Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Oncology Reports
Join Editorial Board Propose a Special Issue
Print ISSN: 1021-335X Online ISSN: 1791-2431
Journal Cover
July-2014 Volume 32 Issue 1

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
July-2014 Volume 32 Issue 1

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Non-essential amino acids attenuate apoptosis of gastric cancer cells induced by glucose starvation

  • Authors:
    • Gang Wang
    • Lei Dai
    • Laisheng  Luo
    • Wen  Xu
    • Chenjing  Zhang
    • Yimiao  Zhu
    • Zhongting  Chen
    • Wen  Hu
    • Xiang  Xu
    • Wensheng  Pan
  • View Affiliations / Copyright

    Affiliations: Department of Gastroenterology, The Second Affiliated Hospital, School of Medicine, Zhejiang University, Hangzhou, Zhejiang 310009, P.R. China, Department of Gastroenterology, The Second Affiliated Hospital Binjiang Campus, School of Medicine, Zhejiang University, Hangzhou, Zhejiang 310009, P.R. China, Department of Pharmacy, The Second Affiliated Hospital, School of Medicine, Zhejiang University, Hangzhou, Zhejiang 310009, P.R. China
  • Pages: 332-340
    |
    Published online on: May 21, 2014
       https://doi.org/10.3892/or.2014.3205
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

Energy and nutrition are essential requirements for all living cells, including cancer cells. In the initiating stage of cancer in organs, cancer cells grow fast and have inadequate supplies of glucose, oxygen and other nutrients due to deficient angiogenesis. Anaerobic conditions cause cancer cells to rely on glycolysis, which produces pyruvate and ATP that can be used by cancer cells to survive. However, glucose starvation may result in apoptosis or necrosis of cancer cells. It has been reported that autophagy is a consequence of glucose starvation and that amino acids are products of autophagy. The present study investigated whether amino acids may represent an alternative energy source for cancer cells undergoing glucose starvation. With non-essential amino acids, growth inhibition and apoptosis of gastric cancer cells induced by glucose starvation were attenuated compared with that of cells undergoing glucose starvation without amino acids, as measured by cell viability, apoptosis rates, membrane potential of mitochondria, and apoptosis-related genes. Meanwhile, both mitochondrial DNA copy number and amino acid transporter genes were increased compared with those in control cells. Non-essential amino acids prevented gastric cancer cells from glucose starvation-induced apoptosis.

Introduction

Deregulating cellular metabolism is one of the hallmarks of cancer, first observed by Otto Warburg in the 20th century, and now known as the Warburg effect (1–4). The Warburg effect in cancer cells is partially induced by rapid cell division, proliferation and anaerobic conditions as well as the requirement of small molecules for the subcellular construction of new cells (1). Under anaerobic conditions, cancer cells convert glucose to pyruvate and then the pyruvate is transformed to lactic acid for the production of ATP and other cellular construction materials.

High glycolytic activity and inadequate glucose intake are contradictory factors in cancer cells. To handle this stress, the expression of glucose transporters, glucose-metabolizing enzymes and pyruvate dehydrogenase kinase are upregulated to promote glucose uptake; however, there is insufficient adaptive angiogenesis and blood supply (5). To attenuate nutrient starvation, cancer cells utilize several compensatory approaches, such as autophagy (6). Autophagy may be induced by high temperature, hormonal stimulation, low oxygen or nutrient starvation (7,8). In cancer cells, a lack of nutrient sources triggers autophagy, which can sustain the survival of malignant cells (6). Cancer cells may undergo autophagy for back-up energy reserve to support self-survival (6,9), although autophagy may increase apoptosis and cell death (10–12). The non-vascularized and metabolically stressed sites of tumors are usually accompanied by autophagy (9).

During the early neonatal stages of newborns, starvation occurs in most mammals (13). To overcome this life-threatening problem, autophagy is activated and self-holding proteins are degraded by autophagy to produce a pool of amino acids with which to attenuate nutrient starvation (13). Meanwhile, nitrogen deprivation also triggers autophagy-dependent amino acid production (14). Amino acids are enzymatically degraded and become nutrient molecules, which may sustain cancer cell survival while cancer cells are under conditions of low oxygen and blood supply.

To investigate the relationship between amino acids and cancer cells under low glucose conditions, we designed and performed a series of experiments. The present study determined whether amino acids can attenuate nutrient starvation of gastric cancer cells.

Materials and methods

Cell lines and materials

Gastric cancer cells SGC7901, AGS and MGC803 were purchased from Shanghai Cell Collection (China) and cultured in RPMI-1640 medium (Gibco, USA) containing 2 mM L-glutamine, 100 U/ml penicillin, and 100 μg/ml streptomycin and supplemented with 10% fetal bovine serum (FBS; HyClone, USA). The cell culture flasks were maintained in a humidified incubator at 37°C with a 5% CO2 atmosphere until they reached appropriate confluence. RPMI-1640 [−] (no glucose, cat. 11879-020), standard RPMI-1640, MEM [100X, non-essential amino acids (NEAs); Invitrogen, cat. 11140-050], and MEM amino acid solution (cat. 11130-051) were obtained from Life Technologies (USA). The JC-1 kit was obtained from Beyotime Biotech Inc. (China).

Cell viability assay

When grown to 60–80% confluence, gastric cells were trypsinized and seeded on 96-well plates at a density of 1×104 cells/well. The next day, complete medium containing 2,000, 1,000 or 500 mg/ml glucose was added into microplate wells, and a NEA solution was added into corresponding wells. Twenty microliters of a 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT; Sigma Chemical Co., St. Louis, MO, USA) solution (5 mg/ml) were added to each well at intervals of 24, 48, 72 and 96 h after NEA infection. Plates were incubated at 37°C for 4 h, and 100 μl of a lysis buffer DMSO was then added to each well and mixed thoroughly for 10 min. Finally, absorbance values were determined at 570 nm by a microplate reader (Bio-Rad, USA) (15).

Flow cytometry for apoptosis

To measure low-glucose-induced apoptosis, gastric cancer cells were pelleted in 6-well tissue plates and 16 h later, complete medium containing 2,000, 1,000 or 500 mg/ml glucose or complete medium containing 2,000, 1,000 or 500 mg/ml glucose with 2× NEAs (20 μl of 100× NEAs in 1 ml of experimental treatment medium) was added. Forty-eight hours later, gastric cancer cells were washed with phosphate-buffered saline (PBS), trypsinized with no-EDTA trypsin, centrifuged at 1,000 rpm for 5 min, repeatedly washed with PBS, and resuspended in 500 μl binding buffer/106 cells. Cells were then incubated with FITC-labeled Annexin V for 15 min on ice, followed by incubation with propidium iodide (PI) for another 15 min (BD Biosciences, USA) (16). The apoptosis of gastric cancer cells was determined by flow cytometry.

Mitochondrial membrane potential detection by JC-1 staining

Gastric cancer cells were seeded in 6-well tissue plates at a density of 1×105 cells/well and grown to 60–70% confluence. Cells were then stimulated by experimental treatment medium for 48 h. The cells were washed twice with serum-free medium and incubated with a final concentration of 1 μM JC-1 (5,5′,6,6′-tetrachloro-1,1′,3,3′-tetraethylbenzimidazolylcarbocyanine iodide) in DMEM medium for 30 min at 37°C and 5% CO2 (17,18). After the medium was removed, each treatment group of cells was washed with PBS 3 times, and 100 μl of PBS was added to each well. Finally, the changes in the mitochondria membrane potential were determined by fluorescence-activated cell sorting (FACS; BD Biosciences) at excitation and emission wavelengths of 544 and 590 nm, respectively.

Total RNA isolation and quantitative real-time PCR

Total RNA from different treatment groups was extracted using TRIzol reagent (Invitrogen, USA), and the quality and concentration of RNAs were determined by UV spectrophotometry (Bio-Rad). Complimentary DNA (cDNA) was obtained, and quantitative real-time PCR (qRT-PCR) was then performed using a StepOne Plus instrument (Applied Biosystems, USA) with the following procedures: 95°C for 10 min, followed by 95°C for 15 sec, and 60°C for 1 min for 40 cycles. The relative expressions of the mRNAs of amino acid transporter genes (Lat1, Lat2 and h4F2hc) and cell apoptosis genes (Bcl-2, Bcl-xL, Bik and Bax) were detected by qRT-PCR, and the GAPDH gene was used as an internal control. The comparative CT method was used to calculate the relative expression level of these genes, and qRT-PCR was performed according to a previously described protocol (19). Primers for these genes are listed in Table I.

Table I

Primers for amino acid transporter and apoptosis-related genes used in qRT-PCR.

Table I

Primers for amino acid transporter and apoptosis-related genes used in qRT-PCR.

Gene namesPrimers
LAT1F: TGTGCTGGCATTATACAGCG
LAT1R: AGGTGATAGTTCCCGAAGTC
LAT2F: TTTCCAGGAACCTGACATCG
LAT2R: ACATTGCAGTGACATAAGCG
h4F2hcF: CTCAGGCAAGGCTCCTGACT
h4F2hcR: GGCAGGGTGAAGAGCATCA
BaxF: GATGCGTCCACCAAGAAGCT
BaxR: CGGCCCCAGTTGAAGTTG
Bcl-xLF: ACCCCAGGGACAGCATATCA
Bcl-xLR: TGCGATCCGACTCACCAATA
Bcl-2F: TCCGCATCAGGAAGGCTAGA
Bcl-2R: AGGACCAGGCCTCCAAGCT
BikF: CTTGATGGAGACCCTCCTGTATG
BikR: AGGGTCCAGGTCCTCTTCAGA
Mitochondrial DNA copy number detection

mtDNA copy number from experimental treatment medium-stimulated gastric cancer cells was determined by a standard protocol, as described in Current Protocols in Human Genetics (20). Total genomic DNA was isolated with a QIAamp kit (Qiagen, Germany), according to the manufacturer’s instructions. The method for mtDNA copy number detection based on qRT-PCR involved the utilization of a 107-bp-sized amplicon of mtDNA tRNALeu(UUR) (forward primer, CACCCAAGAACAGGGTT TGT and reverse primer, TGGCCATGGGTATGTTGTTA); and an 86-bp-sized amplicon of β2-microglobulin (forward primer, TGCTGTCTCCATGTTTGATGTATCT and reverse primer, TCTCTGCTCCCCACCTCTAAGT) of nuclear DNA (nDNA) was used as an internal control (20). The PCR procedure was as follows: 95°C for 10 min, followed by 95°C for 15 sec, and 60°C for 1 min for 40 cycles. PCR assays were performed in triplicate for each DNA sample. The expression of mtDNA copy number relative to the expression of nDNA was determined using the formula: 2×2(ΔCT), where ΔCT is the difference in CT values between the β2-microglobulin gene and tRNALeu(UUR) (20).

Statistical analysis

The statistical significance of the data between different groups was evaluated by performing an analysis of variance and Student’s t-test using the SPSS 1 statistical software. p<0.05 was considered to indicate a statistically significant difference.

Results

Amino acids help gastric cancer cells survive during glucose starvation

In solid tumors, low blood supply, glucose starvation and hypoxia are common due to the rapid proliferation of malignant cells (21). Therefore, glucose starvation leads to apoptosis or necrosis of fast-growth cancer cells. Gastric cancer cells MGC803, AGS and SGC7901 were cultured in medium containing glucose concentrations of 2,000, 1,000 or 500 mg/ml in the presence or absence of 2× MEM amino acids. Cell viability detection assays were performed 24, 48 and 72 h later. As shown in Fig. 1, the cell viability at concentrations of 2,000 and 1,000 D-glucose (DG) was not significantly different between samples with and without NEA (Fig. 1A, B, D, E, G and H), but cells in 500 DG medium with NEA had a significantly higher survival rate compared with those in medium without NEA (Fig. 1C, F and I). Amino acids, therefore, promote gastric cancer cell survival under glucose starvation.

Figure 1

Non-essential amino acids promote gastric cancer cell survival under conditions of glucose starvation. Non-essential amino acids may help MGC803, AGS and SGC7901, three gastric cancer cell lines, resist low glucose. Cell growth in the 500 DG group was significantly greater than that in the 500 DG with NEA group (p<0.05) (C, F and I). Others were not as high as that in the 500 DG with NEA group (A, B, D, E, G and H).

NEAs inhibit apoptosis caused by glucose starvation

To further investigate the effects of NEA on gastric cancer, we utilized flow cytometry to confirm the results of NEA-assisted gastric cancer cells surviving glucose starvation. Forty-eight hours after stimulation with conditional medium (medium containing glucose at a concentration of 2,000, 1,000 or 500 mg/ml with or without 2× MEM amino acids), cells were trypsinized and stained with PI and FITC-labeled Annexin V (22). An obvious increase in the apoptosis rate was detected in the 500 DG groups (15.9–44.1%) compared with the 500 DG with NEA group in both the FITC/PI-positive (31.2–54.3%) and FITC-positive/PI-negative (19.2–27.6%) cells (Fig. 2A-c and -f; Fig. 2B-c and -f; Fig. 2C-c and -f). In contrast, no significant differences were found between the 2,000 and 1,000 DG groups (Fig. 2A-a, -b, -d and -e; Fig. 2B-a, -b, -d and -e; Fig. 2C-a, -b, -d and -e). NEA therefore decreased the apoptosis rate of gastric cancer cells in glucose-deficient medium.

Figure 2

Apoptosis of gastric cancer cells induced by glucose starvation. (A) Apoptosis of MGC803 cells induced by glucose starvation. (B) Apoptosis of AGS cells induced by glucose starvation. (C) Apoptosis of SGC7901 cells induced by glucose starvation. FITC-labeled Annexin V and PI were both used as indices for apoptosis induced by medium containing 2,000, 1,000 or 500 mg/ml glucose (a–c) with or without NEA (d–f). (a, 2,000 DG group; b, 1,000 DG group; c, 500 DG group; d, 2,000 DG-AA group; e, 1,000 DG-AA group; and f, 500 DG-AA group).

Altered expression of the Bcl-2 gene family

Apoptosis is a programmed procedure involving various genes. The Bcl-2 gene family is a member of the apoptosis-associated genes and plays an important role in promoting or inhibiting apoptosis (23,24). The family contains Bcl-2, Bcl-xL, Bak, Bik and other genes (24). The general function of Bcl-2 and Bcl-xL is anti-apoptotic and that of Bax and Bik is pro-apoptotic (24,25). Our data showed that the groups treated with 500 DG and 500 DG-AA medium had significantly different rates of proliferation and apoptosis. Thus, we evaluated the expression of Bcl-2, Bcl-xL, Bak and Bik in gastric cancer cells treated with 500 DG or 500 DG-AA medium. As shown in Fig. 3, Bcl-2 and Bcl-xL genes demonstrated decreased expression when gastric cancer cells were exposed to 500 DG medium compared with 500 DG-AA medium. Conversely, the expression of the Bik and Bax genes increased, which suggested that NEA sustained gastric cancer cells by inducing the expression of anti-apoptotic members of the Bcl-2 gene family and preventing the expression of pro-apoptotic members.

Figure 3

Non-essential amino acids affect the expression of Bcl-2 family genes under glucose starvation conditions. Real-time PCR analysis of Bcl-2 family genes (Bcl-2, Bcl-xL, Bik and Bax) in three gastric cancer cell lines, MGC803, AGS and SGC7901, cultured in 500 DG (with or without NEA) for 48 h. NEA aided the cells by reducing the effects induced by glucose starvation. Data are representative of three experiments. (‘*’ represents a statistically significant difference, and ‘**’ represents a highly statistically significant difference).

Overexpression of amino acid transporter genes induced by glucose starvation

The data presented above demonstrate that amino acids inhibit apoptosis. We hypothesized that the expression of amino acid transporters in the cell membrane may increase to fulfill the energy requirements of the cell. Thus, we examined the relative expression levels of amino acid transporter genes L-type amino acid transporter 1 (LAT1), LAT2 and h4F2hc. LAT1, as a transporter gene, is reported to be highly expressed in various human cancers (26–32), and its expression is strongly correlated with that of another amino acid transporter gene, h4F2hc (26). We performed qRT-PCR to determine transporter gene expression after 48 h of low-glucose culture and found that the decrease in glucose concentration led to the significant upregulation of amino acid transporters (LAT1 and h4Fhc). As shown in Fig. 4, LAT1 expression in MGC803 cells was upregulated under low-glucose conditions by 8.17- and 7.48-fold (1,000 and 500 DG, respectively) compared with the 2,000 DG group. LAT2 expression was decreased under low-glucose conditions, and the expression of h4F2hc was upregulated by 2.48- and 2.40-fold (1,000 and 500 DG, respectively; Fig. 4A) compared with the 2,000 DG group. Additionally, the ratios of LAT1, LAT2 and h4F2hc in the 1,000 and 500 DG groups compared with the 2,000 DG group were changed from 1.79 to 3.87, 2.42 to 0.69 and 5.09 to 5.14, respectively, in AGS cells (Fig. 4B). The corresponding ratios were 2.68 and 3.72, 20.23 and 6.20, and 3.41 and 4.50 in SGC7901 cells (Fig. 4C). Thus, glucose starvation was capable of upregulating amino acid transporter genes.

Figure 4

Low glucose concentration upregulates amino acid transporter genes in gastric cancer cells. Amino acid transporter genes in low glucose-induced (A) MGC803 cells, (B) AGS cells, (C) SGC7901 cells.

Mitochondrial content determination: DNA copy number

Mitochondrial disorders are complicated heterogeneous diseases that may be caused by molecular or cellular defects (33,34). It is clear that a constant number of mtDNA copies is essential for maintaining cell homeostasis (35–37). Similarly, we investigated whether the copy number of mtDNA varied in gastric cancer cells during glucose starvation. We extracted the total genomic DNA of gastric cancer cells stimulated by 1,000 DG and 1,000 DG with NEA for 48 h and investigated the relative copy number of mtDNA compared to nDNA with real-time PCR. With nDNA as an internal control, the relative mtDNA copy number increased from 599 to 712, 597 to 783, and 461 to 523 in MGC803, AGS and SGC7901 cells, respectively, in the medium with NEA (p<0.05) (Fig. 5).

Figure 5

Amino acids stimulate an increase in mitochondrial DNA (mtDNA) copy number in gastric cancer cells cultured in low-glucose medium. MGC803, AGS and SGC7901 cells were stimulated with medium containing 1,000 DG or 1,000 DG with NEA for 48 h, and the genomic DNA of these cells was extracted for real-time PCR detection. We calculated the relative amount of mtDNA using the formula 2×2(ΔCT). The amount of mtDNA increased slightly (599 to 712 in MGC803 cells, 597 to 783 in AGS cells and 461 to 523 in SGC7901 cells). DG, D-glucose; NEA, non-essential amino acids.

NEAs prevent the loss of the mitochondrial membrane potential of gastric cancer cells during glucose starvation

Depolarization of the mitochondrial inner membrane resulting from ion channel opening is regarded as one of the signs of cell death. To examine whether low glucose and amino acids affected mitochondrial inner membrane potential, we used the voltage-sensitive fluorescent dye JC-1 to stain gastric cancer AGS cells that were treated for 24 h with low-glucose medium or medium with NEA. The ratio of JC-1 red (595 nm)/green (535 nm) represents the percentage of cells undergoing apoptosis. The ratio of JC-1 red/green in AGS cells is shown in Fig. 5. We determined that there were no significant differences in mitochondrial membrane potential between the groups cultured with or without NEA at 2,000 or 1,000 DG (2.45–1.23 and 1.15–3.19%, respectively), but a significant difference was found between the 500 DG groups with and without NEA (78% of the 500 DG group and 15.2% of the 500 DG-AA group) (Fig. 6C and D).

Figure 6

Membrane potential of mitochondria in gastric cancer AGS cells cultured in gradient concentrations of glucose and labeled with JC-1. (A) 2,000 DG group; (B) 1,000 DG group; (C) 500 DG group; (D) 2,000 DG with NEA group; (E) 1,000 DG with NEA group, and 500 DG with NEA group.

Discussion

Gastric cancer, similar to other types of solid cancer, requires angiogenesis when cancer cells undergo rapid growth and proliferation (38,39). Cancer cells require more energy support compared to normal cells, and glucose is a major source of cellular energy (40). Otherwise, glucose is consumed not for ATP production but for cell growth and the production of new cells. Glycolysis is the major mechanism of glucose metabolism in cancer cells, which is called the Warburg effect, as it was observed by Otto Warburg for the first time in 1956 (3,41,42). Without sufficient angiogenesis, glucose starvation or deprivation is common in fast-growing cancer cells, and autophagy may be an alternative energy source for cancer cells (6,9). Amino acids, as the products of autophagy, could serve as a back-up source of nutrients for rapidly growing malignant cells (13,14). Based on the above-referenced studies, we inferred that amino acids could prevent apoptosis of gastric cancer cells undergoing glucose deprivation.

Here, we presented evidence for the first time supporting the hypothesis that non-essential amino acids can attenuate glucose starvation-induced apoptosis of gastric cancer cells. Survival, apoptosis, the potential of mitochondria, mitochondria DNA copy number, and amino acid transporter proteins are all directly or indirectly regulated by non-essential amino acids added to low-glucose media. These data demonstrated that non-essential amino acids may be an alternative energy source for gastric cancer cells under glucose-starved conditions.

Energy deprivation of somatic or cancer cells could trigger marked reprogramming of cell homeostasis to facilitate the adjustment of cellular metabolism (43,44). To elucidate the bio-function of amino acids in gastric cancer cells undergoing glucose starvation, we adopted a strategy of treating cancer cells with culture medium containing a glucose concentration gradient and investigated whether amino acids performed important effects to attenuate glucose starvation. The results of a series of experiments measuring proliferation, apoptosis, and the expression of related genes showed that low glucose concentration could induce gastric cancer cells to undergo apoptosis, but non-essential amino acids could attenuate that effect. Several studies have mentioned that glucose starvation could result in apoptosis of cells though signaling pathways (43,45).

The amino acid transporter gene LAT1 has been reported to be upregulated in the membranes of many cancer cells (27,28,46–48). This protein transports amino acids into cells and is different from two other amino acid transporter genes, namely LAT2 and h4F2hc (49). Energy deprivation can trigger response systems to adjust the state of cells, and increased amino acid intake may be one of those responses.

Several recent studies have shown that amino acids are associated with proliferation in cancer (50–54). Jain et al found that 219 metabolites were released from rapidly proliferating cancer cells, and glycine consumption and the glycine biosynthetic pathway were strongly correlated with the rate of proliferation of almost 60 cell lines (50). Zhang et al reported that glycine may be a critical factor associated with tumor-initiating cells and tumorigenesis of non-small-cell lung cancer (54). In Arabidopsis thaliana, low energy status induced the upregulation of the basic leucine zipper transcriptional factors bZIP1 and bZIP53, which are crucial factors in proline, asparagine, and branched amino acid metabolism in response to energy starvation (55). Proline and asparagine are included in non-essential amino acids. Increasingly more evidence shows that amino acids may have a critical functional role in proliferation, resistance to anticancer drugs, invasion or metastasis of cancer cells. Amino acids are constructed units of proteins and additionally may serve as an energy resource such as glucose. As shown in the present study, non-essential amino acids were able to mitigate the stress caused by glucose starvation.

All cells and tissues have an amino acid sensor system that can help monitor the state of intercellular amino acids (56,57). In higher eukaryotic cells, mTOR1 is believed to regulate protein synthesis in the amino acid signaling pathway (57). The protein mTOR is a central cell growth regulator and promotes cell growth and cell size by controlling protein synthesis (56). At the same time, mTORC can be stimulated by or control amino acid metabolism through several key components (such as Rag GTPase), and the signaling is described in detail in a review (56).

Mitochondria have important roles in various cellular activities, including apoptosis and energy metabolism (58). The content of mitochondria (mitochondrial DNA copy number) changes with the changed status of cells and may increase or decrease (59–62). In the present study, we found that non-essential amino acids maintained a constant mitochondria content in gastric cancer cells undergoing glucose starvation, which indicates that non-essential amino acids may reduce the decreasing effect on the content of mitochondria that are induced by glucose starvation and thus sustain cell viability (63). The potential of mitochondria is associated with cell apoptosis and mitochondria DNA copy number and is also a marker of cell activity. All the effects that were observed in this study reflected the finding that non-essential amino acids could increase the activity of gastric cancer cells facing glucose starvation.

The results of the present study confirmed the hypothesis that non-essential amino acids and not total amino acid or glutamine levels were capable of promoting gastric cancer survival in cells under glucose starvation. The promoting effects of the non-essential amino acids may be achieved through the increased expression of amino acid transporter proteins, upregulation of the expression of anti-apoptotic genes, and mitochondrial content. Future studies should focus on the signaling pathways by which amino acids are regulated in response to low glucose conditions.

Acknowledgements

The present study was supported by grants from the National Health Key Special Fund (No. 200802112), the Health Department Fund (No. 2007A093), the Traditional Chinese Medicine Bureau Fund (No. 2007ZA019), the Natural Science Foundation of Zhejiang Province (Nos. Y2080001, Y12H160121 and Z2080514), the Key Project of Zhejiang Province (No. 2009C03012-5 and No. 2013C03044-5), and the National Natural Science Foundation of China (No. 81372302).

References

1 

Hanahan D and Weinberg RA: Hallmarks of cancer: the next generation. Cell. 144:646–674. 2011. View Article : Google Scholar : PubMed/NCBI

2 

Warburg O: On respiratory impairment in cancer cells. Science. 124:269–270. 1956.PubMed/NCBI

3 

Warburg O: On the origin of cancer cells. Science. 123:309–314. 1956. View Article : Google Scholar : PubMed/NCBI

4 

Warburg O, Wind F and Negelein E: The metabolism of tumors in the body. J Gen Physiol. 8:519–530. 1927. View Article : Google Scholar : PubMed/NCBI

5 

Denko NC: Hypoxia, HIF1 and glucose metabolism in the solid tumour. Nat Rev Cancer. 8:705–713. 2008. View Article : Google Scholar : PubMed/NCBI

6 

Mathew R, Karantza-Wadsworth V and White E: Role of autophagy in cancer. Nat Rev Cancer. 7:961–967. 2007. View Article : Google Scholar

7 

Levine B: Cell biology: autophagy and cancer. Nature. 446:745–747. 2007. View Article : Google Scholar : PubMed/NCBI

8 

Mizushima N: Autophagy: process and function. Genes Dev. 21:2861–2873. 2007. View Article : Google Scholar

9 

Degenhardt K, Mathew R, Beaudoin B, et al: Autophagy promotes tumor cell survival and restricts necrosis, inflammation, and tumorigenesis. Cancer Cell. 10:51–64. 2006. View Article : Google Scholar : PubMed/NCBI

10 

Boya P, González-Polo RA, Casares N, et al: Inhibition of macroautophagy triggers apoptosis. Mol Cell Biol. 25:1025–1040. 2005. View Article : Google Scholar : PubMed/NCBI

11 

Colell A, Ricci JE, Tait S, et al: GAPDH and autophagy preserve survival after apoptotic cytochrome c release in the absence of caspase activation. Cell. 129:983–997. 2007. View Article : Google Scholar : PubMed/NCBI

12 

Karantza-Wadsworth V, Patel S, Kravchuk O, et al: Autophagy mitigates metabolic stress and genome damage in mammary tumorigenesis. Genes Dev. 21:1621–1635. 2007. View Article : Google Scholar : PubMed/NCBI

13 

Kuma A, Hatano M, Matsui M, et al: The role of autophagy during the early neonatal starvation period. Nature. 432:1032–1036. 2004. View Article : Google Scholar : PubMed/NCBI

14 

Onodera J and Ohsumi Y: Autophagy is required for maintenance of amino acid levels and protein synthesis under nitrogen starvation. J Biol Chem. 280:31582–31586. 2005. View Article : Google Scholar : PubMed/NCBI

15 

Zhang J, Yang Y, Yang T, et al: microRNA-22, downregulated in hepatocellular carcinoma and correlated with prognosis, suppresses cell proliferation and tumourigenicity. Br J Cancer. 103:1215–1220. 2010. View Article : Google Scholar : PubMed/NCBI

16 

Gasz B, Rácz B, Roth E, et al: Pituitary adenylate cyclase activating polypeptide protects cardiomyocytes against oxidative stress-induced apoptosis. Peptides. 27:87–94. 2006. View Article : Google Scholar

17 

Gartlon J, Kinsner A, Bal-Price A, Coecke S and Clothier RH: Evaluation of a proposed in vitro test strategy using neuronal and non-neuronal cell systems for detecting neurotoxicity. Toxicol In Vitro. 20:1569–1581. 2006. View Article : Google Scholar : PubMed/NCBI

18 

Coleman MD, O’Neil JD, Woehrling EK, et al: A preliminary investigation into the impact of a pesticide combination on human neuronal and glial cell lines in vitro. PLoS One. 7:e427682012. View Article : Google Scholar : PubMed/NCBI

19 

Cappello C, Zwergal A, Kanclerski S, et al: C/EBPβ enhances NF-κB-associated signalling by reducing the level of IκB-α. Cell Signal. 21:1918–1924. 2009.

20 

Venegas V, Wang J, Dimmock D and Wong LJ: Real-time quantitative PCR analysis of mitochondrial DNA content. Curr Protoc Hum Genet. Unit 19.17:2011.PubMed/NCBI

21 

Pola C: Cancer microenvironment: p53 acts in the hood. Nat Med. 19:5462013. View Article : Google Scholar

22 

Yermolaieva O, Xu R, Schinstock C, et al: Methionine sulfoxide reductase A protects neuronal cells against brief hypoxia/reoxygenation. Proc Natl Acad Sci USA. 101:1159–1164. 2004. View Article : Google Scholar : PubMed/NCBI

23 

Finnegan NM, Curtin JF, Prevost G, Morgan B and Cotter TG: Induction of apoptosis in prostate carcinoma cells by BH3 peptides which inhibit Bak/Bcl-2 interactions. Br J Cancer. 85:115–121. 2001. View Article : Google Scholar : PubMed/NCBI

24 

Hardwick JM and Soane L: Multiple functions of BCL-2 family proteins. Cold Spring Harb Perspect Biol. 5:a0087222013. View Article : Google Scholar : PubMed/NCBI

25 

Zhou F, Yang Y and Xing D: Bcl-2 and Bcl-xL play important roles in the crosstalk between autophagy and apoptosis. FEBS J. 278:403–413. 2011. View Article : Google Scholar : PubMed/NCBI

26 

Kaira K, Oriuchi N, Takahashi T, et al: LAT1 expression is closely associated with hypoxic markers and mTOR in resected non-small cell lung cancer. Am J Transl Res. 3:468–478. 2011.PubMed/NCBI

27 

Fukumoto S, Hanazono K, Komatsu T, Iwano H, Kadosawa T and Uchide T: L-type amino acid transporter 1 (LAT1) expression in canine mammary gland tumors. J Vet Med Sci. 75:431–437. 2013. View Article : Google Scholar : PubMed/NCBI

28 

Kaira K, Oriuchi N, Takahashi T, et al: L-type amino acid transporter 1 (LAT1) expression in malignant pleural mesothelioma. Anticancer Res. 31:4075–4082. 2011.PubMed/NCBI

29 

Kaira K, Oriuchi N, Imai H, et al: L-type amino acid transporter 1 (LAT1) is frequently expressed in thymic carcinomas but is absent in thymomas. J Surg Oncol. 99:433–438. 2009. View Article : Google Scholar : PubMed/NCBI

30 

Ohkawa M, Ohno Y, Masuko K, et al: Oncogenicity of L-type amino-acid transporter 1 (LAT1) revealed by targeted gene disruption in chicken DT40 cells: LAT1 is a promising molecular target for human cancer therapy. Biochem Biophys Res Commun. 406:649–655. 2011. View Article : Google Scholar : PubMed/NCBI

31 

del Amo EM, Urtti A and Yliperttula M: Pharmacokinetic role of L-type amino acid transporters LAT1 and LAT2. Eur J Pharm Sci. 35:161–174. 2008.PubMed/NCBI

32 

Dickens D, Webb SD, Antonyuk S, et al: Transport of gabapentin by LAT1 (SLC7A5). Biochem Pharmacol. 85:1672–1683. 2013. View Article : Google Scholar : PubMed/NCBI

33 

Parr RL, Mills J, Harbottle A, et al: Mitochondria, prostate cancer, and biopsy sampling error. Discov Med. 15:213–220. 2013.PubMed/NCBI

34 

Bratic A and Larsson NG: The role of mitochondria in aging. J Clin Invest. 123:951–957. 2013. View Article : Google Scholar

35 

Purdue MP, Hofmann JN, Colt JS, et al: A case-control study of peripheral blood mitochondrial DNA copy number and risk of renal cell carcinoma. PLoS One. 7:e431492012. View Article : Google Scholar : PubMed/NCBI

36 

Qian W and Van Houten B: Alterations in bioenergetics due to changes in mitochondrial DNA copy number. Methods. 51:452–457. 2010. View Article : Google Scholar : PubMed/NCBI

37 

Liang BC and Hays L: Mitochondrial DNA copy number changes in human gliomas. Cancer Lett. 105:167–173. 1996. View Article : Google Scholar : PubMed/NCBI

38 

Kitadai Y: Angiogenesis and lymphangiogenesis of gastric cancer. J Oncol. 4687252010.PubMed/NCBI

39 

Maehara Y, Hasuda S, Abe T, et al: Tumor angiogenesis and micrometastasis in bone marrow of patients with early gastric cancer. Clin Cancer Res. 4:2129–2134. 1998.PubMed/NCBI

40 

Lunt SY and Vander Heiden MG: Aerobic glycolysis: meeting the metabolic requirements of cell proliferation. Annu Rev Cell Dev Biol. 27:441–464. 2011. View Article : Google Scholar : PubMed/NCBI

41 

Ferguson EC and Rathmell JC: New roles for pyruvate kinase M2: working out the Warburg effect. Trends Biochem Sci. 33:359–362. 2008. View Article : Google Scholar : PubMed/NCBI

42 

Vander Heiden MG, Cantley LC and Thompson CB: Understanding the Warburg effect: the metabolic requirements of cell proliferation. Science. 324:1029–1033. 2009.PubMed/NCBI

43 

Mendivil-Perez M, Jimenez-Del-Rio M and Velez-Pardo C: Glucose starvation induces apoptosis in a model of acute T leukemia dependent on caspase-3 and apoptosis-inducing factor: a therapeutic strategy. Nutr Cancer. 65:99–109. 2013. View Article : Google Scholar

44 

Liu K, Tang Q, Fu C, et al: Influence of glucose starvation on the pathway of death in insect cell line Sl: apoptosis follows autophagy. Cytotechnology. 54:97–105. 2007. View Article : Google Scholar : PubMed/NCBI

45 

Moruno-Manchón JF1, Pérez-Jiménez E and Knecht E: Glucose induces autophagy under starvation conditions by a p38 MAPK-dependent pathway. Biochem J. 449:497–506. 2013.PubMed/NCBI

46 

Hayashi K, Jutabha P, Endou H and Anzai N: c-Myc is crucial for the expression of LAT1 in MIA Paca-2 human pancreatic cancer cells. Oncol Rep. 28:862–866. 2012.PubMed/NCBI

47 

Haining Z, Kawai N, Miyake K, et al: Relation of LAT1/4F2hc expression with pathological grade, proliferation and angiogenesis in human gliomas. BMC Clin Pathol. 12:42012. View Article : Google Scholar : PubMed/NCBI

48 

Ichinoe M, Mikami T, Yoshida T, et al: High expression of L-type amino-acid transporter 1 (LAT1) in gastric carcinomas: comparison with non-cancerous lesions. Pathol Int. 61:281–289. 2011. View Article : Google Scholar : PubMed/NCBI

49 

Khunweeraphong N, Nagamori S, Wiriyasermkul P, et al: Establishment of stable cell lines with high expression of heterodimers of human 4F2hc and human amino acid transporter LAT1 or LAT2 and delineation of their differential interaction with α-alkyl moieties. J Pharmacol Sci. 119:368–380. 2012.PubMed/NCBI

50 

Jain M, Nilsson R, Sharma S, et al: Metabolite profiling identifies a key role for glycine in rapid cancer cell proliferation. Science. 336:1040–1044. 2012. View Article : Google Scholar : PubMed/NCBI

51 

Maddocks OD, Berkers CR, Mason SM, et al: Serine starvation induces stress and p53-dependent metabolic remodelling in cancer cells. Nature. 493:542–546. 2013. View Article : Google Scholar : PubMed/NCBI

52 

Filipp FV, Ratnikov B, De Ingeniis J, Smith JW, Osterman AL and Scott DA: Glutamine-fueled mitochondrial metabolism is decoupled from glycolysis in melanoma. Pigment Cell Melanoma Res. 25:732–739. 2012. View Article : Google Scholar : PubMed/NCBI

53 

Shyh-Chang N, Locasale JW, Lyssiotis CA, et al: Influence of threonine metabolism on S-adenosylmethionine and histone methylation. Science. 339:222–226. 2013. View Article : Google Scholar : PubMed/NCBI

54 

Zhang WC, Shyh-Chang N, Yang H, et al: Glycine decarboxylase activity drives non-small cell lung cancer tumor-initiating cells and tumorigenesis. Cell. 148:259–272. 2012. View Article : Google Scholar : PubMed/NCBI

55 

Dietrich K, Weltmeier F, Ehlert A, et al: Heterodimers of the Arabidopsis transcription factors bZIP1 and bZIP53 reprogram amino acid metabolism during low energy stress. Plant Cell. 23:381–395. 2011.

56 

Kim J and Guan KL: Amino acid signaling in TOR activation. Annu Rev Biochem. 80:1001–1032. 2011. View Article : Google Scholar : PubMed/NCBI

57 

Lamb RF: Amino acid sensing mechanisms: an Achilles heel in cancer? FEBS J. 279:2624–2631. 2012. View Article : Google Scholar : PubMed/NCBI

58 

Crimi M and Rigolio R: The mitochondrial genome, a growing interest inside an organelle. Int J Nanomed. 3:51–57. 2008.PubMed/NCBI

59 

Thyagarajan B, Wang R, Nelson H, Barcelo H, Koh WP and Yuan JM: Mitochondrial DNA copy number is associated with breast cancer risk. PLoS One. 8:e659682013. View Article : Google Scholar : PubMed/NCBI

60 

Mondal R, Ghosh SK, Choudhury JH, et al: Mitochondrial DNA copy number and risk of oral cancer: a report from Northeast India. PLoS One. 8:e577712013. View Article : Google Scholar : PubMed/NCBI

61 

Monnot S, Samuels DC, Hesters L, et al: Mutation dependance of the mitochondrial DNA copy number in the first stages of human embryogenesis. Hum Mol Genet. 22:1867–1872. 2013. View Article : Google Scholar : PubMed/NCBI

62 

Yu M, Wan Y and Zou Q: Reduced mitochondrial DNA copy number in Chinese patients with osteosarcoma. Transl Res. 161:165–171. 2013. View Article : Google Scholar : PubMed/NCBI

63 

Gomes LC, Di Benedetto G and Scorrano L: During autophagy mitochondria elongate, are spared from degradation and sustain cell viability. Nat Cell Biol. 13:589–598. 2011. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Wang G, Dai L, Luo L, Xu W, Zhang C, Zhu Y, Chen Z, Hu W, Xu X, Pan W, Pan W, et al: Non-essential amino acids attenuate apoptosis of gastric cancer cells induced by glucose starvation. Oncol Rep 32: 332-340, 2014.
APA
Wang, G., Dai, L., Luo, L., Xu, W., Zhang, C., Zhu, Y. ... Pan, W. (2014). Non-essential amino acids attenuate apoptosis of gastric cancer cells induced by glucose starvation. Oncology Reports, 32, 332-340. https://doi.org/10.3892/or.2014.3205
MLA
Wang, G., Dai, L., Luo, L., Xu, W., Zhang, C., Zhu, Y., Chen, Z., Hu, W., Xu, X., Pan, W."Non-essential amino acids attenuate apoptosis of gastric cancer cells induced by glucose starvation". Oncology Reports 32.1 (2014): 332-340.
Chicago
Wang, G., Dai, L., Luo, L., Xu, W., Zhang, C., Zhu, Y., Chen, Z., Hu, W., Xu, X., Pan, W."Non-essential amino acids attenuate apoptosis of gastric cancer cells induced by glucose starvation". Oncology Reports 32, no. 1 (2014): 332-340. https://doi.org/10.3892/or.2014.3205
Copy and paste a formatted citation
x
Spandidos Publications style
Wang G, Dai L, Luo L, Xu W, Zhang C, Zhu Y, Chen Z, Hu W, Xu X, Pan W, Pan W, et al: Non-essential amino acids attenuate apoptosis of gastric cancer cells induced by glucose starvation. Oncol Rep 32: 332-340, 2014.
APA
Wang, G., Dai, L., Luo, L., Xu, W., Zhang, C., Zhu, Y. ... Pan, W. (2014). Non-essential amino acids attenuate apoptosis of gastric cancer cells induced by glucose starvation. Oncology Reports, 32, 332-340. https://doi.org/10.3892/or.2014.3205
MLA
Wang, G., Dai, L., Luo, L., Xu, W., Zhang, C., Zhu, Y., Chen, Z., Hu, W., Xu, X., Pan, W."Non-essential amino acids attenuate apoptosis of gastric cancer cells induced by glucose starvation". Oncology Reports 32.1 (2014): 332-340.
Chicago
Wang, G., Dai, L., Luo, L., Xu, W., Zhang, C., Zhu, Y., Chen, Z., Hu, W., Xu, X., Pan, W."Non-essential amino acids attenuate apoptosis of gastric cancer cells induced by glucose starvation". Oncology Reports 32, no. 1 (2014): 332-340. https://doi.org/10.3892/or.2014.3205
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team