Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Experimental and Therapeutic Medicine
Join Editorial Board Propose a Special Issue
Print ISSN: 1792-0981 Online ISSN: 1792-1015
Journal Cover
February-2022 Volume 23 Issue 2

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
February-2022 Volume 23 Issue 2

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article Open Access

Changes of farnesoid X receptor and Takeda G‑protein coupled receptor 5 following biliary tract external drainage in hemorrhagic shock

  • Authors:
    • Lu Wang
    • Huai-Wu He
    • Xiang Zhou
    • Yun Long
  • View Affiliations / Copyright

    Affiliations: Department of Critical Care Medicine, Peking Union Medical College Hospital, Peking Union Medical College and Chinese Academy of Medical Sciences, Beijing 100730, P.R. China
    Copyright: © Wang et al. This is an open access article distributed under the terms of Creative Commons Attribution License.
  • Article Number: 163
    |
    Published online on: December 21, 2021
       https://doi.org/10.3892/etm.2021.11086
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

Since biliary tract external drainage (BTED) is increasingly used to treat patients with shock, it is necessary to clarify pathophysiological changes following BTED in hemorrhagic shock (HS). The present study aimed to investigate the effect of BTED on farnesoid X receptor (FXR) and Takeda G‑protein coupled receptor 5 (TGR‑5) expression in HS. A total of 24 Sprague‑Dawley rats were randomly allocated to sham, BTED, HS and HS + BTED groups. Rat models of HS were induced by drawing blood from the femoral artery until a mean arterial pressure of 40±5 mmHg was achieved and maintained for 60 min. Rat models of BTED were induced by inserting a catheter into the bile duct. The distal end of the bile duct was ligated, and the catheter was passed through the rat flank to allow external collection of bile. Reverse transcription‑quantitative PCR, western blotting and immunohistochemistry were performed to detect changes in expression levels of FXR and TGR‑5 in the jejunum, ileum and liver. Expression levels of FXR and TGR‑5 increased significantly in jejunum and liver following HS (P<0.05). BTED significantly decreased expression levels of FXR in the liver (P<0.05) and TGR‑5 in the jejunum, ileum and liver (P<0.05). In conclusion, expression levels of FXR and TGR‑5 increased in HS but BTED decreased expression levels of FXR and TGR‑5 in HS.

Introduction

Bile acids serve an important role in the pathophysiology of shock (1). Septic shock can be prevented by bile acids (2). Bile acids are an important defense mechanism against endotoxins in microorganisms (2). Septic shock induces progressive sclerosing cholangitis (3). Bile acids induce platelet inhibition and fibrinolysis in hemorrhagic shock (HS) (1). High-fat enteral nutrition decreases endotoxins, TNF-α and intestinal permeability in bile duct-ligated rats subjected to HS (4). As the technology becomes more minimally invasive, biliary tract external drainage (BTED) is widely applied in critically ill patients, such as severe acute pancreatitis, malignant biliary obstruction (5-7), acute cholangitis (8-11). In our previous studies, BTED decreased multiorgan dysfunction in HS by affecting enterohepatic circulation of bile pigments (12-15).

Cholic acid is one of the primary components of bile. Like cholochromes, bile acids circulate in the intestine and liver. Bile external drainage directly decreases levels of cholic acid in the intestinal tract and in the liver by disrupting enterohepatic circulation (16). Farnesoid X receptor (FXR) and Takeda G-protein coupled receptor 5 (TGR-5) are the two most common cholic acid receptors (17,18). FXR and TGR-5 serve an important role in the enterohepatic circulation of cholic acid. FXR, a member of the ligand-activated nuclear receptor superfamily, is highly expressed in the liver and gastrointestinal tract (19-21). Bile acids are natural ligands for FXR (22,23). Medications that activate FXR promote liver regeneration in mice following partial hepatectomy (24-26). TGR-5, also known as G protein-coupled bile acid receptor 1, is expressed in the liver, lungs, intestine, placenta, gallbladder, ovaries, macrophages, monocytes and brown adipose tissue (27,28). TGR-5 is activated by bile acids, including cholic, chenodeoxycholic, deoxycholic and lithocholic acid (29). TGR-5 protects the liver from bile acid overload during liver regeneration in mice (30,31).

To the best of our knowledge, studies on changes in bile acid receptor expression levels following BTED in shock are limited. Since BTED is increasingly used to treat severe acute pancreatitis and acute cholangitis and shock is common in these patients (32), it is necessary to clarify pathophysiological changes following BTED in shock. Identifying the effect of BTED on expression levels of FXR and TGR-5 in liver and intestinal during HS may provide theoretical support for the application of BTED, as well as novel options, for the treatment of HS. The present study aimed to investigate changes in FXR and TGR-5 expression levels following HS by performing reverse transcription-quantitative (RT-q)PCR, western blotting and immunohistochemistry. The effect of BTED on FXR and TGR-5 was also studied.

Materials and methods

Ethics statement

The present study was approved by the Institutional Animal Care and Use Committee at Peking Union Medical College (Beijing, China). Animal surgical procedures were performed in strict accordance with the guidelines for the care and use of laboratory animals established by the Animal Use and Care Committee of the Beijing Committee on Animal Care.

The animal protocol was designed to minimize pain or discomfort to rats. The rats were acclimatized to laboratory conditions (25˚C, 12/12-h light/dark cycle, 50% humidity, ad libitum access to food and water) for 1 week prior to experimentation. All rats were intraperitoneally anesthetized with 3% sodium pentobarbital (50 mg/kg) prior to surgery and decapitation.

Animal model

A total of 24 adult male Sprague-Dawley rats (age, 10 weeks; weight, 250-300 g) were purchased from the Fangyuan Yuan Animal Centre of Beijing. The Chinese People's Liberation Army Military Academy of Medical Sciences was responsible for quality control of rats.

Rats were randomly divided into 4 groups (n=6/group) as follows: Sham, BTED, HS and HS + BTED. Rats in the HS + BTED group were intraperitoneally anesthetized with 3% sodium pentobarbital (50 mg/kg). Laparotomy was performed following shaving and sterilization. Catheters were placed in both femoral arteries for blood pressure measurement and blood withdrawal. Bile duct was exposed 1cm for BTED. Rats were subjected to HS by withdrawing blood at a rate of 1 ml/min until mean arterial pressure (MAP) of 40±5 mmHg was achieved. A catheter was inserted into the bile duct. The distal end of the bile duct was ligated and the catheter was passed through the rat flank to avoid bile passage into the gut and allow the external collection of bile. The abdomen was closed. MAP of 40±5 mmHg was maintained for 1 h. Rats were resuscitated using shed blood and an equal volume of normal saline at the end of the shock period. HS rats underwent pentobarbital anesthesia, laparotomy, vascular cannulation, blood withdrawal and suturing but no BTED. BTED rats underwent pentobarbital anesthesia, laparotomy, vascular cannulation, bile duct cannulation and suturing but no blood withdrawal. Sham rats underwent pentobarbital anesthesia, laparotomy, vascular cannulation and suturing, but no blood withdrawal or BTED. A total of 6 rats in each group was euthanized by rapid decapitation 6 h after resuscitation. Segments of jejunum (5 cm distal to the ligament of Treitz), ileum (2 cm proximal to the cecum) and liver were harvested.

RT-qPCR

Jejunum, ileum and liver scrapings from all animals were snap frozen and stored at -80˚C for RT-qPCR. Total RNA was extracted from the jejunum, ileum and liver using TRIzol® reagent. Aliquots (2 µg) of total RNA were used to synthesize complementary (c)DNA. Purity and content of RNA was determined using ultraviolet spectrophotometry. RT was performed with 0.5 µg RNA to obtain cDNA in a mixture containing random primers, RevertAid Reverse Transcriptase, RNase inhibitor, and dNTPs. The PCR reaction mixture was prepared using SYBR Premix Ex Taq (Thermo Fisher Scientific, Inc.) with specific upstream and downstream primers. The thermocycling conditions were as follows: Initial denaturation for 10 sec at 95˚C followed by 40 cycles of 95˚C for 5 sec and 60˚C for 20 sec in a real-time PCR system (7500; Applied Biosystems; Thermo Fisher Scientific, Inc.). Relative target gene expression was quantitated according to the comparative 2-ΔΔCq method (33) and normalized to the endogenous control gene, β-actin. The primers used are listed in Table I.

Table I

Primers for reverse transcription-quantitative PCR analysis.

Table I

Primers for reverse transcription-quantitative PCR analysis.

GeneForward primer, 5'→3'Reverse primer, 5'→3'
FXR GTGACAAAGAAGCCGCGAAT GCAGGTGAGCGCGTTGTAAT
TGR5 CCACCACTAGGGCCTGTAAC TCCTCGAAGCACTTGTAGCC
β-actin GCGCTCGTCGTCGACAACGG GTGTGGTGCCAAATCTTCTCC

[i] FXR, farnesoid X receptor; TGR5, Takeda G-protein coupled receptor 5.

Western blotting

Scrapings of the jejunum, ileum and liver from all animals were snap frozen and stored at -80˚C for western blotting. RIPA lysis buffer and 5X loading buffer were prepared. Briefly, samples were homogenized in RIPA lysis buffer supplemented with a protease inhibitor cocktail. Tissues were frozen immediately in liquid nitrogen and placed in a mortar for pulverization. Total protein was extracted by centrifuging the tubes at 4˚C for 30 min at 10,000 x g to remove debris. Protein concentration was measured using a BCA Protein Assay kit according to the manufacturer's instructions. A total of 10 mg protein/lane was loaded onto 10% sodium dodecyl sulfate/polyacrylamide electrophoresis gel for separation, and the proteins were transferred for 2 h to PVDF membranes. Then membranes were blocked in 5% skimmed milk powder at room temperature for 2 h. The blot was probed with primary antibody overnight at 4˚C. Primary antibodies were rabbit polyclonal anti-FXR (cat. no. ab28676) and anti-TGR-5 (both 1:500; cat. no. ab72608; both Abcam) and mouse monoclonal anti-β-actin (Santa Cruz Biotechnology, Inc.; cat. no. sc517582) (1:1,000). The blots were incubated with horseradish peroxidase-conjugated goat anti-Rabbit (cat. no. BS13278) or anti-mouse (cat. no. BS12471) IgG (both 1:2,000; both Bioworld Technology, Inc.) for 2 h at room temperature and reacted with enhanced chemiluminescence substrate. The chemiluminescence was recorded using an imaging system (Imagequant LAS 400; GE Healthcare). The enhanced chemiluminescence signals were digitized using Photoshop CS6 software (Adobe Systems, Inc.) to quantify the expression levels of FXR, TGR-5 and β-actin. Relative FXR and TGR-5 protein expression was normalized to β-actin.

Immunohistochemistry

Samples were fixed in 4% paraformaldehyde for 24 h at room temperature. The tissue was embedded in paraffin and sections (4 µm) were used for immunohistochemical staining. Sections were deparaffinized, rehydrated and incubated with 3% hydrogen peroxide to quench any endogenous peroxidase activity. Sections were placed in 3% citrate buffer to repair antigens. The buffer was heated to 92-98˚C using a microwave for 10 min. Sections were cooled to room temperature. The tissue samples were blocked with 5% bovine serum (Wuhan Boster Biological Technology. Ltd.) for 20 min at room temperature. Sections were incubated overnight at 4˚C with optimally diluted primary antibody. Negative control sections were incubated overnight at 4˚C with saline solution. Primary antibodies were rabbit polyclonal anti-FXR (cat. no. ab28676) and anti-TGR-5 (cat. no. ab72608; both 1:100; both Abcam). Sections were washed with PBS and incubated with goat anti-Rabbit IgG (Bioworld Technology, Inc.; cat. no. BS13278; 1:200) at room temperature for 30 min, rewashed and incubated with peroxidase-conjugated streptavidin at room temperature for 15 min. Peroxidation activity was visualized via incubation with a peroxidase substrate solution (DAB kit; Invitrogen; Thermo Fisher Scientific, Inc.) at room temperature for 3 min according to the manufacturer's instructions. Sections were counterstained with hematoxylin at room temperature for 5 min. Image-Pro Plus software 4.0 (Media Cybernetics, Inc.) was used to determine the integrated optical density of images. A total of six randomly selected fields of view/section were observed under a light microscope at x100 magnification (six sections/group).

Reagents

RIPA lysis buffer, BCA Protein Assay kit and 5X loading buffer were purchased from Beyotime Institute of Biotechnology. Rabbit polyclonal anti-FXR (cat. no. ab28676) and anti-TGR-5 (cat. no. ab72608) were purchased from Abcam. The mouse monoclonal antibody to β-actin (cat. no. sc517582) was purchased from Santa Cruz Biotechnology, Inc. The goat anti-Rabbit IgG (cat. no. BS13278) and goat anti-Mouse IgG (cat. no. BS12471) were purchased from Bioworld Technology, Inc. eECL Western Blot kit (cat. no. CW0049A) was purchased from CoWin Biosciences. RevertAidFirst Strand cDNA Synthesis kit was purchased from Thermo Fisher Scientific, Inc. SYBR Premix Ex Taq was purchased from Thermo Fisher Scientific, Inc. The primers were synthesized by Invitrogen (Thermo Fisher Scientific, Inc.). The fluorescence RT-qPCR kit was purchased from Takara Biotechnology, Co., Ltd. TRIzol® and the immunohistochemistry kit were purchased from Invitrogen (Thermo Fisher Scientific, Inc.). The 5% bovine serum was purchased from Wuhan Boster Biological Technology. Ltd.

Statistical analysis

Data were analyzed using SPSS 16.0 software (SPSS, Inc.). All data are expressed as the mean ± SEM (n=6). Results were compared by one-way analysis of variance followed by post hoc Tukey's test. P<0.05 was considered to indicate a statistically significant difference.

Results

RT-qPCR

The expression levels of FXR mRNA increased significantly in the jejunum and liver and decreased significantly in the ileum following HS (P<0.05; Fig. 1). The expression levels of FXR increased significantly in the jejunum and ileum and decreased significantly in the liver following BTED (P<0.05; Fig. 1). In HS rats, BTED significantly increased the expression levels of FXR mRNA in the jejunum and ileum but decreased these levels in the liver (P<0.05; Fig. 1). The expression levels of TGR-5 mRNA increased significantly in the jejunum, ileum and liver following HS (P<0.05; Fig. 1). The expression levels of TGR-5 decreased significantly in the jejunum, ileum and liver following BTED (P<0.05; Fig. 1). In HS rats, BTED significantly decreased the expression levels of TGR-5 mRNA in the jejunum, ileum and liver (P<0.05; Fig. 1).

Figure 1

Expression levels of FXR and TGR-5 mRNA in the jejunum, ileum and liver. Results are presented as the mean ± SEM (n=6). *P<0.05 vs. Sham; †P<0.05 vs. BTED; ‡P<0.05 vs. HS. HS, hemorrhagic shock; BTED, biliary tract external drainage; FXR, farnesoid X receptor; TGR-5, Takeda G-protein coupled receptor 5.

Western blotting

The protein expression levels of FXR increased significantly in the jejunum and liver following HS (P<0.05; Fig. 2). The protein expression levels of FXR increased significantly in the jejunum and ileum and decreased significantly in the liver following BTED (P<0.05; Fig. 2). In HS rats, BTED significantly increased protein expression levels of FXR in the jejunum and ileum and decreased these levels in the liver (P<0.05; Fig. 2). The expression levels of TGR-5 increased significantly in the jejunum, ileum and liver following HS (P<0.05; Fig. 2). The expression levels of TGR-5 decreased significantly in the jejunum, ileum and liver following BTED (P<0.05; Fig. 2). In HS rats, BTED significantly decreased protein expression levels of TGR-5 in the jejunum, ileum and liver (P<0.05; Fig. 2).

Figure 2

Protein expression levels of FXR and TGR-5 in the jejunum, ileum and liver. Results are presented as the mean ± SEM (n=6). *P<0.05 vs. Sham; †P<0.05 vs. BTED; ‡P<0.05 vs. HS. HS, hemorrhagic shock; BTED, biliary tract external drainage; FXR, farnesoid X receptor; TGR-5, Takeda G-protein coupled receptor 5.

Immunohistochemistry

The protein expression levels of FXR increased significantly in the liver and decreased significantly in the ileum following HS (P<0.05; Fig. 3). The protein expression levels of FXR increased significantly in the jejunum and ileum and decreased significantly in the liver following BTED (P<0.05; Fig. 3). In HS rats, BTED significantly increased protein expression levels of FXR in the jejunum and ileum and decreased these levels in the liver (P<0.05; Fig. 3).

Figure 3

Immunohistochemical expression of FXR in the jejunum, ileum and liver. Immunohistochemical analysis of FXR expression in (A) jejunum, (B) ileum and (C) liver tissue. (i) Sham. (ii) BTED (iii) HS. (iv) HS+BTED. (v) Negative control. (vi) Integrated optical density. Magnification, x100. Results are presented as the mean ± SEM (n=6). *P<0.05 vs. Sham; †P<0.05 vs. BTED; ‡P<0.05 vs. HS. HS, hemorrhagic shock; BTED, biliary tract external drainage; FXR, farnesoid X receptor.

The protein expression levels of TGR-5 increased significantly in the jejunum and liver following HS (P<0.05; Fig. 4). The protein expression levels of TGR-5 decreased significantly in the jejunum, ileum and liver following BTED (P<0.05; Fig. 4). In HS rats, BTED significantly decreased protein expression levels of TGR-5 in the jejunum, ileum and liver (P<0.05; Fig. 4).

Figure 4

Immunohistochemical expression of TGR-5 in the jejunum, ileum and liver. Immunohistochemical analysis of TGR-5 expression in (A) jejunum, (B) ileum and (C) liver tissue. (i) Sham. (ii) BTED (iii) HS. (iv) HS+BTED. (v) Negative control. (vi) Integrated optical density. Magnification, x100. Results are presented as the mean ± SEM (n=6). *P<0.05 vs. Sham; †P<0.05 vs. BTED; ‡P<0.05 vs. HS. HS, hemorrhagic shock; BTED, biliary tract external drainage; TGR-5, Takeda G-protein coupled receptor 5.

Discussion

Following fluid resuscitation in shock, cells are liberated from ischemia and hypoxia and the body begins tissue repair (34). The present study showed that mRNA and protein expression levels of FXR increased significantly in the jejunum and liver and those of TGR-5 increased significantly in the jejunum, ileum and liver following HS. This may be due to elimination of ischemia following fluid resuscitation in HS. Cell repair and regeneration increase expression levels of FXR and TGR-5. In the enterohepatic circulation, bile acid is reabsorbed in the ileum. Increased reabsorption of bile acid during HS may inhibit expression of FXR (35), which may partly explain why FXR was not upregulated in the ileum following HS in the present study.

BTED is increasingly used to treat patients with shock (36). The present study aimed to identify pathophysiological changes following BTED in HS. In addition to its therapeutic potential, BTED also exerts certain negative effects. Sinusoids remain narrowed due to swelling of activated Kupffer cells, which causes deterioration of hepatic microcirculation during the early phase of BTED in jaundiced mice (37). Initial liver regeneration following major hepatectomy is decreased following biliary drainage and is associated with decreased serum bile acid levels (38). BTED as a treatment for obstructive jaundice markedly suppresses liver regeneration following partial hepatectomy (39). However, internal biliary drainage does not suppress regeneration of rat liver following partial hepatectomy (16). In our unpublished studies, liver damage was aggravated following BTED in a rat model of HS. Preoperative bile replacement using large volumes of bile improves blood coagulation and cellular immunity in patients with jaundice treated with BTED (40). FXR and TGR-5 serve a key role in pathophysiological changes of the liver (41). Bile acid promotes liver regeneration via FXR signaling in rats (42). Sirtuin1 controls liver regeneration by regulating bile acid metabolism via FXR (43). TGR-5 regulates bile acid hydrophobicity and stimulates bile acid excretion in urine during liver regeneration (44). BTED may affect liver function by decreasing cholic acid levels (39). To the best of our knowledge, however, the number of studies on changes in bile acid receptors following BTED in shock is limited. Therefore, the present study aimed to assess changes in FXR and TGR-5 expression in the jejunum, ileum and liver following BTED in HS rats. BTED significantly decreased the expression levels of FXR and TGR-5 in the liver in HS rats. This may be because BTED disrupts cholic acid enterohepatic circulation, thereby decreasing levels of cholic acid in the body (45). Due to lack of stimulation, levels of FXR and TGR-5 decrease, resulting in inhibition of tissue repair and liver cell regeneration The aforementioned results suggested that bile acid supplementation may be beneficial for patients receiving BTED during HS. In HS rats, BTED significantly increased expression levels of FXR but decreased those of TGR-5 in the jejunum and ileum. This may explain why BTED does not cause injury to the jejunum and ileum.

The present study is only a preliminary observation and the clinical significance of the effect of BTED on FXR and TGR-5 in HS is unclear. For example, FXR and TGR-5 promote organ regeneration (46,47). However, the effect of BTED on expression levels of proliferation markers is unclear. The association between BTED and organ regeneration should be investigated in future experiments.

In summary, the expression levels of FXR and TGR-5 changed following BTED in HS. BTED significantly increased expression levels of FXR in the jejunum and ileum but decreased FXR expression in the liver in HS rats. BTED significantly decreased expression levels of TGR-5 in the jejunum, ileum and liver in HS rats.

Acknowledgements

Not applicable.

Funding

Funding: The present study was supported by the National Natural Science Fund of China (grant no. 81801901).

Availability of data and materials

The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.

Authors' contributions

LW, HWH, XZ and YL drafted the manuscript. LW and HWH performed surgical procedures. LW and HWH performed statistical analysis. XZ and YL conceived and designed the study. LW and XZ confirm the authenticity of all the raw data. All authors read and approved the final manuscript.

Ethics approval and consent to participate

The present study was approved by the Institutional Animal Care and Use Committee at Peking Union Medical College (Beijing, China).

Patient consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

Authors' information

LW, ORCID no. 0000-0001-6553-6381; HWH, ORCID no. 0000-0003-3422-3109; XZ, ORCID no. 0000-0001-8523-8082; YL, ORCID no. 0000-0003-0274-8322.

References

1 

Wiener G, Moore HB, Moore EE, Gonzalez E, Diamond S, Zhu S, D'Alessandro A and Banerjee A: Shock releases bile acid inducing platelet inhibition and fibrinolysis. J Surg Res. 195:390–395. 2015.PubMed/NCBI View Article : Google Scholar

2 

Bertók L: Role of endotoxins and bile acids in the pathogenesis of septic circulatory shock. Acta Chir Hung. 36:33–36. 1997.PubMed/NCBI

3 

Engler S, Elsing C, Flechtenmacher C, Theilmann L, Stremmel W and Stiehl A: Progressive sclerosing cholangitis after septic shock: A new variant of vanishing bile duct disorders. Gut. 52:688–693. 2003.PubMed/NCBI View Article : Google Scholar

4 

Luyer MD, Buurman WA, Hadfoune M, Jacobs JA, Dejong CH and Greve JW: High-fat enteral nutrition reduces endotoxin, tumor necrosis factor-alpha and gut permeability in bile duct-ligated rats subjected to hemorrhagic shock. J Hepatol. 41:377–383. 2004.PubMed/NCBI View Article : Google Scholar

5 

Xu C, Huang XE, Wang SX, Lv PH, Sun L and Wang FA: Comparison of infection between internal-external and external percutaneous transhepatic biliary drainage in treating patients with malignant obstructive jaundice. Asian Pac J Cancer Prev. 16:2543–2546. 2015.PubMed/NCBI View Article : Google Scholar

6 

Saettini F, Agazzi R, Giraldi E, Foglia C, Cavalleri L, Morali L, Fasolini G, Spotti A and Provenzi M: Percutaneous transhepatic biliary drainage in an infant with obstructive jaundice caused by neuroblastoma. Pediatr Hematol Oncol. 32:223–228. 2015.PubMed/NCBI View Article : Google Scholar

7 

Arkadopoulos N, Kyriazi MA, Papanikolaou IS, Vasiliou P, Theodoraki K, Lappas C, Oikonomopoulos N and Smyrniotis V: Preoperative biliary drainage of severely jaundiced patients increases morbidity of pancreaticoduodenectomy: Results of a case-control study. World J Surg. 38:2967–2972. 2014.PubMed/NCBI View Article : Google Scholar

8 

Shinya S, Sasaki T, Yamashita Y, Kato D, Yamashita K, Nakashima R, Yamauchi Y and Noritomi T: Procalcitonin as a useful biomarker for determining the need to perform emergency biliary drainage in cases of acute cholangitis. J Hepatobiliary Pancreat Sci. 21:777–785. 2014.PubMed/NCBI View Article : Google Scholar

9 

McNabb-Baltar J, Trinh QD and Barkun AN: Biliary drainage method and temporal trends in patients admitted with cholangitis: A national audit. Can J Gastroenterol. 27:513–518. 2013.PubMed/NCBI View Article : Google Scholar

10 

Itoi T, Tsuyuguchi T, Takada T, Strasberg SM, Pitt HA, Kim MH, Belli G, Mayumi T, Yoshida M, Miura F, et al: TG13 indications and techniques for biliary drainage in acute cholangitis (with videos). J Hepatobiliary Pancreat Sci. 20:71–80. 2013.PubMed/NCBI View Article : Google Scholar

11 

Abdelkader AM, Zidan AM and Younis MT: Temporary CBD stenting with a nelaton tube is a more practical and safer option than T-tube drainage after conventional CBD exploration for choledocholithiasis. HPB Surg. 2018(8035164)2018.PubMed/NCBI View Article : Google Scholar

12 

Wang L, Zhao B, Chen Y, Ma L, Chen EZ and Mao EQ: Biliary tract external drainage protects against intestinal barrier injury in hemorrhagic shock rats. World J Gastroenterol. 21:12800–12813. 2015.PubMed/NCBI View Article : Google Scholar

13 

Wang L, Zhao B, Chen Y, Ma L, Chen EZ and Mao EQ: Inflammation and edema in the lung and kidney of hemorrhagic shock rats are alleviated by biliary tract external drainage via the heme oxygenase-1 pathway. Inflammation. 38:2242–2251. 2015.PubMed/NCBI View Article : Google Scholar

14 

Wang L, Zhao B, Chen Y, Ma L, Chen EZ and Mao EQ: Biliary tract external drainage increases the expression levels of heme oxygenase-1 in rat livers. Eur J Med Res. 20(61)2015.PubMed/NCBI View Article : Google Scholar

15 

Wang L, Zhao B, Chen Y, Ma L, Chen EZ and Mao EQ: Biliary tract external drainage alleviates kidney injury in shock. J Surg Res. 199:564–571. 2015.PubMed/NCBI View Article : Google Scholar

16 

Suzuki H, Iyomasa S, Nimura Y and Yoshida S: Internal biliary drainage, unlike external drainage, does not suppress the regeneration of cholestatic rat liver after partial hepatectomy. Hepatology. 20:1318–1322. 1994.PubMed/NCBI

17 

Iracheta-Vellve A, Calenda CD, Petrasek J, Ambade A, Kodys K, Adorini L and Szabo G: FXR and TGR5 agonists ameliorate liver injury, steatosis, and inflammation after binge or prolonged alcohol feeding in mice. Hepatol Commun. 2:1379–1391. 2018.PubMed/NCBI View Article : Google Scholar

18 

Mertens KL, Kalsbeek A, Soeters MR and Eggink HM: Bile acid signaling pathways from the enterohepatic circulation to the central nervous system. Front Neurosci. 11(617)2017.PubMed/NCBI View Article : Google Scholar

19 

Wang YD, Chen WD, Moore DD and Huang W: FXR: A metabolic regulator and cell protector. Cell Res. 18:1087–1095. 2008.PubMed/NCBI View Article : Google Scholar

20 

Lee FY, Lee H, Hubbert ML, Edwards PA and Zhang Y: FXR, a multipurpose nuclear receptor. Trends Biochem Sci. 31:572–580. 2006.PubMed/NCBI View Article : Google Scholar

21 

Horikawa T, Oshima T, Li M, Kitayama Y, Eda H, Nakamura K, Tamura A, Ogawa T, Yamasaki T, Okugawa T, et al: Chenodeoxycholic acid releases proinflammatory cytokines from small intestinal epithelial cells through the farnesoid X receptor. Digestion. 100:286–294. 2019.PubMed/NCBI View Article : Google Scholar

22 

Tuominen I and Beaven SW: Intestinal farnesoid X receptor puts a fresh coat of wax on fatty liver. Hepatology. 62:646–648. 2015.PubMed/NCBI View Article : Google Scholar

23 

Hou Y, Fan W, Yang W, Samdani AQ, Jackson AO and Qu S: Farnesoid X receptor: An important factor in blood glucose regulation. Clin Chim Acta. 495:29–34. 2019.PubMed/NCBI View Article : Google Scholar

24 

Meng Q, Chen X, Wang C, Liu Q, Sun H, Sun P, Peng J and Liu K: Alisol B 23-acetate promotes liver regeneration in mice after partial hepatectomy via activating farnesoid X receptor. Biochem Pharmacol. 92:289–298. 2014.PubMed/NCBI View Article : Google Scholar

25 

Zhang L, Wang YD, Chen WD, Wang X, Lou G, Liu N, Lin M, Forman BM and Huang W: Promotion of liver regeneration/repair by farnesoid X receptor in both liver and intestine in mice. Hepatology. 56:2336–2343. 2012.PubMed/NCBI View Article : Google Scholar

26 

Chen WD, Wang YD, Zhang L, Shiah S, Wang M, Yang F, Yu D, Forman BM and Huang W: Farnesoid X receptor alleviates age-related proliferation defects in regenerating mouse livers by activating forkhead box m1b transcription. Hepatology. 51:953–962. 2010.PubMed/NCBI View Article : Google Scholar

27 

Kawamata Y, Fujii R, Hosoya M, Harada M, Yoshida H, Miwa M, Fukusumi S, Habata Y, Itoh T, Shintani Y, et al: A G protein-coupled receptor responsive to bile acids. J Biol Chem. 278:9435–9440. 2003.PubMed/NCBI View Article : Google Scholar

28 

Finn PD, Rodriguez D, Kohler J, Jiang Z, Wan S, Blanco E, King AJ, Chen T, Bell N, Dragoli D, et al: Intestinal TGR5 agonism improves hepatic steatosis and insulin sensitivity in Western diet-fed mice. Am J Physiol Gastrointest Liver Physiol. 316:G412–G424. 2019.PubMed/NCBI View Article : Google Scholar

29 

Fiorucci S, Mencarelli A, Palladino G and Cipriani S: Bile-acid-activated receptors: Targeting TGR5 and farnesoid-X-receptor in lipid and glucose disorders. Trends Pharmacol Sci. 30:570–580. 2009.PubMed/NCBI View Article : Google Scholar

30 

Jourdainne V, Péan N, Doignon I, Humbert L, Rainteau D and Tordjmann T: The bile acid receptor TGR5 and liver regeneration. Dig Dis. 33:319–326. 2015.PubMed/NCBI View Article : Google Scholar

31 

Péan N, Doignon I, Garcin I, Besnard A, Julien B, Liu B, Branchereau S, Spraul A, Guettier C, Humbert L, et al: The receptor TGR5 protects the liver from bile acid overload during liver regeneration in mice. Hepatology. 58:1451–1460. 2013.PubMed/NCBI View Article : Google Scholar

32 

Berquist TH, May GR, Johnson CM, Adson MA and Thistle JL: Percutaneous biliary decompression: Internal and external drainage in 50 patients. AJR Am J Roentgenol. 136:901–906. 1981.PubMed/NCBI View Article : Google Scholar

33 

Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods. 25:402–408. 2001.PubMed/NCBI View Article : Google Scholar

34 

Gordon D and Spiegel R: Fluid resuscitation: History, physiology, and modern fluid resuscitation strategies. Emerg Med Clin North Am. 38:783–793. 2020.PubMed/NCBI View Article : Google Scholar

35 

Nakatani T and Kobayashi K: Post-traumatic jaundice-its mechanism from a view point of hepatic mitochondrial function. Nihon Geka Gakkai Zasshi. 92:441–447. 1991.PubMed/NCBI(In Japanese).

36 

Shimada H, Nakagawara G, Kobayashi M, Tsuchiya S, Kudo T and Morita S: Pathogenesis and clinical features of acute cholangitis accompanied by shock. Jpn J Surg. 14:269–277. 1984.PubMed/NCBI View Article : Google Scholar

37 

Okaya T, Nakagawa K, Kimura F, Shimizu H, Yoshidome H, Ohtsuka M, Kato A, Yoshitomi H, Ito H and Miyazaki M: The alterations in hepatic microcirculation and Kupffer cell activity after biliary drainage in jaundiced mice. J Hepatobiliary Pancreat Sci. 19:397–404. 2012.PubMed/NCBI View Article : Google Scholar

38 

Otao R, Beppu T, Isiko T, Mima K, Okabe H, Hayashi H, Masuda T, Chikamoto A, Takamori H and Baba H: External biliary drainage and liver regeneration after major hepatectomy. Br J Surg. 99:1569–1574. 2012.PubMed/NCBI View Article : Google Scholar

39 

Iyomasa S, Terasaki M, Kuriki H, Nimura Y, Shionoya S, Kojima K and Yoshida S: Decrease in regeneration capacity of rat liver after external biliary drainage. Eur Surg Res. 24:265–272. 1992.PubMed/NCBI View Article : Google Scholar

40 

Yoshida Y, Ajiki T, Ueno K, Shinozaki K, Murakami S, Okazaki T, Matsumoto T, Matsumoto I, Fukumoto T, Usami M and Ku Y: Preoperative bile replacement improves immune function for jaundiced patients treated with external biliary drainage. J Gastrointest Surg. 18:2095–2104. 2014.PubMed/NCBI View Article : Google Scholar

41 

Ferrell JM, Pathak P, Boehme S, Gilliland T and Chiang JY: Deficiency of both farnesoid X receptor and takeda G protein-coupled receptor 5 exacerbated liver fibrosis in mice. Hepatology. 70:955–970. 2019.PubMed/NCBI View Article : Google Scholar

42 

Ding L, Yang Y, Qu Y, Yang T, Wang K, Liu W and Xia W: Bile acid promotes liver regeneration via farnesoid X receptor signaling pathways in rats. Mol Med Rep. 11:4431–4437. 2015.PubMed/NCBI View Article : Google Scholar

43 

Garcia-Rodriguez JL, Barbier-Torres L, Fernández-Álvarez S, Gutiérrez-de Juan V, Monte MJ, Halilbasic E, Herranz D, Álvarez L, Aspichueta P, Marín JJ, et al: SIRT1 controls liver regeneration by regulating bile acid metabolism through farnesoid X receptor and mammalian target of rapamycin signaling. Hepatology. 59:1972–1983. 2014.PubMed/NCBI View Article : Google Scholar

44 

Fan M, Wang X, Xu G, Yan Q and Huang W: Bile acid signaling and liver regeneration. Biochim Biophys Acta. 1849:196–200. 2015.PubMed/NCBI View Article : Google Scholar

45 

Sun Q, Fang F, Lu GC, Mao HH, Xu JH, Zhou SK, Tong XM, Guo Y, Wu JF and Jiang B: Effects of different drainage methods on serum bile acid and hepatocyte apoptosis and regeneration after partial hepatectomy in rats with obstructive jaundice. J Biol Regul Homeost Agents. 33:571–579. 2019.PubMed/NCBI

46 

Jung K, Kim M, So J, Lee SH, Ko S and Shin D: Farnesoid X receptor activation impairs liver progenitor cell-mediated liver regeneration via the PTEN-PI3K-AKT-mTOR axis in zebrafish. Hepatology. 74:397–410. 2021.PubMed/NCBI View Article : Google Scholar

47 

Chiang JYL and Ferrell JM: Bile acid receptors FXR and TGR5 signaling in fatty liver diseases and therapy. Am J Physiol Gastrointest Liver Physiol. 318:G554–G573. 2020.PubMed/NCBI View Article : Google Scholar

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Wang L, He H, Zhou X and Long Y: Changes of farnesoid X receptor and Takeda G‑protein coupled receptor 5 following biliary tract external drainage in hemorrhagic shock. Exp Ther Med 23: 163, 2022.
APA
Wang, L., He, H., Zhou, X., & Long, Y. (2022). Changes of farnesoid X receptor and Takeda G‑protein coupled receptor 5 following biliary tract external drainage in hemorrhagic shock. Experimental and Therapeutic Medicine, 23, 163. https://doi.org/10.3892/etm.2021.11086
MLA
Wang, L., He, H., Zhou, X., Long, Y."Changes of farnesoid X receptor and Takeda G‑protein coupled receptor 5 following biliary tract external drainage in hemorrhagic shock". Experimental and Therapeutic Medicine 23.2 (2022): 163.
Chicago
Wang, L., He, H., Zhou, X., Long, Y."Changes of farnesoid X receptor and Takeda G‑protein coupled receptor 5 following biliary tract external drainage in hemorrhagic shock". Experimental and Therapeutic Medicine 23, no. 2 (2022): 163. https://doi.org/10.3892/etm.2021.11086
Copy and paste a formatted citation
x
Spandidos Publications style
Wang L, He H, Zhou X and Long Y: Changes of farnesoid X receptor and Takeda G‑protein coupled receptor 5 following biliary tract external drainage in hemorrhagic shock. Exp Ther Med 23: 163, 2022.
APA
Wang, L., He, H., Zhou, X., & Long, Y. (2022). Changes of farnesoid X receptor and Takeda G‑protein coupled receptor 5 following biliary tract external drainage in hemorrhagic shock. Experimental and Therapeutic Medicine, 23, 163. https://doi.org/10.3892/etm.2021.11086
MLA
Wang, L., He, H., Zhou, X., Long, Y."Changes of farnesoid X receptor and Takeda G‑protein coupled receptor 5 following biliary tract external drainage in hemorrhagic shock". Experimental and Therapeutic Medicine 23.2 (2022): 163.
Chicago
Wang, L., He, H., Zhou, X., Long, Y."Changes of farnesoid X receptor and Takeda G‑protein coupled receptor 5 following biliary tract external drainage in hemorrhagic shock". Experimental and Therapeutic Medicine 23, no. 2 (2022): 163. https://doi.org/10.3892/etm.2021.11086
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team