressed in OS and overexpression of miR-29 promoted OS cell proliferation, as well as proliferating cell nuclear antigen (PCNA) expression and migration, whereas lower expression of miR-29 inhibited OS cell proliferation, PCNA expression and migration. In the present study, a dual-luciferase reporter system supporting phosphatase and tensin homolog (PTEN) was a target of miR-29 and its expression was inhibited by miR-29 mimic, but increased by miR-29 inhibitor. Overexpression of PTEN inhibited OS cell proliferation and migration and it could attenuate miR-29 promotion effect on OS progression. Overall, the results revealed that miR-29, as a tumor promoter, is involved in OS progression and metastasis by targeting PTEN, indicating that the miR-29/PTEN pathway is a potential therapeutic target for the treatment of OS.

Introduction

Osteosarcoma (OS) is a malignant bone tumor characterized by tumor cells directly forming bone or bone tissues. It often occurs in adolescents or children under the age of 20 and the prognosis is poor (1–3). The current treatment strategy focuses on primary tumors, but it is limited in the treatment of metastatic OS (4). Thus, treating metastatic OS is now a great challenge for oncologists. It is necessary for us to understand the pathogenesis and biological characteristics of metastatic OS and to find new targets and biomarkers for the treatment of OS patients is urgent (5,6).

It is known that, miRNAs can extensively disrupt various functions of different cancers by targeting mRNA (7), and the target mRNA is also proven to regulate cell proliferation, invasion and apoptosis (8). New evidence suggests that miRNAs are involved in human carcinogenesis, including promoting or inhibiting tumor development (9,10). For example, miR-365, miR-124a, miR-625 and miR-141 acted as tumor suppressors in OS (11–14), while miR-504, miR-19 and miR-93 promoted OS cell progression (15–17).

The miR-29 family contains three mature members (miR-29a, miR-29b and miR-29c). An increasing number of studies have shown the decreased expression of miR-29 family in various types of cancer and that it has the ability to suppress tumors, including breast, bladder and pancreatic cancer (18–20). Shin et al found that miR-29b effect on glioblastoma was suppressive (21). Ma et al stated that, miR-29 suppressed schwannoma cell proliferation and motility by regulating CDK6 (22). In colon cancer, miR-29 showed inhibitory effect on cell invasion and migration by regulating MMP2 (23). Additionally, miR-29 suppressed lung cancer development by targeting DNMT3A and DNMT3B (24). However, role of miR-29 in OS and its mechanism have rarely been reported.

It is well known that phosphatase and tensin homolog (PTEN) acts as a tumor suppressor and PTEN expression was proved abnormal in many cancers (25). For instance, PTEN functioned as a tumor inhibitor in regulating pancreatic cancer progression regulated by miR-32 (26). miR-21 modulated gastric cancer development via targeting PTEN (27) and PTEN was also a target of miR-20b in modulating prostate cancer cell viability and migratory ability (28). However, the effect of PTEN on OS cell migration and proliferation and whether PTEN is regulated by miR-29 in OS have yet to be reported.

In our study, miR-29 and PTEN in OS and its potential mechanism in modulating OS cell migration and proliferation was investigated. Our results may provide important insight into the prognosis and treatment of OS.

Materials and methods

OS specimens

We collected conventional OS and adjacent non-cancerous tissues from 60 patients who underwent resection surgery in the First Affiliated Hospital of Zhengzhou University (Zhengzhou, China) between February 2010 and August 2016. None of OS patients had received radiotherapy or chemotherapy before surgery and the tissues were diagnosed as OS by pathologists. All tissue specimens were placed into liquid nitrogen immediately and stored at −80°C in a refrigerator for use in subsequent experiments. The Ethics Committee of Zhengzhou University approved this study and the patients signed informed consent prior to surgery.

Cell lines and cell culture

The purchased OS cell lines (MG-63, U2OS, 143B, Saos-2) were cultured in RPMI-1640 medium at 37°C and the medium contained 20% FBS and penicillin (100 U/ml) and streptomycin (100 µg/ml). hFOB1.19 (normal human osteoblast) cells were cultured in DMEM supplemented with 10% FBS and G418 (0.03 mg/ml) at 34°C with 5% CO2. OS cell lines (MG-63, U2OS, 143B, Saos-2) and hFOB1.19 (normal human osteoblast) cells were obtained from ATCC (Manassas, VA, USA).

Cell transfection

miR-29 mimic or inhibitor provided by Suzhou GenePharma Co., Ltd. (Suzhou, China) was transfected into MG-63 cells to facilitate or inhibit miR-29 expression and control mimic were used as control (con). We added MG-63 cells into 24-well plates containing medium and we performed transfection using Lipofectamine 3000 reagent (Invitrogen; Thermo Fisher Scientific, Inc., Waltham, MA, USA) for 48 h. PTEN vector and con vector were synthesized by GenePharma Co., Ltd. and they were used to enforce PTEN expression and acted as a control separately.

RNA extraction and reverse transcription-quantitative polymerase chain reaction (RT-qPCR)

Total RNA and microRNA were extracted from OS tissues and cells using TRIzol reagent (Invitrogen; Thermo Fisher Scientific, Inc.) according to the manufacturer's protocol. Complementary DNA was synthesized using PrimeScript RT reagent kit and RT-qPCR was performed using SYBR Premix Ex Taq (both from Takara Biotechnology Co., Ltd., Dalian, China) with the Stratagene Mx3000P real-time PCR system (Agilent Technologies, Inc., Santa Clara, CA, USA). The primer sequences used were: miR-29-F: TGCCAGGAGCTGGTGATTTCCT, miR-29-R: ACGGGCGTACAGAGGATCCCC. PTEN-F: GTGCAG ATAATGACAAG, PTEN-R: GATTTGACGGCTCCTCT. proliferating cell nuclear antigen (PCNA)-F: GGTGTTG GAGGCACTCAAGG, PCNA-R: CAGGGTGAGCTGCACC AAAG. U6-F: CTCGCTTCGGCAGCAC, U6-R: ACGCTTC ACGAATTTGC. β-actin-F: GA TCATTGCTCCTCCTGAGC; β-actin-R: ACTCCTGCTTGCTGATCCAC. U6 and β-actin were used as internal controls. Relative expression of miR-29, PTEN and PCNA was calculated by the 2−ΔΔCq method (29).

Western blot analysis

Lysis buffer containing protease inhibitor and phenylmethanesulfonyl fluoride (PMSF) was added into OS tissues or cells and then homogenized on ice (the written informed consent from patients were obtained). After centrifugation at 12,000 × g, at 4°C for 30 min, the supernatant was measured by BCA kit. Then, 50 µg protein specimens at the same concentration were added onto sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE). Proteins were then transferred to polyvinylidene fluoride (PVDF) membranes and blocked with skim milk (5–10%) at room temperature for 2 h subsequently. Then primary antibodies, monoclonal rabbit anti-PTEN (1:1,000, cat. no. 9188; Cell Signaling Technology, Inc., Danvers, MA, USA), monoclonal mouse anti-actin (1:1,000, cat. no. sc-58673; Santa Cruz Biotechnology, Inc., Dallas, TX, USA) were added to incubate the membranes at 4°C overnight and secondary antibodies, monoclonal goat anti-rabbit or anti-mouse IgG-HRP (1:2,000, cat. no. sc-2004; Santa Cruz Biotechnology, Inc.) were later added to incubate the membranes at room temperature (25°C) for 2 h. Finally, the enhanced chemiluminescence kit (ECL; Merck Millipore, Billerica, MA, USA) was used to detect the signals. The relative expression of target proteins was evaluated using target protein/β-actin.

Transwell assay

Transwell assay was used to measure cell migration. Transwell inserts with 8 µm pore size polycarbonic membrane (Corning Costar Corp., Cambridge, MA, USA) were used to divide Transwell chamber into upper and lower chambers. MG-63 cells (5×105/well) with different transfection were placed into the top chambers and DMEM containing 10% FBS into lower chambers and then cultured for 48 h at 37°C under CO2 atmosphere. The cells from the top chambers migrated into the lower chambers, and the cells on the top chambers were removed with cotton. The cells were fixed on lower chambers using 4% formaldehyde for 30 min at room temperature (25°C), cells were stained with 0.1% crystal violet for 15 min, and images of the cells were captured using an inverted microscope (Nikon 80i, Feasterville, PA, USA). Cells were then counted using Living Image Version 4.5 Software (PerkinElmer, Inc., Waltham, MA, USA) image software.

MTT assay

Fresh culture (100 µl) medium was added into 96-well plates to replace the culture medium when the MG-63 cell population reached optimal densities. Then, MTT reagent (20 µl) was added and cultured at 37°C for 4 h. Subsequently, the MTT medium was sucked out and 100 µl of DMSO was added for additional 10 min, the plates were read at a wavelength of 570 nm using the multilabel plate reader (PerkinElmer, Inc.) at 1, 2, 3, 4 days to measure the absorbance of each well.

Luciferase reporter assay

TargetScan Human 7.1 was firstly carried out to identify the possible targets of miR-29. We used Lipofectamine 2000 (Thermo Fisher Scientific, Inc.) to co-transfect miR-29 mimic or control mimic with 3′-UTR of wild or mutated PTEN in MG-63 cells. The dual luciferase reporter system (GeneCopoeia, Inc., Rockville, MD, USA) was then used to measure the luciferase activity of MG-63 cells treated with different transfection.

Statistical analysis

All experiments were repeated three times independently. SPSS v.19.0 software (IBM Corp., Armonk, NY, USA) was used to perform statistical analyses and GraphPad Prism 5.02 software (GraphPad Software, Inc., La Jolla, CA, USA) to complete graph presentations. Results are presented as the mean ± standard deviation, and the data were evaluated using Student's t-test or Tukey's post hoc test after ANOVA in SPSS. P<0.05 was considered to indicate a statistically significant difference.

Results

miR-29 is overexpressed in OS

Our primary aim was to explore miR-29 role in OS. First, we detected miR-29 level in OS tissues and cells using RT-qPCR. As shown in Fig. 1A, miR-29 average level in OS tissues was significantly increased compared with normal tissues. miR-29 expression in OS cells (MG-63, U2OS, 143B, Saos-2) was also elevated compared to normal cells (hFOB1.19), as expected (Fig. 1B). miR-29 expression was also detected in various stages of OS tumors and the results showed that the more advanced the tumor stage, the higher the expression of miR-29 (Fig. 1C), indicating that miR-29 may participate in OS malignant progression.

Figure 1.

miR-29 is increased in OS. (A) Quantification of miR-29 average expression in OS tissues (n=60). (B) miR-29 measured in OS cells and normal cells. (C) Quantification of miR-29 expression in different stages of OS. **P<0.01, ***P<0.001; ##P<0.01. OS, osteosarcoma.

miR-29 mimic promotes OS cell proliferation and migration

Secondly, we measured miR-29 effect on OS progression. We overexpressed miR-29 in MG-63 cells using miR-29 mimic, and mRNA expression was increased significantly (Fig. 2A). Cell proliferation was measured by MTT assay and RT-qPCR. MTT results showed that cell viability in miR-29 mimic group was enhanced in comparison with control mimic group (Fig. 2B). PCNA is a marker for cell proliferation (30,31). RT-qPCR analysis found that PCNA expression was increased in miR-29 mimic group (Fig. 2C). Cell migration measured by Transwell demonstrated that miR-29 mimic promoted OS cell migratory ability (Fig. 2D). The results above demonstrated a promotion effect of miR-29 on OS progression.

Figure 2.

miR-29 mimic promoted OS cell migration and proliferation. (A) Quantification of miR-29 mRNA and protein level in MG-63 cells treated with miR-29 mimic. (B and C) Detection of cell viability by MTT and PCNA expression using RT-qPCR after MG-63 cells restoration of miR-29. (D) Measurement of cell migration by Transwell after MG-63 cell restoration of miR-29. **P<0.01. OS, osteosarcoma; con, control.

Silencing miR-29 curbed OS cell proliferation and migration

We then silenced miR-29 using miR-29 inhibitor to further confirm its effect on OS. The transfection efficiency is shown in Fig. 3A, miR-29 inhibitor group decreased miR-29 expression. As we expected, MTT results showed the decreased cell viability in miR-29 inhibitor group in comparison with the con-inhibitor group (Fig. 3B). RT-qPCR analysis revealed the increased PCNA expression in MG-63 cells after silencing miR-29 (Fig. 3C). Cell migration measured by Transwell showed enhanced cell migratory ability in miR-29 inhibitor group than the con-inhibitor group (Fig. 3D). The results above indicated that silencing miR-29 inhibited the development of OS.

Figure 3.

miR-29 inhibitor curbed OS cell migration and proliferation. (A) Quantification of miR-29 mRNA and protein level in MG-63 cells treated with miR-29 inhibitor. (B and C) Detection of cell viability by MTT and PCNA expression by RT-qPCR after MG-63 cells silencing miR-29. (D) Measurement of cell migration by Transwell after MG-63 cell silencing by miR-29. *P<0.05, **P<0.01, ***P<0.001. OS, osteosarcoma; PCNA, proliferating cell nuclear antigen.

miR-29 targets PTEN in OS

The next step was to investigate miR-29 molecular mechanism in OS. TargetScan Human 7.1 was carried out to identify the possible targets of miR-29 and results are shown in Fig. 4A. As further confirmation, we assessed PTEN protein and mRNA level after MG-63 cell restoration or inhibiting miR-29 via western blot analysis and RT-qPCR. PTEN expression was reduced when miR-29 was restored while increased when inhibiting miR-29 (Fig. 4B). Then, luciferase reporter assay was carried out to determine whether PTEN was a direct target of miR-29 in OS. The luciferase activity of miR-29 mimic group was decreased but increased in miR-29 inhibitor group in wild-type. However, there was no significant effect in mut type (Fig. 4C). The results verified PTEN as a direct target of miR-29. In addition, miR-29 and PTEN expression were negatively correlated (Fig. 4D).

Figure 4.

PTEN is a target of miR-29 in OS. (A) Binding sites of PTEN and miR-29. (B) PTEN protein and mRNA expression detected in MG-63 cells after restoration or silencing miR-29. (C) Detection of PTEN luciferase activity in MG-63 cells after beingtreated with PTEN 3′-UTR WT or MUT and miR-29 mimic. (D) Detection of the relevance of miR-29 and PTEN expression (r= −0.8670, P<0.0001). **P<0.01. OS, osteosarcoma; PTEN, phosphatase and tensin homolog.

PTEN attenuates miR-29 promotion effect on OS progression

Then, we investigated the role of PTEN in OS and whether PTEN affected the miR-29 role in regulating OS progression. PTEN was overexpressed by PTEN vector due to its lower expression in OS. The results showed that PTEN expression was higher after cells were transfected with PTEN vector (Fig. 5A). PTEN overexpressed could inhibit OS cell migration and proliferation (Fig. 5B and C). Subsequently, miR-29 mimic and PTEN vector were co-transfected into MG-63 cells to test the role of PTEN in OS regulated by miR-29. The cell viability and PCNA expression were both increased obviously by miR-29 mimic in comparison with control (Fig. 5D). By contrast, overexpression of both miR-29 and PTEN, cell proliferation was reduced compared with overexpression of miR-29 alone, indicating that PTEN could attenuate miR-29 promotion effect on cell proliferation. Additionally, the migration results suggested that miR-29 promotion increased migration in OS cells compared with control, whereas promoting both miR-29 and PTEN reduced cell migration in comparison with promoting miR-127 alone, suggesting that PTEN could reverse miR-29 promotion effect on OS cell migration. In summary, miR-29 could facilitate OS cell migration and proliferation by targeting PTEN.

Figure 5.

PTEN attenuates miR-29 promotion effect on OS cell migration and proliferation. (A) PTEN mRNA and protein expression quantified in MG-63 cells after overexpression of PTEN. (B) Measurement of cell migration by Transwell after MG-63 cell overexpression of PTEN. (C) Detection of cell viability by MTT and PCNA expression using RT-qPCR after MG-63 cells after overexpression of PTEN. (D) Detection of cell viability by MTT and PCNA expression by RT-qPCR after MG-63 cell re-expression of miR-29 alone or both miR-29 and PTEN. (E) Detection of cell migration by Transwell after MG-63 cell re-expression of miR-29 alone or both miR-29 and PTEN. *P<0.05, **P<0.01, ***P<0.001; #P<0.05, ##P<0.01. OS, osteosarcoma; PTEN, phosphatase and tensin homolog; PCNA, proliferating cell nuclear antigen.

Discussion

An increasing number of studies have reported the important roles of miRNAs in tumorigenesis and tumor development (32). Furthermore, the ability to control cell growth, metastasis and survival may serve essential roles in preventing and treating various human malignancies, including OS (33). miR-29 was reported to have significant inhibitory effect on various cancers. For example, it inhibited hepatocellular carcinoma cell migration and proliferation by regulating IGF1R (34). miR-29 played a tumor suppressive role in modulating gliomas through targeting CDC42 (35). However, Gao et al reported that miR-29 played a promoting role in OS (36) and Hong et al showed the same discovery that miR-29 expression was higher in OS patients (37). Those results were in line with our findings that miR-29 expression was upregulated in OS tissues and cells, but these studies did not show the function of miR-29 in OS tumorigenesis and development. In the present study, we first demonstrated that restoration of miR-29 facilitated cell migration and proliferation, while inhibiting miR-29 showed inhibitory effect.

PTEN was the first tumor suppressor gene found with a bispecific phosphatase activity and closely associated with carcinoma (38). PTEN suppressed the migration and genetic deletion of the PTEN tumor suppressor gene, promoting cell motility and overexpression or reconstitution of PTEN and inhibiting cell motility in a variety of cell types (39,40). Hundreds of genes were found to be the target of miRNA, which harbors the target sequence in their 3′-UTR complementary to the seed region of the miRNA. PTEN was also proven to be a target of miRNAs in modulating cancer progression. PTEN was the target of miR-28 and suppressed gastric cancer cell proliferation and invasion (41). Additionally, it suppressed renal cancer cell proliferation as a target of miR-30a (42). Zhao et al reported that PTEN regulated OS cell growth and apoptosis and acted as a target of miR-19 (43). We also found that the PTEN mRNA expression was downregulated in MG63 cells compared with the hFOB1.19 cells (data not shown). However, the underlying mechanism between miR-29 and PTEN was still unclear in OS. In our study, we found that miR-29 could negatively regulate the expression of PTEN in MG63 cells. Further investigation was conducted to explore the molecular mechanism how PTEN promoted OS cell proliferation and migration. In addition, PTEN overexpressed was proved to inhibit OS cell proliferation and migration, PTEN could reverse miR-29 promotion effect on OS progression as well. Therefore, to the best of our knowledge, the present study provided an effective treatment target in OS.

In conclusion, miR-29 facilitated OS migration and proliferation and this is the first report that miR-29 targeted PTEN and regulated OS development. Furthermore, PTEN could reverse miR-29 promotion effect on OS providing a new idea for OS therapy.

Acknowledgements

Not applicable.

Funding

This study received the specific grant from the Co-construction project of Henan Provincial Medical Science and Technology Key Project (grant no. 201401007).

Availability of data and materials

The datasets generated or analyzed during the present study are available from the corresponding author on reasonable request.

Authors' contributions

QL was a major contributor in writing the manuscript and contributed to the conception of the study. PG contributed significantly to data analysis and manuscript preparation. LS performed the data analyses and wrote the manuscript. QW and PW helped perform the data analysis with constructive discussions. All authors read and approved the final study.

Ethics approval and consent to participate

The study was approved by the Ethics Committee of The First Affiliated Hospital of Zhengzhou University (Zhengzhou, China). Signed informed consents were obtained from all participants.

Patient consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

References

1 

Endo-Munoz L, Evdokiou A and Saunders NA: The role of osteoclasts and tumour-associated macrophages in osteosarcoma metastasis. Biochim Biophys Acta. 1826:434–442. 2012.PubMed/NCBI

2 

Harting MT and Blakely ML: Management of osteosarcoma pulmonary metastases. Semin Pediatr Surg. 15:25–29. 2006. View Article : Google Scholar : PubMed/NCBI

3 

Jia S and Li B: Osteosarcoma of the jaws: Case report on synchronous multicentric osteosarcomas. J Clin Diagn Res. 8:ZD01–ZD03. 2014.PubMed/NCBI

4 

He JP, Hao Y, Wang XL, Yang XJ, Shao JF, Guo FJ and Feng JX: Review of the molecular pathogenesis of osteosarcoma. Asian Pac J Cancer Prev. 15:5967–5976. 2014. View Article : Google Scholar : PubMed/NCBI

5 

Egas-Bejar D, Anderson PM, Agarwal R, Corrales-Medina F, Devarajan E, Huh WW, Brown RE and Subbiah V: Theranostic profiling for actionable aberrations in advanced high risk osteosarcoma with aggressive biology reveals high molecular diversity: The human fingerprint hypothesis. Oncoscience. 1:167–179. 2014. View Article : Google Scholar : PubMed/NCBI

6 

Poletajew S, Fus L and Wasiutyński A: Current concepts on pathogenesis and biology of metastatic osteosarcoma tumors. Ortop Traumatol Rehabil. 13:537–545. 2011. View Article : Google Scholar : PubMed/NCBI

7 

Xu C, Ping Y and Li X, Zhao H, Wang L, Fan H, Xiao Y and Li X: Prioritizing candidate disease miRNAs by integrating phenotype associations of multiple diseases with matched miRNA and mRNA expression profiles. Mol Biosyst. 10:2800–2809. 2014. View Article : Google Scholar : PubMed/NCBI

8 

Gaál Z and Oláh E: MicroRNA-s and their role in malignant hematologic diseases. Orv Hetil. 153:2051–2059. 2012.(In Hungarian). View Article : Google Scholar : PubMed/NCBI

9 

Lin S, Pan L, Guo S, Wu J, Jin L, Wang JC and Wang S: Prognostic role of microRNA-181a/b in hematological malignancies: A meta-analysis. PLoS One. 8:e595322013. View Article : Google Scholar : PubMed/NCBI

10 

Kalinowski FC, Brown RA, Ganda C, Giles KM, Epis MR, Horsham J and Leedman PJ: microRNA-7: A tumor suppressor miRNA with therapeutic potential. Int J Biochem Cell Biol. 54:312–317. 2014. View Article : Google Scholar : PubMed/NCBI

11 

Xu Y, Chu H, Zhou Y, Wang J, Dong C and Yin R: miR-365 functions as a tumor suppressor by directly targeting CYR61 in osteosarcoma. Biomed Pharmacother. 98:531–537. 2018. View Article : Google Scholar : PubMed/NCBI

12 

Yu L, Wang S, Lin X, Lu Y and Gu P: MicroRNA-124a inhibits cell proliferation and migration in liver cancer by regulating interleukin-11. Mol Med Rep. 17:3972–3978. 2018.PubMed/NCBI

13 

Luo Z, Wu G, Zhang D, Liu J and Ran R: microRNA 625 targets Yes associated protein 1 to suppress cell proliferation and invasion of osteosarcoma. Mol Med Rep. 17:2005–2011. 2018.PubMed/NCBI

14 

Wang N, Li P, Liu W, Wang N, Lu Z, Feng J, Zeng X, Yang J, Wang Y and Zhao W: miR-141-3p suppresses proliferation and promotes apoptosis by targeting GLI2 in osteosarcoma cells. Oncol Rep. 39:747–754. 2018.PubMed/NCBI

15 

He Y and Yu B: MicroRNA-93 promotes cell proliferation by directly targeting P21 in osteosarcoma cells. Exp Ther Med. 13:2003–2011. 2017. View Article : Google Scholar : PubMed/NCBI

16 

Sun Z, Liu Q, Hong H, Zhang H and Zhang T: miR-19 promotes osteosarcoma progression by targeting SOCS6. Biochem Biophys Res Commun. 495:1363–1369. 2018. View Article : Google Scholar : PubMed/NCBI

17 

Cai Q, Zeng S, Dai X, Wu J and Ma W: miR-504 promotes tumour growth and metastasis in human osteosarcoma by targeting TP53INP1. Oncol Rep. 38:2993–3000. 2017. View Article : Google Scholar : PubMed/NCBI

18 

Wu Z, Huang X, Huang X, Zou Q and Guo Y: The inhibitory role of Mir-29 in growth of breast cancer cells. J Exp Clin Cancer Res. 32:982013. View Article : Google Scholar : PubMed/NCBI

19 

Lv M, Zhong Z, Huang M, Tian Q, Jiang R and Chen J: lncRNA H19 regulates epithelial-mesenchymal transition and metastasis of bladder cancer by miR-29b-3p as competing endogenous RNA. Biochim Biophys Acta. 1864:1887–1899. 2017. View Article : Google Scholar

20 

Kwon JJ, Willy JA, Quirin KA, Wek RC, Korc M, Yin XM and Kota J: Novel role of miR-29a in pancreatic cancer autophagy and its therapeutic potential. Oncotarget. 7:71635–71650. 2016. View Article : Google Scholar : PubMed/NCBI

21 

Shin J, Shim HG, Hwang T, Kim H, Kang SH, Dho YS, Park SH, Kim SJ and Park CK: Restoration of miR-29b exerts anti-cancer effects on glioblastoma. Cancer Cell Int. 17:1042017. View Article : Google Scholar : PubMed/NCBI

22 

Ma J, Li T, Yuan H, Han X, Shui S, Guo D and Yan L: MicroRNA-29a inhibits proliferation and motility of schwannoma cells by targeting CDK6. J Cell Biochem. 119:2617–2626. 2018. View Article : Google Scholar : PubMed/NCBI

23 

Ding Q, Chang CJ, Xie X, Xia W, Yang JY, Wang SC, Wang Y, Xia J, Chen L, Cai C, et al: APOBEC3G promotes liver metastasis in an orthotopic mouse model of colorectal cancer and predicts human hepatic metastasis. J Clin Invest. 121:4526–4536. 2011. View Article : Google Scholar : PubMed/NCBI

24 

Fabbri M, Garzon R, Cimmino A, Liu Z, Zanesi N, Callegari E, Liu S, Alder H, Costinean S, Fernandez-Cymering C, et al: MicroRNA-29 family reverts aberrant methylation in lung cancer by targeting DNA methyltransferases 3A and 3B. Proc Natl Acad Sci USA. 104:15805–15810. 2007. View Article : Google Scholar : PubMed/NCBI

25 

Boosani CS and Agrawal DK: PTEN modulators: A patent review. Expert Opin Ther Pat. 23:569–580. 2013. View Article : Google Scholar : PubMed/NCBI

26 

Gao ZQ, Wang JF, Chen DH, Ma XS, Wu Y, Tang Z and Dang XW: Long non-coding RNA GAS5 suppresses pancreatic cancer metastasis through modulating miR-32-5p/PTEN axis. Cell Biosci. 7:662017. View Article : Google Scholar : PubMed/NCBI

27 

Wang P, Guan Q, Zhou D, Yu Z, Song Y and Qiu W: miR-21 inhibitors modulate biological functions of gastric cancer cells via PTEN/PI3K/mTOR pathway. DNA Cell Biol. 37:38–45. 2018. View Article : Google Scholar : PubMed/NCBI

28 

Guo J, Xiao Z, Yu X and Cao R: miR-20b promotes cellular proliferation and migration by directly regulating phosphatase and tensin homolog in prostate cancer. Oncol Lett. 14:6895–6900. 2017.PubMed/NCBI

29 

Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods. 25:402–408. 2001. View Article : Google Scholar : PubMed/NCBI

30 

Hall PA, Levison DA, Woods AL, Yu CC, Kellock DB, Watkins JA, Barnes DM, Gillett CE, Camplejohn R, Dover R, et al: Proliferating cell nuclear antigen (PCNA) immunolocalization in paraffin sections: An index of cell proliferation with evidence of deregulated expression in some neoplasms. J Pathol. 162:285–294. 1990. View Article : Google Scholar : PubMed/NCBI

31 

Moldovan GL, Pfander B and Jentsch S: PCNA, the maestro of the replication fork. Cell. 129:665–679. 2007. View Article : Google Scholar : PubMed/NCBI

32 

Li Y, Zeng C, Tu M, Jiang W, Dai Z, Hu Y, Deng Z and Xiao W: MicroRNA-200b acts as a tumor suppressor in osteosarcoma via targeting ZEB1. Onco Targets Ther. 9:3101–3111. 2016.PubMed/NCBI

33 

Yin Z, Ding H, He E, Chen J and Li M: Up-regulation of microRNA-491-5p suppresses cell proliferation and promotes apoptosis by targeting FOXP4 in human osteosarcoma. Cell Prolif. 50:e123082017. View Article : Google Scholar

34 

Wang X, Liu S, Cao L, Zhang T, Yue D, Wang L, Ping Y, He Q, Zhang C, Wang M, et al: miR-29a-3p suppresses cell proliferation and migration by downregulating IGF1R in hepatocellular carcinoma. Oncotarget. 8:86592–86603. 2017.PubMed/NCBI

35 

Shi C, Ren L, Sun C, Yu L, Bian X, Zhou X, Wen Y, Hua D, Zhao S, Luo W, et al: miR-29a/b/c function as invasion suppressors for gliomas by targeting CDC42 and predict the prognosis of patients. Br J Cancer. 117:1036–1047. 2017. View Article : Google Scholar : PubMed/NCBI

36 

Gao S, Cheng C, Chen H, Li M, Liu K and Wang G: IGF1 3′UTR functions as a ceRNA in promoting angiogenesis by sponging miR-29 family in osteosarcoma. J Mol Histol. 47:135–143. 2016. View Article : Google Scholar : PubMed/NCBI

37 

Hong Q, Fang J, Pang Y and Zheng J: Prognostic value of the microRNA-29 family in patients with primary osteosarcomas. Med Oncol. 31:372014. View Article : Google Scholar : PubMed/NCBI

38 

Li J, Yen C, Liaw D, Podsypanina K, Bose S, Wang SI, Puc J, Miliaresis C, Rodgers L, McCombie R, et al: PTEN, a putative protein tyrosine phosphatase gene mutated in human brain, breast, and prostate cancer. Science. 275:1943–1947. 1997. View Article : Google Scholar : PubMed/NCBI

39 

Yang YK, Xi WY, Xi RX, Li JY, Li Q and Gao YE: MicroRNA-494 promotes cervical cancer proliferation through the regulation of PTEN. Oncol Rep. 33:2393–2401. 2015. View Article : Google Scholar : PubMed/NCBI

40 

Hodakoski C, Fine B, Hopkins B and Parsons R: Analysis of intracellular PTEN signaling and secretion. Methods. 77-78:164–171. 2015. View Article : Google Scholar : PubMed/NCBI

41 

Li L, Zhu X, Shou T, Yang L, Cheng X, Wang J, Deng L and Zheng Y: MicroRNA-28 promotes cell proliferation and invasion in gastric cancer via the PTEN/PI3K/AKT signalling pathway. Mol Med Rep. 17:4003–4010. 2018.PubMed/NCBI

42 

Li J, Li C, Li H, Zhang T, Hao X, Chang J and Xu Y: MicroRNA 30a 5p suppresses tumor cell proliferation of human renal cancer via the MTDH/PTEN/AKT pathway. Int J Mol Med. 41:1021–1029. 2018.PubMed/NCBI

43 

Zhao D, Chen Y, Chen S, Zheng C, Hu J and Luo S: MiR-19a regulates the cell growth and apoptosis of osteosarcoma stem cells by targeting PTEN. Tumour Biol. 39:10104283177053412017. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Liu Q, Geng P, Shi L, Wang Q and Wang P: miR-29 promotes osteosarcoma cell proliferation and migration by targeting PTEN. Oncol Lett 17: 883-890, 2019.
APA
Liu, Q., Geng, P., Shi, L., Wang, Q., & Wang, P. (2019). miR-29 promotes osteosarcoma cell proliferation and migration by targeting PTEN. Oncology Letters, 17, 883-890. https://doi.org/10.3892/ol.2018.9646
MLA
Liu, Q., Geng, P., Shi, L., Wang, Q., Wang, P."miR-29 promotes osteosarcoma cell proliferation and migration by targeting PTEN". Oncology Letters 17.1 (2019): 883-890.
Chicago
Liu, Q., Geng, P., Shi, L., Wang, Q., Wang, P."miR-29 promotes osteosarcoma cell proliferation and migration by targeting PTEN". Oncology Letters 17, no. 1 (2019): 883-890. https://doi.org/10.3892/ol.2018.9646
Copy and paste a formatted citation
x
Spandidos Publications style
Liu Q, Geng P, Shi L, Wang Q and Wang P: miR-29 promotes osteosarcoma cell proliferation and migration by targeting PTEN. Oncol Lett 17: 883-890, 2019.
APA
Liu, Q., Geng, P., Shi, L., Wang, Q., & Wang, P. (2019). miR-29 promotes osteosarcoma cell proliferation and migration by targeting PTEN. Oncology Letters, 17, 883-890. https://doi.org/10.3892/ol.2018.9646
MLA
Liu, Q., Geng, P., Shi, L., Wang, Q., Wang, P."miR-29 promotes osteosarcoma cell proliferation and migration by targeting PTEN". Oncology Letters 17.1 (2019): 883-890.
Chicago
Liu, Q., Geng, P., Shi, L., Wang, Q., Wang, P."miR-29 promotes osteosarcoma cell proliferation and migration by targeting PTEN". Oncology Letters 17, no. 1 (2019): 883-890. https://doi.org/10.3892/ol.2018.9646
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team