Open Access

Long non‑coding RNA HOTAIRM1‑1 silencing in cartilage tissue induces osteoarthritis through microRNA‑125b

  • Authors:
    • Wen-Bin Liu
    • Qi-Jin Feng
    • Gui-Shi Li
    • Peng Shen
    • Ya-Nan Li
    • Fu-Jiang Zhang
  • View Affiliations

  • Published online on: July 1, 2021     https://doi.org/10.3892/etm.2021.10365
  • Article Number: 933
  • Copyright: © Liu et al. This is an open access article distributed under the terms of Creative Commons Attribution License.

Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )


Abstract

Aberrations in long noncoding RNA (lncRNA) expression have been recognized in numerous human diseases. In the present study, the of role the long noncoding RNA HOX antisense intergenic RNA myeloid 1 variant (HOTAIRM1‑1) in regulating the pathological progression of osteoarthritis (OA) was investigated. The aberrant expression of HOTAIRM1‑1 in OA was demonstrated, but the molecular mechanisms require further analysis. The aim of the present study was to explore the function of miR‑125b in modulating chondrocyte viability and apoptosis, and to address the functional association between HOTAIRM1‑1 and miR‑125b as potential targets. A miR‑125b inhibitor was used, which laid the foundation for the following investigation. The study confirmed that HOTAIRM1‑1 and miR‑125b are inversely expressed in chondrocytes. The expression of HOTAIRM1‑1 was downregulated and the expression of miR‑125b was upregulated in tissues from patients with OA. HOTAIRM1‑1 directly interacted with miR‑125b in chondrocytes. HOTAIRM1‑1 knockdown was associated with chondrocyte proliferation and extracellular matrix degradation. Furthermore, miR‑125b reversed the effect of HOTAIRM1‑1 on cell proliferation and apoptosis. In conclusion, the present study indicates that the loss of HOTAIRM1‑1 function leads to aberrant increases in the proliferation and apoptosis of chondrocytes. miR‑125b may be a potential downstream mechanism that regulates the function of HOTAIRM1‑1, and this finding provides a therapeutic strategy for OA.

Introduction

Osteoarthritis (OA) is the most common type of arthritis, and it affects >10% of the adult population (1). Physicians consider the disease to be a degenerative disease that involves all the tissues of the joint. In OA, cartilage within a joint begins to break down, and the underlying bone begins to change (2). OA can induce substantial limb pain, stiffness, disability, and even loss of whole-body mobility. OA occurs most frequently in the hands, hips and knees, leading to difficulties in patients' daily activities (3). Therefore, numerous management strategies to prevent cartilage degeneration, such as microfracture surgery to stimulate a healing response, stem cell therapy to repair damaged articular cartilage, cartilage transplantation, and complementary treatments, have been developed (4-6).

Long noncoding RNAs (lncRNAs) are transcripts longer than 200 nucleotides and are noncoding RNAs. Aberrant expression of lncRNAs participate in numerous biological processes and various diseases by posttranscriptional or posttranslational regulation (7,8). Jiang et al (9) and Marques-Rocha et al (10) reported that patients with OA have aberrant expression of certain lncRNAs, which indicates that lncRNAs may play a key role in articular cartilage degeneration. Recently, the novel lncRNA HOX antisense intergenic RNA myeloid 1 (HOTAIRM1) was found to be expressed in cells of the myeloid lineage (11,12). Additional evidence has confirmed that HOTAIRM1 plays a crucial role in the pathological progression of colorectal cancer and several other diseases, such as acute myeloid leukemia (13-15). Nonetheless, the potential function of HOTAIRM1 in the development of osteoarthritis remains unknown.

HOTAIRM1 is located between the HOXA1 and HOXA2 loci and has been identified as a myeloid-specific regulator in the HOXA gene family. HOTAIRM1 targets gene transcription during the chromosome remodeling that occurs when myeloid cells are induced to undergo chondrogenic differentiation (16). Furthermore, previous studies in mesenchymal stem cells showed that miR-125b is a miRNA target of HOTAIRM1 during osteoblastic differentiation (16,17). In the present study, the hypothesis that HOTAIRM1-1 and miR-125b have a functional association and that miR-125b is a potential therapeutic target of articular cartilage denegation was tested.

Materials and methods

Tissue collection

The present study was approved by the human ethics committee of Tianjin Hospital. All the patients provided written informed consent and participated in the study according to their own will. A total of 15 articular cartilage samples were obtained from patients with OA undergoing total knee arthroplasty (n=15; mean age, 65.8 ± 6.2 years; 5 males and 10 females). Healthy control articular cartilage samples were collected from trauma patients who underwent amputation and did not have a history of rheumatoid arthritis or OA (n=8; mean age, 41.2 ± 9.1 years; 5 male and 3 female). There was no significant difference between the OA group and the control group in terms of sex or age.

Cell culture

Chondrocytes from the cartilage of patients with OA were cultured following a previously published protocol (18). In brief, small sections of OA cartilage tissues were digested with trypsin (0.25%). Then, type II collagenase (0.2%; Gibco; Thermo Fisher Scientific, Inc.) was incubated with the samples. The chondrocytes were cultured in Dulbecco's modified Eagle's medium (DMEM; Gibco; Thermo Fisher Scientific, Inc.) containing 10% FBS and maintained in a cell incubator containing 5% CO2 at 37˚C.

Cell transfection

The plasmids containing small interfering (si)RNA targeting HOTAIRM1-1 (si-HOTAIRM1-1, 5'-CACCGGAGACTGGTAGCTTATTATTCAAGAGATAATAAGCTACCAGTCTCCTTTTTTG-3') or a si-HOTAIRM1-1 negative control sequence (si-NC, 5'-CACCGTTCTCCGAACGTCACGTCAAGAGATTACGTGACACGTTCGGAGAATTTTTT-3') were purchased from Gene-Pharma (Shanghai GenePharma Co., Ltd.). Briefly, siRNA was transfected into cultured chondrocytes by using Lipofectamine® 2000 (Thermo Fisher Scientific, Inc.) at a concentration of 50 nM, following the manufacturer's instructions, which were plated into 6-well plates the day before transfection to achieve 60-70% confluency. After 48 h, the transfected cells were used for further analysis.

Synthetic miRNA mimics miR-125b, miR-125b inhibitor and their negative control (custom synthesized by Shanghai GenePharma Co., Ltd.) were transfected into cells following the Lipofectamine® RNAiMAX Reagent (Thermo Fisher Scientific, Inc.) transfection protocol. After 48 h, the transfected cells were used for further analysis.

Reverse transcription-quantitative PCR

Total RNA was extracted from cultured cells by using the TRIzol reagent (Invitrogen; Thermo Fisher Scientific, Inc.). Next, 1 mg RNA was reverse transcribed into complementary DNA using the PrimeScript RT reagent kit (Takara Bio, Inc.) at 23˚C for 30 min. Quantification of mRNA was determined by qPCR using a SYBRGreen supermix (Bio-Rad Laboratories, Inc.). The primers of HOTAIRM1-1, miR-125b, IL-10 and MMP-13 were designed and synthesized by Sangon Biotech Co., Ltd; The primer sequences are shown in Table I. Amplification conditions were 95˚C for 30 sec, followed by 35 cycles of 95˚C for 5 sec, and 60˚C for 30 sec. Moreover, to confirm that only one product was amplified, melting curve analysis was set at from 58 to 95˚C with stepwise fluorescence acquisition at every 1˚C/sec. Relative quantification was performed using the 2-ΔΔCq method (19). U6 was used as the endogenous reference gene for all experiments with ncRNA. GAPDH was used as normalization for matrix metalloprotease (MMP)13 and interleukin (IL)-10.

Table I

Primer sequences.

Table I

Primer sequences.

GeneF, 5'-3'R, 5'-3'
HOTAIRM1-1 AAACGAGGGATGGAAGGGAGCG CCAGGCATTCGGCAATGTG
miR-125b GCTTTGCTGCGTACTTCCA GTCCACACGGGTTCCAGA
MMP-13 GGCTTCGACACCCGTGTAA CGTCAAACCTCTTGTCATCCA
IL-10 GTAGAGGACACGGGCAAGAT TTCACGAACTGTCAACTGCAC
U6 CTCGGCTTCGGCAGCACA AACGCTTCACGAATTGCGT
GAPDH AGAAGGCTGGGGCATTTG AGGGGCCATCCACAGTCTTC

[i] HOTAIRM1-1, HOX antisense intergenic RNA myeloid 1 variant; miR, microRNA; MMP-13, matrix metalloprotease-13; IL-10, interleukin-10; F, forward; R, reverse.

Cell proliferation

To analyze cell proliferation, Cell Counting Kit-8 (Dojindo Molecular Technologies, Inc.) was used. The cells were seeded into 96-well plates at ~1x10 cells in each well. Cell proliferation was determined at 0, 24, 48 72 and 96 h. The 96-well plates were analyzed on a microplate reader at OD 450 nm.

Luciferase reporter gene assay

To construct 3'-untranslated region (UTR) Green Renilla Luciferase reporters (Thermo Fisher Scientific, Inc.), mutant and wild-type sequences were simultaneously constructed. Chondrocytes were cultured in 24-well plates, and then, the miR-125b mimics, miR-NC and mutant or wild-type HOTAIRM1-1 were transfected into the chondrocytes using a transfection kit (Lipofectamine 2000®; Thermo Fisher Scientific, Inc.) at 37˚C for 4 h. After 48 h, luciferase reporter gene assays were performed using a pierce renilla luciferase glow assay kit (Thermo Fisher Scientific, Inc.) to measure the luciferase activity. The results are shown as the firefly/Renilla ratio normalized to the Renilla luciferase activity.

Western blotting

Proteins were obtained from cultured cells with radioimmunoprecipitation assay (RIPA) buffer (Pierce; Thermo Fisher Scientific, Inc.) on ice for 30 min. The protein concentration of each cell lysate was determined by a BCA Assay kit (Thermo Fisher Scientific, Inc.). The protein samples (50 µg) were separated on 8% polyacrylamide gels by electrophoresis for 5 min at 50 V, and then the voltage was increased to 100 V for 1 h. Then, the proteins were transferred from the gels onto polyvinylidene difluoride (PVDF) membranes (EMD Millipore) followed by blocking with 5% non-fat milk in buffer [10 mM Tris-HCl (pH 7.6), 100 mM NaCl and 0.1% Tween-20] at 23˚C for 1 h. The membranes were incubated with anti-collagen II (cat. no. ab185430; 1:500 dilution; Abcam) and anti-aggrecan (cat. no. ab36861, 1:1,000 dilution; Abcam) primary antibodies for 4 h at room temperature. The membrane was washed twice and then incubated with Goat Anti-Rabbit IgG H&L secondary antibodies (cat. no. ab205718; 1:1,000; Abcam) for 60 min at room temperature. A chemiluminescent substrate was applied to the blots with an ECL detection kit (Thermo Fisher Scientific, Inc.). The chemiluminescence signals were captured using a Chemi-Doc XRS camera-based imager (Bio-Rad Laboratories, Inc.). Image analysis software was used to analyze the bands of the targeting proteins with Empiria Studio® Software (9141-500E; LI-COR Biosciences), and β-actin was used as the internal control to normalize the band intensity.

Terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL)

Cells were washed twice with cold PBS, after which samples were fixed with 4% paraformaldehyde for 2 min at 23˚C and washed twice with PBS. Terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL) staining was performed on cells with an In-Situ Cell Death Detection kit (Roche Diagnostics). A total of 50 µl reaction mixture (terminal deoxynucleotidyl transferase from calf thymus recombinant in E. coli. Buffer as enzyme solution and nucleotide; provided in the kit) was incubated for 1 h at 37˚C. After staining, samples were mounted with 4',6-diamidino-2-phenylindole (DAPI) mounting medium (Vector Laboratories, Inc.). Nuclear staining was performed at the same time as mounting, at room temperature for 10 min. A microscope was used to visualize cell apoptosis under 10 fields of view per sample (magnification, x200).

Identification of miRNA-mRNA and miRNA-ncRNA interactions

To inspect genome-wide interactions between miRNAs and their target genes, the conserved miRNA target sites were predicted using algorithms from a public database (http://starbase.sysu.edu.cn/index.php). starBase was intersected with the aforementioned Ago CLIP clusters to gain CLIP-supported sites.

Statistical analyses

The sample size for each experiment was determined based on power analysis calculations. All the data are shown as the mean ± SD (standard deviation). Statistical analyses and graph generation were completed by Prism GraphPad (GraphPad Software, Inc.). Student's t test was used for the analysis of two groups. One-way ANOVA followed by the Tukey-Kramer test was used to compare multiple groups. Two-way ANOVA was used to determine the effect of time, the effect of treatment, and their interaction. The Pearson's correlation analysis test was used to evaluate the strength of the association between two quantitative variables. P<0.05 was considered to indicate a statistically significant in all the tests.

Results

Expression of HOTAIRM1-1 and miR-125b in chondrocytes is inversely affected by IL-6 and IL-1β treatment

To mimic OA in vitro, the effect of IL-6 or IL-1β on HOTAIRM1-1 and miR-125b expression was first tested in chondrocytes. Chondrocytes were treated with IL-6 or IL-1β for 96 h. The data confirmed that IL-6 could significantly decreased chondrocyte proliferation (Fig. 1A). Using the same method, IL-1β had a similar effect and decreased chondrocyte proliferation (Fig. 1B). It was observed that the expression of HOTAIRM1-1 was decreased in chondrocytes after IL-6 treatment, but the expression of miR-125b increased in chondrocytes (Fig. 1C and D). Additionally, the results demonstrated similar trends in the expression of HOTAIRM1-1 and miR-125b in the group of chondrocytes treated with IL-1β (Fig. 1E and F).

Expression of HOTAIRM1-1 is downregulated and the expression of miR-125b is upregulated in OA tissues

Moreover, the hypothesis that the expression of HOTAIRM1-1 is downregulated in OA tissue was tested. The data demonstrated that the expression of HOTAIRM1-1 was significantly lower in the OA tissue samples compared with the healthy control samples (Fig. 2A; P<0.05). In addition, miR-125b expression was higher in the OA tissue samples compared with the healthy control tissue samples (Fig. 2B; P<0.01). The correlation test showed that the expression level of miR-125b was negatively correlated with the expression level of HOTAIRM1-1 (Fig. 2C).

HOTAIRM1-1 directly interacts with miR-125b in chondrocytes

Studies have reported that miR-125b is a directly competitive endogenous RNA (ceRNA) that affects the function of HOTAIRM1. However, whether HOTAIRM1-1 has a potential role in OA progression remains unknown. To address this question, potential miRNA binding sites that correlated with HOTAIRM1-1 were searched for with the starBase online tool (http://starbase.sysu.edu.cn/index.php; Fig. 3A). Furthermore, the luciferase assay results indicated that HOTAIRM1-1 directly targeted miR-125b, which confirms a direct association between HOTAIRM1-1 and miR-125b (Fig. 3B and C).

HOTAIRM1-1 knockdown is associated with chondrocyte proliferation and extracellular matrix degradation

Next, the effect of HOTAIRM1-1 knockdown on chondrocytes treated with IL-6 for 48 h before transfection was determined. Chondrocytes were transfected with an siRNA targeting HOTAIRM1-1. The expression of HOTAIRM1-1 was significantly downregulated in the si-HOTAIRM1-1 group compared with the si-NC-HOTAIRM1-1 group (Fig. 4A). The proliferation results demonstrated that HOTAIRM1-1 knockdown significantly decreased cell proliferation (Fig. 4B) and decreased cell cycle progression in the chondrocytes (Fig. 4C). MMP-13 and IL-10 were identified as the major cartilage-degrading enzyme markers in chondrocytes. Collagen II and aggrecan are considered to be fundamental extracellular matrix (ECM) proteins in chondrocytes. The results revealed that MMP-13 and IL-10 expression was increased in the si-HOTAIRM1-1 group (Fig. 4D and E). Conversely, ECM degeneration marker expression was significantly lower in the si-HOTAIRM1-1 group compared with the control group (Fig. 4F). In conclusion, cartilage-degrading enzymes may be upregulated by HOTAIRM1-1 knockdown, which promotes ECM degradation.

miR-125b reverses the effects of HOTAIRM1-1 on proliferation and apoptosis in IL-6-treated chondrocytes

To further explore whether HOTAIRM1-1 regulates chondrocyte proliferation and apoptosis via miR-125b in OA a rescue experiment was performed. As shown in Fig. 5A, miR-125b mimics transfection effectively increased the expression of miR-125b compared with mimics control transfection. The miR-125b inhibitor effectively decreased the expression of miR-125b compared with inhibitor negative control group. A CCK-8 assay was conducted to determine the proliferation ability of the chondrocytes, as shown in Fig. 5B. Downregulation of miR-125b strikingly promoted chondrocyte proliferation. However, miR-125b inhibition dramatically blocked this effect. TUNEL staining is shown in Fig. 5C. The miR-125b inhibitor significantly blocked chondrocyte apoptosis when the cells were treated with IL-6. Conversely, HOTAIRM1-1 knockdown increased cell apoptosis, while the miR-125b inhibitor obviously reversed this effect (Fig. 5d). It is postulated that miR-125b competitively binds to HOTAIRM1-1 to promote chondrocyte apoptosis.

Discussion

Understanding the association of key lncRNAs with disease pathogenesis would help with disease diagnosis and prognosis. Emerging reports have demonstrated that the lncRNA HOTAIRM1-1 is an important lncRNA in several tissues and diseases, such as colorectal cancer and acute myeloid leukemia (20,21). Additionally, HOTAIRM1-1 is involved in the biological processes associated with OA (22). Presently, many studies on OA focus on cartilaginous tissues, since cartilage is a key component of joints. Therefore, cartilage damage is thought to be a landmark event during OA pathology progression (23,24). Some studies have reported that the proinflammatory cytokines IL-6 and IL-1β may play a significant role in the pathology of OA (25). IL-6 is a compound that is characterized by omnidirectional interactions in the processes that occur in the human body. IL-6 is considered a cytokine that strongly activates the immune system and enhances the inflammatory response, although considering some of its effects, IL-6 may be classified as an anti-inflammatory cytokine (26). The production of IL-6 in tissues of joints affected by OA usually occurs in response to IL-1β and tumor necrosis factor (TNF)α and IL-6 and is mainly produced by chondrocytes (27). A study by Zanotti and Canalis (27) showed that IL-6 mediates the induction of MMP13 expression through Notch and contributes to the inhibitory effect of Notch on the mRNA levels in cells of the chondrocyte lineage. Simsa-Maziel and Monsonego-Ornan (28) suggest that interleukin-1β promotes the proliferation and inhibits the differentiation of chondrocytes through a mechanism involving the downregulation of fibroblast growth factor receptor-3 and p21.

In the present study, an in vitro model was established to mimic OA pathogenesis in chondrocytes. The results demonstrated that the inflammatory mediators IL-6 and IL-1β suppressed HOTAIRM1-1 expression in chondrocytes. In addition, the expression of miR-125b exhibited opposite changes, and its expression was increased after treatment with the inflammatory mediators (Fig. 1). Furthermore, the expression of HOTAIRM1-1 and miR-125b was investigated in cartilage samples from patients with OA and healthy subjects. It was found that the expression of HOTAIRM1-1 (downregulated) and miR-125b (upregulated) was inversely correlated in OA cartilage vs. healthy control cartilage (Fig. 2). The preliminary data suggest that miR-125b might stimulate the proliferation and apoptosis of chondrocytes through the development of osteoarthritis. In cells of the myeloid lineage, miR-125b represses interferon regulatory factor 4 and regulates inflammation by downregulating its direct target, TNFα (29). Nagpal et al (30) reported that miR-125b upregulation is critical for the TGF-β-induced fibroblast-to-myofibroblast transition, which implies a potential association between miR-125b and the TGF-β pathway. Zhen et al (31) demonstrated that inhibition of the TGF-β pathway in subchondral bone can attenuate OA progression. Moreover, in a bioinformatics study, the TNF signaling pathway was reported to be closely associated with HOX genes by interacting with HOX proteins (32). It was thus speculated that HOTAIRM1-1 and miR-125b physically interact with each other. The present study was performed to show an interaction between miR-125b and HOTAIRM1-1, and the results proved that HOTAIRM1-1 was a direct target of miR-125b (Fig. 3). Thus, HOTAIRM1-1 probably plays its role by directly targeting miR-125b, thus influencing chondrocytes in OA. As with many of the inflammatory cytokines whose levels increase with age, the precise consequences of dysregulated miR-125b expression on the functions of monocytes and naïve CD8 T cells, such as inflammatory states or altered migration, remain to be elucidated in OA.

Consistent with previous studies (25,31), HOTAIRM1-1 knockdown in chondrocytes promoted cell cycle-induced proliferation and cell apoptosis. ECM degradation is the main factor that changes during chondrocyte destruction in OA. MMP13 and IL-10 both play important roles in cartilage degradation (25,33,34). Aggrecan and type II collagen primarily contribute to the formation of cartilage tissue in the development of (35,36); the present study measured these markers when HOTAIRM1-1 was knocked down. MMP-13 and IL-10 expression was increased by downregulating HOTAIRM1-1 in chondrocytes. On the other hand, collagen II and aggrecan protein expression was decreased (Fig. 4). Thus, it was predicted that HOTAIRM1-1 may play a key role in the pathogenesis of OA. Recently, miR-125b was found to be stimulated as a possible consequence of the inhibitory role of the IL-6 receptor and activator of transcription 3 feedback loop (37,38). Rescue experiments demonstrated that the miR-125b inhibitor functionally reversed the impacts of HOTAIRM1-1 on cell proliferation and apoptosis in chondrocytes (Fig. 5). Furthermore, these results suggest that HOTAIRM1-1 downregulation may be required for cell proliferation and cell apoptosis in OA.

In conclusion, the present study indicates that the loss of HOTAIRM1-1 function leads to aberrant increase in the proliferation and apoptosis of chondrocytes and causes a comprehensive OA phenotype. miR-125b may be a potential downstream mechanism that regulates the function of HOTAIRM1-1, and this finding may provide a therapeutic strategy for OA.

Acknowledgements

Not applicable.

Availability of data and materials

The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.

Authors' contributions

WBL and QJF contributed to the conception of the study and analyzed the data. GSL and PS performed the experiments and wrote the manuscript. YNL, FJZ and WBL analyzed the data and wrote the manuscript. YNL and WBL analyzed the data and provided constructive criticism. FJZ and PS confirm the authenticity of all the raw data. All authors read and approved the final manuscript.

Ethics approval and consent to participate

The present study was approved by the human ethics committee of Tianjin Hospital (approval no. 2019-Yilunli-146). All the patients provided written informed consent and participated in the study according to their own will.

Patient consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

References

1 

Thomas AC, Hubbard-Turner T, Wikstrom EA and Palmieri-Smith RM: Epidemiology of posttraumatic osteoarthritis. J Athl Train. 52:491–496. 2017.PubMed/NCBI View Article : Google Scholar

2 

Vina ER and Kwoh CK: Epidemiology of osteoarthritis: Literature update. Curr Opin Rheumatol. 30:160–167. 2018.PubMed/NCBI View Article : Google Scholar

3 

Okada A and Okada Y: Progress of research in osteoarthritis. Metalloproteinases in osteoarthritis. Clin Calcium. 19:1593–1601. 2009.PubMed/NCBI(In Japanese).

4 

Yoon DS, Lee KM, Kim SH, Kim SH, Jung Y, Kim SH, Park KH, Choi Y, Ryu HA, Choi WJ and Lee JW: Synergistic action of IL-8 and bone marrow concentrate on cartilage regeneration through upregulation of chondrogenic transcription factors. Tissue Eng Part A. 22:363–374. 2016.PubMed/NCBI View Article : Google Scholar

5 

Richardson SM, Kalamegam G, Pushparaj PN, Matta C, Memic A, Khademhosseini A, Mobasheri R, Poletti FL, Hoyland JA and Mobasheri A: Mesenchymal stem cells in regenerative medicine: Focus on articular cartilage and intervertebral disc regeneration. Methods. 99:69–80. 2016.PubMed/NCBI View Article : Google Scholar

6 

Mobasheri A, Kalamegam G, Musumeci G and Batt ME: Chondrocyte and mesenchymal stem cell-based therapies for cartilage repair in osteoarthritis and related orthopaedic conditions. Maturitas. 78:188–198. 2014.PubMed/NCBI View Article : Google Scholar

7 

Pant T, Dhanasekaran A, Fang J, Bai X, Bosnjak ZJ, Liang M and Ge ZD: Current status and strategies of long noncoding RNA research for diabetic cardiomyopathy. BMC Cardiovasc Disord. 18(197)2018.PubMed/NCBI View Article : Google Scholar

8 

Ji D, Zhong X, Jiang X, Leng K, Xu Y, Li Z, Huang L, Li J and Cui Y: The role of long non-coding RNA AFAP1-AS1 in human malignant tumors. Pathol Res Pract. 214:1524–1531. 2018.PubMed/NCBI View Article : Google Scholar

9 

Jiang SD, Lu J, Deng ZH, Li YS and Lei GH: Long noncoding RNAs in osteoarthritis. Joint Bone Spine. 84:553–556. 2017.PubMed/NCBI View Article : Google Scholar

10 

Marques-Rocha JL, Samblas M, Milagro FI, Bressan J, Martinez JA and Marti A: Noncoding RNAs, cytokines, and inflammation-related diseases. FASEB J. 29:3595–3611. 2015.PubMed/NCBI View Article : Google Scholar

11 

Chen L, Hu N, Wang C and Zhao H: HOTAIRM1 knockdown enhances cytarabine-induced cytotoxicity by suppression of glycolysis through the Wnt/β-catenin/PFKP pathway in acute myeloid leukemia cells. Arch Biochem Biophys. 680(108244)2020.PubMed/NCBI View Article : Google Scholar

12 

Bhan A, Hussain I, Ansari KI, Kasiri S, Bashyal A and Mandal SS: Antisense transcript long noncoding RNA (lncRNA) HOTAIR is transcriptionally induced by estradiol. J Mol Biol. 425:3707–3722. 2013.PubMed/NCBI View Article : Google Scholar

13 

Wang Y, Hardin H, Chu YH, Esbona K, Zhang R and Lloyd RV: Long non-coding RNA expression in anaplastic thyroid carcinomas. Endocr Pathol. 30:262–269. 2019.PubMed/NCBI View Article : Google Scholar

14 

Xiao Y, Yan X, Yang Y and Ma X: Downregulation of long noncoding RNA HOTAIRM1 variant 1 contributes to osteoarthritis via regulating miR-125b/BMPR2 axis and activating JNK/MAPK/ERK pathway. Biomed Pharmacother. 109:1569–1577. 2019.PubMed/NCBI View Article : Google Scholar

15 

Wei S, Zhao M, Wang X, Li Y and Wang K: PU.1 controls the expression of long noncoding RNA HOTAIRM1 during granulocytic differentiation. J Hematol Oncol. 9(44)2016.PubMed/NCBI View Article : Google Scholar

16 

Li Y, Li S, Luo Y, Liu Y and Yu N: LncRNA PVT1 Regulates chondrocyte apoptosis in osteoarthritis by acting as a sponge for miR-488-3p. DNA Cell Biol. 36:571–580. 2017.PubMed/NCBI View Article : Google Scholar

17 

Huang K, Fu J, Zhou W, Li W, Dong S, Yu S, Hu Z, Wang H and Xie Z: MicroRNA-125b regulates osteogenic differentiation of mesenchymal stem cells by targeting Cbfβ in vitro. Biochimie. 102:47–55. 2014.PubMed/NCBI View Article : Google Scholar

18 

Zhang HF, Li ZJ, Fu X, Ma JX and Ma XL: Interactions of bone marrow stromal cells with native and RGD surface modified acellular bone matrix: A biocompatibility study. Arch Med Res. 44:69–74. 2013.PubMed/NCBI View Article : Google Scholar

19 

Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods. 25:402–408. 2001.PubMed/NCBI View Article : Google Scholar

20 

Li L, Wang Y, Song G, Zhang X, Gao S and Liu H: HOX cluster-embedded antisense long non-coding RNAs in lung cancer. Cancer Lett. 450:14–21. 2019.PubMed/NCBI View Article : Google Scholar

21 

Gulei D, Mehterov N, Ling H, Stanta G, Braicu C and Berindan-Neagoe I: The ‘good-cop bad-cop’ TGF-β role in breast cancer modulated by non-coding RNAs. Biochim Biophys Acta Gen Subj. 1861:1661–1675. 2017.PubMed/NCBI View Article : Google Scholar

22 

Park S, Lee M, Chun CH and Jin EJ: The lncRNA, nespas, is associated with osteoarthritis progression and serves as a potential new prognostic biomarker. Cartilage. 10:148–156. 2019.PubMed/NCBI View Article : Google Scholar

23 

Yang S, Kim J, Ryu JH, Oh H, Chun CH, Kim BJ, Min BH and Chun JS: Hypoxia-inducible factor-2alpha is a catabolic regulator of osteoarthritic cartilage destruction. Nat Med. 16:687–693. 2010.PubMed/NCBI View Article : Google Scholar

24 

Miyaki S, Sato T, Inoue A, Otsuki S, Ito Y, Yokoyama S, Kato Y, Takemoto F, Nakasa T, Yamashita S, et al: MicroRNA-140 plays dual roles in both cartilage development and homeostasis. Genes Dev. 24:1173–1185. 2010.PubMed/NCBI View Article : Google Scholar

25 

Wojdasiewicz P, Poniatowski LA and Szukiewicz D: The role of inflammatory and anti-inflammatory cytokines in the pathogenesis of osteoarthritis. Mediators Inflamm. 2014(561459)2014.PubMed/NCBI View Article : Google Scholar

26 

Pearson MJ, Herndler-Brandstetter D, Tariq MA, Nicholson TA, Philp AM, Smith HL, Davis ET, Jones SW and Lord JM: IL-6 secretion in osteoarthritis patients is mediated by chondrocyte-synovial fibroblast cross-talk and is enhanced by obesity. Sci Rep. 7(1)(3451)2017.PubMed/NCBI View Article : Google Scholar

27 

Zanotti S and Canalis E: Interleukin 6 mediates selected effects of notch in chondrocytes. Osteoarthritis Cartilage. 21:1766–1773. 2013.PubMed/NCBI View Article : Google Scholar

28 

Simsa-Maziel S and Monsonego-Ornan E: Interleukin-1β promotes proliferation and inhibits differentiation of chondrocytes through a mechanism involving down-regulation of FGFR-3 and p21. Endocrinology. 153:2296–2310. 2012.PubMed/NCBI View Article : Google Scholar

29 

Cheng NL, Chen X, Kim J, Shi AH, Nguyen C, Wersto R and Weng NP: MicroRNA-125b modulates inflammatory chemokine CCL4 expression in immune cells and its reduction causes CCL4 increase with age. Aging Cell. 14:200–208. 2015.PubMed/NCBI View Article : Google Scholar

30 

Nagpal V, Rai R, Place AT, Murphy SB, Verma SK, Ghosh AK and Vaughan DE: MiR-125b is critical for fibroblast-to-myofibroblast transition and cardiac fibrosis. Circulation. 133:291–301. 2016.PubMed/NCBI View Article : Google Scholar

31 

Zhen G, Wen C, Jia X, Li Y, Crane JL, Mears SC, Askin FB, Frassica FJ, Chang W, Yao J, et al: Inhibition of TGF-β signaling in mesenchymal stem cells of subchondral bone attenuates osteoarthritis. Nat Med. 19:704–712. 2013.PubMed/NCBI View Article : Google Scholar

32 

Shi X, Shao X, Liu B, Lv M, Pandey P, Guo C, Zhang R and Zhang Y: Genome-wide screening of functional long noncoding RNAs in the epicardial adipose tissues of atrial fibrillation. Biochim Biophys Acta Mol Basis Dis. 1866(165757)2020.PubMed/NCBI View Article : Google Scholar

33 

Charlier E, Deroyer C, Ciregia F, Malaise O, Neuville S, Plener Z, Malaise M and de Seny D: Chondrocyte dedifferentiation and osteoarthritis (OA). Biochem Pharmacol. 165:49–65. 2019.PubMed/NCBI View Article : Google Scholar

34 

Silawal S, Willauschus M, Schulze-Tanzil G, Gogele C, Gesslein M and Schwarz S: IL-10 could play a role in the interrelation between diabetes mellitus and osteoarthritis. Int J Mol Sci. 20(768)2019.PubMed/NCBI View Article : Google Scholar

35 

Hu J, Wang Z, Shan Y, Pan Y, Ma J and Jia L: Long non-coding RNA HOTAIR promotes osteoarthritis progression via miR-17-5p/FUT2/β-catenin axis. Cell Death Dis. 9(711)2018.PubMed/NCBI View Article : Google Scholar

36 

Matyas JR, Adams ME, Huang D and Sandell LJ: Discoordinate gene expression of aggrecan and type II collagen in experimental osteoarthritis. Arthritis Rheum. 38:420–425. 1995.PubMed/NCBI View Article : Google Scholar

37 

Misso G, Zarone MR, Lombardi A, Grimaldi A, Cossu AM, Ferri C, Russo M, Vuoso DC, Luce A, Kawasaki H, et al: miR-125b upregulates miR-34a and sequentially activates stress adaption and cell death mechanisms in multiple myeloma. Mol Ther Nucleic Acids. 16:391–406. 2019.PubMed/NCBI View Article : Google Scholar

38 

Cui F, Li X, Zhu X, Huang L, Huang Y, Mao C, Yan Q, Zhu J, Zhao W and Shi H: MiR-125b inhibits tumor growth and promotes apoptosis of cervical cancer cells by targeting phosphoinositide 3-kinase catalytic subunit delta. Cell Physiol Biochem. 30:1310–1318. 2012.PubMed/NCBI View Article : Google Scholar

Related Articles

Journal Cover

September-2021
Volume 22 Issue 3

Print ISSN: 1792-0981
Online ISSN:1792-1015

Sign up for eToc alerts

Recommend to Library

Copy and paste a formatted citation
x
Spandidos Publications style
Liu W, Feng Q, Li G, Shen P, Li Y and Zhang F: Long non‑coding RNA HOTAIRM1‑1 silencing in cartilage tissue induces osteoarthritis through microRNA‑125b. Exp Ther Med 22: 933, 2021
APA
Liu, W., Feng, Q., Li, G., Shen, P., Li, Y., & Zhang, F. (2021). Long non‑coding RNA HOTAIRM1‑1 silencing in cartilage tissue induces osteoarthritis through microRNA‑125b. Experimental and Therapeutic Medicine, 22, 933. https://doi.org/10.3892/etm.2021.10365
MLA
Liu, W., Feng, Q., Li, G., Shen, P., Li, Y., Zhang, F."Long non‑coding RNA HOTAIRM1‑1 silencing in cartilage tissue induces osteoarthritis through microRNA‑125b". Experimental and Therapeutic Medicine 22.3 (2021): 933.
Chicago
Liu, W., Feng, Q., Li, G., Shen, P., Li, Y., Zhang, F."Long non‑coding RNA HOTAIRM1‑1 silencing in cartilage tissue induces osteoarthritis through microRNA‑125b". Experimental and Therapeutic Medicine 22, no. 3 (2021): 933. https://doi.org/10.3892/etm.2021.10365