Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Experimental and Therapeutic Medicine
Join Editorial Board Propose a Special Issue
Print ISSN: 1792-0981 Online ISSN: 1792-1015
Journal Cover
January-2020 Volume 19 Issue 1

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
January-2020 Volume 19 Issue 1

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

miR‑31‑5p may enhance the efficacy of chemotherapy with Taxol and cisplatin in TNBC

  • Authors:
    • Xiaowei Shen
    • Jiaqi Lei
    • Lei Du
  • View Affiliations / Copyright

    Affiliations: Department of General Surgery, Zhongshan Hospital Qingpu Branch, Fudan University, Shanghai 200092, P.R. China, Department of General Surgery, Shuguang Hospital, Shanghai University of Traditional Chinese Medicine, Shanghai 201203, P.R. China
  • Pages: 375-383
    |
    Published online on: November 12, 2019
       https://doi.org/10.3892/etm.2019.8191
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

The limited efficacy of chemotherapy with Taxol (TAX) and cisplatin (DDP) in triple‑negative breast cancer (TNBC) has prompted the investigation of combined therapies. Previous studies demonstrated that microRNA (miR)‑31‑5p is involved in various biological processes. In the present study, it was hypothesized that the overexpression of miR‑31‑5p may enhance the efficacy of chemotherapy. The expression levels of miR‑31‑5p in the TNBC cell lines MDA‑MB‑231 and MDA‑MB‑468 were measured using reverse transcription‑quantitative PCR following transfection with miR‑31‑5p mimic or inhibitor. A Cell Counting Kit‑8 and flow cytometry assays suggested that the overexpression of miR‑31‑5p inhibited cell proliferation and promoted apoptosis, and these effects were reversed by transfecting a miR‑31‑5p inhibitor into MDA‑MB‑231 and MDA‑MB‑468 cells. Furthermore, the overexpression of miR‑31‑5p increased the sensitivity of cells to chemotherapy, which exhibited an increase in apoptosis and in the expression level of Bax, and a decrease in the expression level of Bcl‑2. Chemotherapy resistance induced by miR‑31‑5p inhibitor could be reversed by inhibiting the AKT signaling pathway in MDA‑MB‑231 and MDA‑MB‑468 cells. In conclusion, the present preclinical results indicated that targeting miR‑31‑5p may enhance the efficacy of TAX‑ and DDP‑mediated chemotherapy in TNBC.

Introduction

Breast cancer is a common gynecologic cancer worldwide (1). Low expression of human epidermal growth factor receptor 2 (HER2), progesterone receptor (PR) and estrogen receptor (ER) are the main characteristics of TNBC (2). TNBC accounts for 10–15% of breast carcinomas, which constitute ~80% of all ‘basal-like tumors’ (3). There are many risk factors for TNBC, including the lack of breastfeeding, high parity, high body mass index and young age at menarche (4). The majority of tumor exhibiting a BRCA1-mutation belong to the TNBC subtype (5). Compared with other subtypes of breast cancer, TNBC has a poor prognosis and tends to recur more frequently (6). Although a previous study showed that TNBC is sensitive to chemotherapy, sensitive patients only represent a minority of all patients with TNBC (7). Although the survival rate of breast cancer has increased significantly in recent years, there is still no effective treatment for TNBC (8). Currently, breast cancer treatments target ER, PR or HER2, and it is therefore essential to identify novel biomarkers that may predict tumor progression and that can be used as potential therapeutic targets (9–12).

MicroRNAs (miRNAs) are a class of small non-coding RNAs that can regulate gene expression by triggering translation repression or RNA degradation of the target mRNAs (13). Dysregulation of miRNAs or the expression of mutant miRNAs in human diseases including cancer, suggest that miRNAs may act as oncogenes or tumor suppressors (14–18). Among the differentially expressed miRNAs, miRNA (miR)-155-5p, miR-21-3p, miR-181a-5p, miR-181b-5p and miR-183-5p are significantly upregulated in TNBC, whereas miR-10b-5p, miR-451a, miR-125b-5p, miR-31-5p, miR-195-5p and miR-130a-3p are downregulated (7). In addition, miRNAs that act as metastasis suppressors in breast cancer include miR-17/20, miR-22, miR-30, miR-31, miR-126, miR-145, miR-146, miR-205, miR-206 and let-7 (19). However, the mechanism underlying miR-31-5p function in TNBC remains unclear. miR-31 is involved in many biological processes, including bone formation (20), embryonic development (21) and myogenesis (22). In addition, miR-31 has been reported to promote spermatogenesis and to facilitate embryonic implantation (23,24). Dysregulation of miR-31 has also been found in various human diseases, including cancer and autoimmune diseases (21). Repression of miR-31 was identified in breast cancer, suggesting that miR-31 may serve as a tumor suppressor (25). miR-31 inhibition has been identified in leukemia patients, and it was shown that miR-31 can inhibit NF-κB signaling by suppressing mitogen-activated protein kinase kinase kinase 14 (26). Similarly, patients with hepatocellular carcinoma exhibit downregulated levels of miR-31 (27). By contrast, miR-31 was also found to be upregulated in certain types of cancer; in colorectal cancer, miR-31 acts as an oncogenic miRNA (28,29). In lung cancer, miR-31 directly regulates tumor-suppressing genes, such as protein phosphatase 2 regulatory subunit B α, large tumor suppressor kinase 2 and BRCA1 associated protein 1 (30,31).

Although previous studies have revealed important roles for miR-31 in different cancer types (20–22,32), the role of miR-31 in TNBC remains unclear. The aim of the present study was to investigate the role of miR-31 in TNBC by overexpressing or silencing miR-31 in TNBC cell lines.

Materials and methods

Cell line and cell culture

The human TNBC cell line MDA-MB-231 was obtained from The Cell Bank of the Chinese Academy of Sciences and cultured in DMEM (HyClone; GE Healthcare Life Sciences) containing 10% FBS, 100 U/ml penicillin and 100 µg/ml streptomycin (all Gibco; Thermo Fisher Scientific, Inc.). Cells were incubated at 37°C in a humidified incubator with 5% CO2.

Cells were transfected with miR-31-5p mimics or miR-31-5p inhibitors for 48 h at 37°C, and then treated with 50 µM Taxol (TAX; Aladdin Biochemical Technology, Co., Ltd.) for 24 h, 50 µM cisplatin (DDP; Sigma-Aldrich; Merck KGaA) for 24 h or 20 µM LY294002 (Selleck Chemicals), an antagonist of the AKT pathway, for 48 h at 37°C, respectively. Following treatments, cells were used for the following experiments.

miR-31-5p mimic and inhibitor

The miR-31-5p mimic and miR-31-5p inhibitor were used to overexpress or repress the expression level of miR-31-5p. The hsa-miR-31-5p mimic (final concentration, 5 nM), inhibitor (final concentration, 50 nM) and negative controls (NCs; final concentration, 5 nM) were synthesized by GenePharma. The sequences of the miR-31-5p mimic, inhibitor and NC are presented in Table I. Cells were plated in six-well plates and transfected with the mimic, inhibitor and NC using Lipofectamine 2000 (Invitrogen; Thermo Fisher Scientific, Inc.) according to the manufacturer's protocol. Cells were harvested for further experimentation after 48 h.

Table I.

Primer, mimic and inhibitor sequences.

Table I.

Primer, mimic and inhibitor sequences.

OligonucleotideSequences (5′-3′)
miR-31-5p PrimersF: ACACTCCAGCTGGGAGGCAAGATGCTGGC
R: TGGTGTCGTGGAGTCG
U6 PrimersF: CTCGCTT CGGCAGCACA
R: AACGCTTCACGAATTTGCGT
miR-31-5p mimic AGGCAAGAUGCUGGCAUAGCU
miR-31-5p mimic NC UUGUACUACACAAAAGUACUG
miR-31-5p inhibitor AGCUAUGCCAGCAUCUUGCCU
miR-31-5p inhibitor NC CAGUACUUUUGUGUAGUACAA

[i] miR, microRNA; NC, negative control.

Reverse transcription-quantitative PCR (RT-qPCR)

Treated cells were rinsed twice with PBS, and RNA was extracted using TRIzol Reagent (Invitrogen; Thermo Fisher Scientific, Inc.) according to the manufacturer's protocol. cDNA was synthesized using a Moloney murine leukemia virus reverse transcriptase kit (Promega Corporation) on an ABI 7300 system (Applied Biosystems; Thermo Fisher Scientific, Inc.) using the following protocol: 37°C for 60 min, 85°C for 5 min and 4°C for 5 min. RT-qPCR was performed using a SYBR Green qPCR kit (Thermo Fisher Scientific, Inc.) and an ABI 7300 system using the following protocol: 95°C for 10 min, 40 cycles of 95°C for 15 sec and 60°C for 45 sec, 95°C for 15 sec, 60°C for 1 min, and 4°C for 10 min. Gene expression levels were normalized to the expression level of U6 and calculated using the 2−∆∆Cq method (33). The sequences of the primers used for the RT-qPCR analysis are presented in Table I.

Cell proliferation

A Cell Counting Kit-8 assay (CCK-8; Beyotime Institute of Biotechnology) was used to examine cell proliferation. Treated cells were plated into 96-well plate (2,000 cells/well). After 24, 48 and 72 h of all treatments, the medium was replaced with DMEM containing 10% CCK-8 solution and the cells were incubated for 1 h at 37°C. Following incubation, the absorbance was detected using an automatic microplate reader (Bio-Rad Laboratories, Inc.) at a wavelength of 450 nm. Experiments were performed in triplicate.

Cell apoptosis

An Annexin V/propidium iodide (PI) apoptosis detection kit (BD Biosciences) was used to measure the cell apoptosis according to the manufacturer's protocol. Cells were plated into six-well plates and then transfected and/or treated with various drugs. Cells were rinsed twice with cold PBS and incubated in the staining buffer, which was included in the kit. Then, the cells were stained with Annexin V and PI for 15 min at 37°C in the dark and then evaluated by flow cytometry (Accuri C6; BD Biosciences). Experiments were performed in triplicate.

Western blot analysis

Whole protein was extracted from MDA-MB-231 cells after two washes with cold PBS using RIPA lysis buffer (Beyotime Institute of Biotechnology). Protein concentration was measured by BCA kit (Bio-Rad Laboratories, Inc.). A total of 20 µg protein from each group was and then separated by SDS-PAGE on 10% gels, and after separation the proteins were transferred to nitrocellulose membranes (EMD Millipore). After blocking with PBST containing 5% BSA (Beyotime Institute of Biotechnology), the blots were incubated with the appropriate primary antibodies at 4°C overnight and horseradish peroxidase-conjugated secondary antibodies (cat. no. A0216; 1:1,000 dilution; Beyotime Institute of Biotechnology) at room temperature for 1 h. The primary antibodies used (dilution, 1:1,000) were the following: Anti-P-glycoprotein (P-gp; cat. no. ab103477), anti-Bcl-2 (cat. no. ab32124), and anti-Bax (cat. no. ab32503; all Abcam), anti-AKT (cat. no. 4685), anti-phosphorylated (p)-AKT (cat. no. 4060) and anti-GAPDH (cat. no. 5174; all Cell Signaling Technologies, Inc.). Signals were detected using an ECL kit (EMD Millipore). Bands were analyzed with ImageJ 5.0 (National Institutes of Health) and GAPDH was used as the loading control.

Statistics

All the experiments were performed ≥3 times. Data are presented as the mean ± SD. The statistical differences between the control and treatment groups were determined using ANOVA followed by a Student-Newman-Keuls test. Data were analyzed using GraphPad Prism 6.0 (GraphPad Software, Inc.). P<0.05 was considered to indicate a statistically significant difference.

Results

Overexpression of miR-31 promotes apoptosis and inhibits cell proliferation in TNBC cells

To investigate the role of miR-31-5p in TNBC, MDA-MB-231 and MDA-MB-468 cell lines were selected to examine the effects of altering the expression level of miR-31-5p. The miR-31-5p mimic and miR-31-5p inhibitor were transfected into MDA-MB-231 and MDA-MB-468 cells. RT-qPCR was used to detect the efficiency of miR-31-5p overexpression and inhibition. miR-31-5p was dramatically increased and reduced after miR-31-5p mimic and inhibitor transfection, respectively (Fig. 1A). Following the determination of the transfection efficiencies, the effects of miR-31-5p on cell proliferation were examined. Cell Counting Kit-8 assay was performed to measure cell proliferation and cytotoxicity. Cells transfected with miR-31-5p mimic proliferated more slowly than cells transfected with miR-NC (Fig. 1B). The miR-31-5p inhibitor transfection exhibited opposite effects, as this transfection promoted cell proliferation in MDA-MB-231 and MDA-MB-468 cells. To explore the mechanism underlying miR-31-p function, cells were stained with Annexin-V, and flow cytometry was performed to detect the effects of miR-31 on cell apoptosis. An increased number of PI and Annexin-V double positive cells were found in the group transfected with miR-31-5p mimic, suggesting an increase in cell apoptosis. miR-31-5p inhibitor reduced apoptosis in MDA-MB-231 and MDA-MB-468 cells, in line with the aforementioned results (Fig. 1C). Collectively, the present data suggested that overexpression of miR-31-5p promoted apoptosis and inhibited cell proliferation in MDA-MB-231 and MDA-MB-468 cells. By contrast, inhibition of miR-31-5p expression exhibited the opposite effects on cell proliferation and apoptosis.

Figure 1.

Overexpression of miR-31 promotes apoptosis but inhibits cell proliferation in TNBC cells. (A) Reverse transcription-quantitative PCR was performed to detect the expression level of miR-31-5p following transfection with miR-31-5p mimic or inhibitor. (B) Cell Cycle Kit-8 assay was performed to measure cell proliferation in MDA-MB-231 and MDA-MB-468 cells. (C) Flow cytometry was performed to measure cell apoptosis following staining with annexin-V and PI. ***P<0.001 vs. NC. WT, wild-type; NC, negative control; miR, microRNA; PI, propidium iodide; OD, optical density.

miR-31 overexpression increases the sensitivity of TNBC to TAX and DDP treatment

TNBC is an aggressive cancer with a high risk of relapse within the first 3–5 years after the completion of adjuvant chemotherapy treatments (34). The potential role of miR-31-5p in chemotherapy resistance was then investigated. First, the appropriate concentration of each drug was examined. Treatment with TAX and DDP at 50 µmol/l induced cell apoptosis but did not induce cell death in a large portion of the cell population. After transfection with miR-31-5p mimic for 48 h, 50 µmol/l TAX or DDP were used to treat cells for 48 h. Then, the harvested cells were stained with PI and annexin-V and flow cytometry was performed to detect cell apoptosis. Single treatment with TAX or DDP increased apoptosis, but the effects were increased when combined with miR-31-5p mimic transfection (apoptotic rates: TAX, 25.7±0.61%; TAX + mimic, 45.8±0.52%; DDP, 28.74±0.74%; and DDP + mimic, 54.8±0.87%) (Fig. 2A). Then, the underlying mechanisms of miR-31-5p-mediated chemoresistance were investigated. Following various treatments, cells were harvested and western blotting was performed to detect the expression levels of apoptosis-related proteins, including an apoptosis suppressor (Bcl-2) (35) and a positive regulator of apoptosis (Bax) (36). The protein expression level of P-gp, which is negatively associated with chemotherapy sensitivity (37), was also detected. As presented in Fig. 2B, P-gp expression increased with single treatment with TAX or DDP, but significantly decreased following drug treatments combined with miR-31 mimic transfection. Bcl-2 was decreased after treatment with TAX or DDP and the effects were more significant in cells transfected with miR-31 mimic. Consistently, monotherapy with TAX or DDP significantly increased the protein expression levels of Bax, and the increase was greater following miR-31 mimics transfection. However, the levels of p-AKT, a tumor proliferation marker (38), showed opposite trends compared with Bax, suggesting decreased proliferation and increased apoptosis following miR-31 mimics transfection (Fig. 2C). Collectively, the synergistic effect of miR-31-5p and TAX or DDP promoted apoptosis in TNBC cells.

Figure 2.

miR-31 overexpression increases the sensitivity of TNBC to TAX and DDP. (A) Flow cytometry was performed to measure cell apoptosis after staining with annexin-V and PI. (B) Western blot analysis was performed to detect the protein expression level of P-gp, Bcl-2 and Bax. (C) Both AKT and p-AKT protein levels were measured by western blotting. ***P<0.001 vs. WT; &&&P<0.001 vs. NC + TAX; $$$P<0.001 vs. NC+DDP. WT, wild-type; NC, negative control; TAX, Taxol; DCC, cisplatin; miR, microRNA; PI, propidium iodide; p-, phosphorylated; P-gp, P-glycoprotein.

Inhibition of miR-31-5p decreases the sensitivity of TNBC to TAX and DDP treatment

To further validate the present findings, cells were transfected with miR-31-5p inhibitor, and flow cytometry and western blotting were performed. The inhibition of miR-31-5p slightly reduced the apoptotic rates induced by single treatment with TAX or DDP (apoptosis rates: TAX, 23.8±0.46%; TAX + inhibitor, 16.2±0.46%; DDP, 28.37±1.12%; and DDP + inhibitor, 16.63±0.4%) (Fig. 3A). To study the mechanism of miR-31-5p, markers of apoptosis and proliferation were detected by western blotting. Both P-gp and Bcl-2 were significantly increased after combined chemotherapy and transfection of miR-31-5p inhibitor (Fig. 3B). Consistently, treatment with TAX or DDP and transfection of the inhibitor dramatically decreased the levels of Bax. However, the amplification marker p-AKT showed contrasting trends with Bax, suggesting increased proliferation but decreased apoptosis after transfection of miR-31-5p inhibitor (Fig. 3B). Collectively, the present results suggested that inhibition of miR-31-5p reduced the apoptotic rates induced by TAX and DDP, indicating a decreased sensitivity to chemotherapy in TNBC.

Figure 3.

Inhibition of AKT pathway reestablishes the sensitivity to chemotherapy in TNBC cells. (A) Flow cytometry was performed to measure cell apoptosis after staining with annexin-V and PI. (B) Western blotting was performed to detect the protein levels of P-gp, Bcl-2, Bax, AKT and p-AKT. *P<0.05, **P<0.01, ***P<0.001. NC, negative control; TAX, Taxol; DCC, cisplatin; miR, microRNA; p-, phosphorylated; P-gp, P-glycoprotein; PI, propidium iodide.

Suppression of the AKT pathway restores sensitivity to chemotherapy in TNBC

The present results suggested that treatment with TAX or DDP with or without the transfection of miR-31-5p mimic or inhibitor altered the activity of the AKT pathway. To further investigate the role of the AKT pathway in chemotherapy resistance of TNBC, the AKT inhibitor LY294002 was used to block the AKT pathway, and the effects on chemotherapy resistance in TNBC cells were investigated. First, cells were transfected with miR-31-5p inhibitor for 48 h and treated with TAX or DDP combined with AKT inhibitor LY294002 (20 µM) for 48 h. Then, flow cytometry was performed to detect cell viability. As shown in Fig. 3A, cells treated with a monotherapy of TAX or DDP showed a slight increase of cell apoptosis, as indicated by the number of cells positive for both PI and Annexin-V (apoptotic rates: TAX, 23.8±0.46%; DDP, 28.37±1.12%). However, the apoptosis induced by chemotherapy could be attenuated by the inhibition of miR-31-5p following transfection of miR-31-5p inhibitor (apoptotic rates: TAX + inhibitor, 16.2±0.46%; DDP + inhibitor, 16.63±0.4%). Interestingly, LY294002 treatment could restore sensitivity to TAX or DDP (apoptotic rates: TAX + inhibitor + LY294002, 24.67±0.32%; DDP + inhibitor + LY294002, 32.73±1%). To investigate the mechanism underlying miR-31-5p function, western blotting was performed to detect the protein expression level of apoptosis and proliferation markers. Treatment with TAX or DDP in cells transfected with miR-31-5p inhibitor induced an increase in P-gp expression. Similar results were found for Bcl-2. However, Bax levels were reduced after treatment with TAX or DDP in cells transfected with miR-31-5p inhibitor. Interestingly, cells treated with LY294002 showed increased levels of Bax compared with monotherapy of TAX or DDP, indicating higher levels of apoptosis were found in the LY294002 group (Fig. 3B). In addition, AKT and p-AKT levels were also investigated. As shown in Fig. 3B, the level of AKT did not change among groups. However, p-AKT levels increased significantly compared with single treatments (NC + TAX or NC + DDP). Consistently, after treatment with LY294002, the expression level of p-AKT was significantly reduced to the expression level in the control group. Collectively, the present results suggested that the apoptosis induced by monotherapy with TAX or DDP could be attenuated by transfection with miR-31-5p inhibitor, and this effect was reversed by treatment with LY294002, an AKT inhibitor.

Discussion

As an essential chemotherapeutic agent, TAX, also known as paclitaxel, has been used to treat various types of tumors, including non-small cell lung cancer, prostate cancer and ovarian cancer (39–41). However, its clinical efficacy is limited as the chemoresistance of primary tumor cells during the course of treatment was found in a large proportion of patients (42,43). For the treatment of a diverse group of malignancies, including breast, prostate, ovarian, testicular, cervical, bladder, lung cancer and refractory non-Hodgkin's lymphomas, DDP is a widely used chemotherapeutic agent (44). However, resistance to TAX and DDP is found in the late stage of breast cancer and in particular in TNBC.

It has been reported that AKT, a serine/threonine kinase, serves a significant role in cell survival following exposure to apoptotic stimuli (45,46). In breast cancer, constitutive activation of the PI3K/AKT pathway in combination with the upregulation of HER2 and/or loss of PTEN suppressor gene, confers resistance to endocrine therapy including tamoxifen, and EGFR- and HER2-targeted therapies (47,48). In the present study, cell proliferation was found to be suppressed following overexpression of miR-31-5p, and was increased following miR-31-5p inhibitor transfection. Consistently, cell apoptosis was promoted by overexpression of miR-31-5p but suppressed by miR-31-5p inhibition. The present results are in line with prior observations regarding miR-31-5p, and suggested that miR-31-5p may act as a tumor suppressor in breast cancer and in particular in TNBC. TAX and DDP showed no significant inhibitory effects on TNBC cell proliferation. Cells treated with mimic + TAX or mimic + DDP showed higher apoptotic rate than cells treated with only TAX or DDP.

The present results indicated that overexpression of miR-31-5p restored sensitivity to both drugs. Consistently, inhibition of miR-31-5p blocked the effects of the drugs by reducing cell apoptosis. Interestingly, the reduction in the sensitivity to TAX and DDP induced by miR-31-5p inhibition could be restored by inhibiting AKT using LY294002. The PI3K/AKT/mTOR pathway is frequently activated in breast cancer, and PIK3 catalytic subunit α was found to be the most commonly mutated gene in ER-positive breast cancer (9). As previously reported, the activation of this pathway has been found to be associated with the resistance to therapies targeting HER2, and endocrine and cytotoxic therapy in breast cancer (48).

As previously reported, miR-31 induces cell apoptosis by downregulating the expression level of Bcl-2 by directly targeting protein kinase C ε (PKCε) in breast cancer cells (32). PKCε may serve a role in the increased rates of cell apoptosis induced by miR-31-5p and TAX or DDP treatment in TNBC. In addition, PKCε may be involved in the molecular mechanism underlying miR-31-5p-mediated apoptosis regulation.

The present findings suggested that the AKT pathway may be involved in the acquisition of chemotherapy resistance. Therefore, combination of miR-31-5p and AKT inhibitors may enhance efficacy of chemotherapy in breast cancer, and, in particular, in TNBC. However, in order to confirm the present results, mechanistic and clinical studies are required to identify the exact pathways involved in the increased chemosensitivity caused by miR-31-5p. In addition, xenograft models and genetically engineered mouse model may be used in the future to investigate the role of miR-31-5p in vivo. However, the present findings suggest that it is necessary to examine the role and the underlying mechanisms of miR-31-5p in TNBC, and the present results may facilitate the development of using miR-31-5p to regulate treatments in order to enhance therapeutic efficacy in the future.

Acknowledgements

Not applicable.

Funding

No funding was received.

Availability of data and materials

The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.

Authors' contributions

LD conceived and designed the present study. XS performed cell culture experiments and wrote the manuscript. JL performed western blot and RT-qPCR analyses, and analyzed the data.

Ethics approval and consent to participate

Not applicable.

Patient consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

References

1 

Fragomeni SM, Sciallis A and Jeruss JS: Molecular subtypes and local-regional control of breast cancer. Surg Oncol Clin N Am. 27:95–120. 2018. View Article : Google Scholar : PubMed/NCBI

2 

Camorani S, Fedele M, Zannetti A and Cerchia L: TNBC challenge: Oligonucleotide aptamers for new imaging and therapy modalities. Pharmaceuticals (Basel). 11(pii): E1232018. View Article : Google Scholar : PubMed/NCBI

3 

Dent R, Trudeau M, Pritchard KI, Hanna WM, Kahn HK, Sawka CA, Lickley LA, Rawlinson E, Sun P and Narod SA: Triple-negative breast cancer: Clinical features and patterns of recurrence. Clin Cancer Res. 13:4429–4434. 2007. View Article : Google Scholar : PubMed/NCBI

4 

John EM, Hines LM, Phipps AI, Koo J, Longacre TA, Ingles SA, Baumgartner KB, Slattery ML and Wu AH: Reproductive history, breast-feeding and risk of triple negative breast cancer: The Breast Cancer Etiology in Minorities (BEM) study. Int J Cancer. 142:2273–2285. 2018. View Article : Google Scholar : PubMed/NCBI

5 

Domagala P, Huzarski T, Lubinski J, Gugala K and Domagala W: Immunophenotypic predictive profiling of BRCA1-associated breast cancer. Virchows Arc. 458:55–64. 2011. View Article : Google Scholar

6 

Sameni M, Tovar EA, Essenburg CJ, Chalasani A, Linklater ES, Borgman A, Cherba DM, Anbalagan A, Winn ME, Graveel CR and Sloane BF: Cabozantinib (XL184) inhibits growth and invasion of preclinical TNBC models. Clin Cancer Res. 22:923–934. 2016. View Article : Google Scholar : PubMed/NCBI

7 

Ouyang M, Li Y, Ye S, Ma J, Lu L, Lv W, Chang G, Li X, Li Q, Wang S and Wang W: MicroRNA profiling implies new markers of chemoresistance of triple-negative breast cancer. PLoS One. 9:e962282014. View Article : Google Scholar : PubMed/NCBI

8 

O'Shaughnessy J, Osborne C, Pippen JE, Yoffe M, Patt D, Rocha C, Koo IC, Sherman BM and Bradley C: Iniparib plus chemotherapy in metastatic triple-negative breast cancer. N Engl J Med. 364:205–214. 2011. View Article : Google Scholar : PubMed/NCBI

9 

Ellis MJ and Perou CM: The genomic landscape of breast cancer as a therapeutic roadmap. Cancer Discov. 3:27–34. 2013. View Article : Google Scholar : PubMed/NCBI

10 

Altundag K: Is there a role of breast pathologist in diagnostic challenges of discordances in ER, PR, and HER2 between primary breast cancer and brain metastasis? J Neurooncol. 138:2192018. View Article : Google Scholar : PubMed/NCBI

11 

Dackus GMHE, Jozwiak K, Sonke GS, van der Wall E, van Diest PJ, Hauptmann M, Siesling S and Linn SC: Optimal adjuvant endocrine treatment of ER+/HER2+ breast cancer patients by age at diagnosis: A population-based cohort study. Eur J Cancer. 90:92–101. 2018. View Article : Google Scholar : PubMed/NCBI

12 

Jung J, Lee SH, Park M, Youn JH, Shin SH, Gwak HS and Yoo H: Discordances in ER, PR, and HER2 between primary breast cancer and brain metastasis. J Neurooncol. 137:295–302. 2018. View Article : Google Scholar : PubMed/NCBI

13 

Di Leva G, Calin GA and Croce CM: MicroRNAs: Fundamental facts and involvement in human diseases. Birth Defects Res C Embryo Today. 78:180–189. 2006. View Article : Google Scholar : PubMed/NCBI

14 

Calin GA, Dumitru CD, Shimizu M, Bichi R, Zupo S, Noch E, Aldler H, Rattan S, Keating M, Rai K, et al: Frequent deletions and down-regulation of micro-RNA genes miR15 and miR16 at 13q14 in chronic lymphocytic leukemia. Proc Natl Acad Sci USA. 99:15524–15529. 2002. View Article : Google Scholar : PubMed/NCBI

15 

Michael MZ, SM OC, van Holst Pellekaan NG, Young GP and James RJ: Reduced accumulation of specific microRNAs in colorectal neoplasia. Mol Cancer Res. 1:882–891. 2003.PubMed/NCBI

16 

Takamizawa J, Konishi H, Yanagisawa K, Tomida S, Osada H, Endoh H, Harano T, Yatabe Y, Nagino M, Nimura Y, et al: Reduced expression of the let-7 microRNAs in human lung cancers in association with shortened postoperative survival. Cancer Res. 64:3753–3756. 2004. View Article : Google Scholar : PubMed/NCBI

17 

Metzler M, Wilda M, Busch K, Viehmann S and Borkhardt A: High expression of precursor microRNA-155/BIC RNA in children with Burkitt lymphoma. Genes Chromosomes Cancer. 39:167–169. 2004. View Article : Google Scholar : PubMed/NCBI

18 

Eis PS, Tam W, Sun L, Chadburn A, Li Z, Gomez MF, Lund E and Dahlberg JE: Accumulation of miR-155 and BIC RNA in human B cell lymphomas. Proc Natl Acad Sci USA. 102:3627–3632. 2005. View Article : Google Scholar : PubMed/NCBI

19 

Singh R and Mo YY: Role of microRNAs in breast cancer. Cancer Biol Ther. 14:201–212. 2013. View Article : Google Scholar : PubMed/NCBI

20 

Deng Y, Bi X, Zhou H, You Z, Wang Y, Gu P and Fan X: Repair of critical-sized bone defects with anti-miR-31-expressing bone marrow stromal stem cells and poly(glycerol sebacate) scaffolds. Eur Cell Mater. 27:13–25. 2014. View Article : Google Scholar : PubMed/NCBI

21 

Stepicheva NA and Song JL: Function and regulation of microRNA-31 in development and disease. Mol Reprod Dev. 83:654–674. 2016. View Article : Google Scholar : PubMed/NCBI

22 

Huang S, Chen Z, Wu W, Wang M, Wang R, Cui J, Li W and Wang S: MicroRNA-31 promotes arterial smooth muscle cell proliferation and migration by targeting mitofusin-2 in arteriosclerosis obliterans of the lower extremitie. Exp Ther Med. 15:633–640. 2018.PubMed/NCBI

23 

Munoz X, Mata A, Bassas L and Larriba S: Altered miRNA signature of developing germ-cells in infertile patients relates to the severity of spermatogenic failure and persists in spermatozoa. Sci Rep. 5:179912015. View Article : Google Scholar : PubMed/NCBI

24 

Kresowik JD, Devor EJ, Van Voorhis BJ and Leslie KK: MicroRNA-31 is significantly elevated in both human endometrium and serum during the window of implantation: A potential biomarker for optimum receptivity. Biol Reprod. 91:172014. View Article : Google Scholar : PubMed/NCBI

25 

Augoff K, Das M, Bialkowska K, McCue B, Plow EF and Sossey-Alaoui K: miR-31 is a broad regulator of β1-integrin expression and function in cancer cells. Mol Cancer Res. 9:1500–1508. 2011. View Article : Google Scholar : PubMed/NCBI

26 

Yamagishi M, Nakano K, Miyake A, Yamochi T, Kagami Y, Tsutsumi A, Matsuda Y, Sato-Otsubo A, Muto S, Utsunomiya A, et al: Polycomb-mediated loss of miR-31 activates NIK-dependent NF-kappaB pathway in adult T cell leukemia and other cancers. Cancer Cell. 21:121–135. 2012. View Article : Google Scholar : PubMed/NCBI

27 

Kim HS, Lee KS, Bae HJ, Eun JW, Shen Q, Park SJ, Shin WC, Yang HD, Park M, Park WS, et al: MicroRNA-31 functions as a tumor suppressor by regulating cell cycle and epithelial-mesenchymal transition regulatory proteins in liver cancer. Oncotarget. 6:8089–8102. 2015.PubMed/NCBI

28 

Cottonham CL, Kaneko S and Xu L: miR-21 and miR-31 converge on TIAM1 to regulate migration and invasion of colon carcinoma cells. J Biol Chem. 285:35293–35302. 2010. View Article : Google Scholar : PubMed/NCBI

29 

Xu RS, Wu XD, Zhang SQ, Li CF, Yang L, Li DD, Zhang BG, Zhang Y, Jin JP and Zhang B: The tumor suppressor gene RhoBTB1 is a novel target of miR-31 in human colon cancer. Int J Oncol. 42:676–682. 2013. View Article : Google Scholar : PubMed/NCBI

30 

Liu CJ, Tsai MM, Hung PS, Kao SY, Liu TY, Wu KJ, Chiou SH, Lin SC and Chang KW: miR-31 ablates expression of the HIF regulatory factor FIH to activate the HIF pathway in head and neck carcinoma. Cancer Res. 70:1635–1644. 2010. View Article : Google Scholar : PubMed/NCBI

31 

Yu M, Liang H, Fu Z, Wang X, Liao Z, Zhou Y, Liu Y, Wang Y, Hong Y, Zhou X, et al: BAP1 suppresses lung cancer progression and is inhibited by miR-31. Oncotarget. 7:13742–13753. 2016.PubMed/NCBI

32 

Korner C, Keklikoglou I, Bender C, Worner A, Munstermann E and Wiemann S: MicroRNA-31 sensitizes human breast cells to apoptosis by direct targeting of protein kinase C epsilon (PKCepsilon). J Biol Chem. 288:8750–8761. 2013. View Article : Google Scholar : PubMed/NCBI

33 

Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods. 25:402–408. 2001. View Article : Google Scholar : PubMed/NCBI

34 

Park JH, Ahn JH and Kim SB: How shall we treat early triple-negative breast cancer (TNBC): From the current standard to upcoming immuno-molecular strategies. ESMO Open. 3 (Suppl 1):e0003572018. View Article : Google Scholar : PubMed/NCBI

35 

Siddiqui WA, Ahad A and Ahsan H: The mystery of BCL2 family: Bcl-2 proteins and apoptosis: An update. Arch Toxicol. 89:289–317. 2015. View Article : Google Scholar : PubMed/NCBI

36 

Lin Y, Kokontis J, Tang F, Godfrey B, Liao S, Lin A, Chen Y and Xiang J: Androgen and its receptor promote Bax-mediated apoptosis. Mol Cell Biol. 26:1908–1916. 2006. View Article : Google Scholar : PubMed/NCBI

37 

Ge C, Cao B, Feng D, Zhou F, Zhang J, Yang N, Feng S, Wang G and Aa J: The down-regulation of SLC7A11 enhances ROS induced P-gp over-expression and drug resistance in MCF-7 breast cancer cells. Sci Rep. 7:37912017. View Article : Google Scholar : PubMed/NCBI

38 

Paplomata E and O'Regan R: The PI3K/AKT/mTOR pathway in breast cancer: Targets, trials and biomarkers. Ther Adv Med Oncol. 6:154–166. 2014. View Article : Google Scholar : PubMed/NCBI

39 

Henley D, Isbill M, Fernando R, Foster JS and Wimalasena J: Paclitaxel induced apoptosis in breast cancer cells requires cell cycle transit but not Cdc2 activity. Cancer Chemother Pharmacol. 59:235–249. 2007. View Article : Google Scholar : PubMed/NCBI

40 

Tan M and Yu D: Molecular mechanisms of erbB2-mediated breast cancer chemoresistance. Adv Exp Med Biol. 608:119–129. 2007. View Article : Google Scholar : PubMed/NCBI

41 

Orr GA, Verdier-Pinard P, McDaid H and Horwitz SB: Mechanisms of Taxol resistance related to microtubules. Oncogene. 22:7280–7295. 2003. View Article : Google Scholar : PubMed/NCBI

42 

Frankel A, Buckman R and Kerbel RS: Abrogation of taxol-induced G2-M arrest and apoptosis in human ovarian cancer cells grown as multicellular tumor spheroids. Cancer Res. 57:2388–2393. 1997.PubMed/NCBI

43 

Yin S, Bhattacharya R and Cabral F: Human mutations that confer paclitaxel resistance. Mol Cancer Ther. 9:327–335. 2010. View Article : Google Scholar : PubMed/NCBI

44 

Tsimberidou AM, Braiteh F, Stewart DJ and Kurzrock R: Ultimate fate of oncology drugs approved by the us food and drug administration without a randomized Trial. J Clin Oncol. 27:6243–6250. 2009. View Article : Google Scholar : PubMed/NCBI

45 

Song G, Ouyang G and Bao S: The activation of Akt/PKB signaling pathway and cell survival. J Cell Mol Med. 9:59–71. 2005. View Article : Google Scholar : PubMed/NCBI

46 

Wang YP, Huang LY, Sun WM, Zhang ZZ, Fang JZ, Wei BF, Wu BH and Han ZG: Insulin receptor tyrosine kinase substrate activates EGFR/ERK signalling pathway and promotes cell proliferation of hepatocellular carcinoma. Cancer Lett. 337:96–106. 2013. View Article : Google Scholar : PubMed/NCBI

47 

Tokunaga E, Kimura Y, Mashino K, Oki E, Kataoka A, Ohno S, Morita M, Kakeji Y, Baba H and Maehara Y: Activation of PI3K/Akt signaling and hormone resistance in breast cancer. Breast Cancer. 13:137–144. 2006. View Article : Google Scholar : PubMed/NCBI

48 

Clark AS, West K, Streicher S and Dennis PA: Constitutive and inducible Akt activity promotes resistance to chemotherapy, trastuzumab, or tamoxifen in breast cancer cells. Mol Cancer Ther. 1:707–717. 2002.PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Shen X, Lei J and Du L: miR‑31‑5p may enhance the efficacy of chemotherapy with Taxol and cisplatin in TNBC. Exp Ther Med 19: 375-383, 2020.
APA
Shen, X., Lei, J., & Du, L. (2020). miR‑31‑5p may enhance the efficacy of chemotherapy with Taxol and cisplatin in TNBC. Experimental and Therapeutic Medicine, 19, 375-383. https://doi.org/10.3892/etm.2019.8191
MLA
Shen, X., Lei, J., Du, L."miR‑31‑5p may enhance the efficacy of chemotherapy with Taxol and cisplatin in TNBC". Experimental and Therapeutic Medicine 19.1 (2020): 375-383.
Chicago
Shen, X., Lei, J., Du, L."miR‑31‑5p may enhance the efficacy of chemotherapy with Taxol and cisplatin in TNBC". Experimental and Therapeutic Medicine 19, no. 1 (2020): 375-383. https://doi.org/10.3892/etm.2019.8191
Copy and paste a formatted citation
x
Spandidos Publications style
Shen X, Lei J and Du L: miR‑31‑5p may enhance the efficacy of chemotherapy with Taxol and cisplatin in TNBC. Exp Ther Med 19: 375-383, 2020.
APA
Shen, X., Lei, J., & Du, L. (2020). miR‑31‑5p may enhance the efficacy of chemotherapy with Taxol and cisplatin in TNBC. Experimental and Therapeutic Medicine, 19, 375-383. https://doi.org/10.3892/etm.2019.8191
MLA
Shen, X., Lei, J., Du, L."miR‑31‑5p may enhance the efficacy of chemotherapy with Taxol and cisplatin in TNBC". Experimental and Therapeutic Medicine 19.1 (2020): 375-383.
Chicago
Shen, X., Lei, J., Du, L."miR‑31‑5p may enhance the efficacy of chemotherapy with Taxol and cisplatin in TNBC". Experimental and Therapeutic Medicine 19, no. 1 (2020): 375-383. https://doi.org/10.3892/etm.2019.8191
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team