Effects of genistein supplementation on genome‑wide DNA methylation and gene expression in patients with localized prostate cancer

  • Authors:
    • Birdal Bilir
    • Nitya V. Sharma
    • Jeongseok Lee
    • Bato Hammarstrom
    • Aud Svindland
    • Omer Kucuk
    • Carlos S. Moreno
  • View Affiliations

  • Published online on: May 24, 2017     https://doi.org/10.3892/ijo.2017.4017
  • Pages:223-234
Metrics: HTML 0 views | PDF 0 views     Cited By (CrossRef): 0 citations

Abstract

Epidemiological studies have shown that dietary compounds have significant effects on prostate carcinogenesis. Among dietary agents, genistein, the major isoflavone in soybean, is of particular interest because high consumption of soy products has been associated with a low incidence of prostate cancer, suggesting a preventive role of genistein in prostate cancer. In spite of numerous studies to understand the effects of genistein on prostate cancer, the mechanisms of action have not been fully elucidated. We investigated the differences in methylation and gene expression levels of prostate specimens from a clinical trial of genistein supplementation prior to prostatectomy using Illumina HumanMethylation450 and Illumina HumanHT-12 v4 Expression BeadChip Microarrays. The present study was a randomized, placebo-controlled, double-blind clinical trial on Norwegian patients who received 30 mg genistein or placebo capsules daily for 3-6 weeks before prostatectomy. Gene expression changes were validated by quantitative PCR (qPCR). Whole genome methylation and expression profiling identified differentially methylated sites and expressed genes between placebo and genistein groups. Differentially regulated genes were involved in developmental processes, stem cell markers, proliferation and transcriptional regulation. Enrichment analysis suggested overall reduction in MYC activity and increased PTEN activity in genistein-treated patients. These findings highlight the effects of genistein on global changes in gene expression in prostate cancer and its effects on molecular pathways involved in prostate tumorigenesis.

Introduction

Prostate cancer is the most commonly diagnosed malignancy and the second leading cause of cancer death among men in the United States. It is estimated that approximately 180,890 new cases of prostate cancer and 26,120 deaths from prostate cancer occurred in the USA in 2016 (1). The common risk factors for prostate cancer are age, race/ethnicity, geography, family history and lifestyle (2). Depending on the severity of the disease, current treatment options for prostate cancer include single or a combination of therapies such as active surveillance, surgery, radiation therapy, chemotherapy, hormone therapy or vaccines (3). Although these interventions have significantly improved the quality of life of the patients and the overall survival rates, effective treatment of prostate cancer is still limited due to the major challenges such as genetic heterogeneity, tumor recurrence (~30% of the cases) and resistance to conventional chemotherapeutic drugs (46). Therefore, it is crucial to develop novel preventive and therapeutic strategies that have the potential to improve outcomes for prostate cancer patients.

Epidemiological studies have shown that there is a significant disparity in incidence and mortality rates of prostate cancer among different countries, with the highest rates in the USA and European countries and the lowest rates in Asian countries such as Japan and China (7,8). This wide variability in the prostate cancer rates across countries suggests that several factors including genetic, epigenetic and environmental differences play a key role in the etiology of the disease. Notably, it has been shown that Asian immigrants in the USA have an increased incidence of prostate cancer compared to those individuals with the same genetic background who live in Asia, indicating that environmental factors, especially the diet, are major determinants of prostate cancer incidence (9). One of the remarkable dietary differences between Asian and Western countries is the amount of soy-based food consumption. Asian populations consume high quantities of soy food which is rich in isoflavones (~2 g of isoflavones per kg of fresh soybean) (10). It has been shown that plasma and prostatic fluid concentrations of isoflavones in Asian men are 10 to 100 times higher than those in Western men, with particularly high levels of the isoflavone genistein (11,12). An increasing body of population-based studies has demonstrated that high intake of soy isoflavones are associated with a 25–30% reduced risk of prostate cancer (13,14).

As the major biologically active isoflavone in the soy diet, genistein has been extensively investigated for its chemopreventive potential in various types of cancer, including prostate cancer. The average daily intake of genistein in Asian populations has been shown to be 20–80 mg whereas it is 1–3 mg in the USA, supporting the protective effects of genistein against prostate cancer in Asian men (15). Genistein reaches plasma concentrations of 1–5 µM 6–8 h after intake of soy-rich diet (11,16). The plasma half-life of genistein has been reported as 7.9 h in adults. In addition, concentrations of total soy isoflavones in prostate tissue have been shown ~6-fold higher than serum levels of isoflavones (17). Safety and pharmacokinetic studies of soy isoflavones have demonstrated that minimal clinical toxicity was observed in healthy subjects administered with purified soy isoflavones at doses that exceed normal dietary intakes (18).

Due to its structural similarity to the steroid hormone 17β-estradiol, genistein binds to estrogen receptors, ER-α and ER-β, with a higher affinity to ER-β, and acts as a natural selective estrogen receptor modulator (16,19,20). Genistein exerts its inhibitory effects on prostate cancer cells by upregulating the expression of ER-β, which has anti-proliferative and pro-apoptotic roles in prostate cells (21,22). In addition to its estrogenic activities, genistein regulates androgen receptor (AR)-mediated pathways in prostate cancer (23,24). Of note, it has been shown that the inhibitory effect of genistein on AR expression is also mediated by ER-β (25). Several other molecular mechanisms underlying the preventive effects of genistein on prostate cancer include the inhibition of cell proliferation by inducing G1 and/or G2/M cell cycle arrest (2628), angiogenesis (29,30) and metastasis (3133) and induction of apoptosis (34,35). Genistein exerts its pleiotropic effects in the context of prostate cancer through modulation of several cell signal transduction pathways such as IGF-1 (36), TGF-β (37), Wnt/β-catenin (36), NF-κB (38), AKT and MAPK (39) signaling. This modulation could be by direct binding to nuclear receptors or modification of the phosphorylation state of signal transduction proteins. In addition, genistein inhibits tyrosine kinase activities (40) and shows antioxidant properties (41,42) in prostate cells. Swami et al (43) demonstrated that genistein reduces prostate cancer progression by inhibiting prostaglandin synthesis and activity. Genistein has also been reported to have possible effects on DNA damage and repair in prostate cancer cells (42). Moreover, genistein inhibits DNA methylation (4448) and histone modifications (47,48) and regulates miRNAs (4952) in prostate cancer. It is of interest that genistein has been shown to enhance the efficacy of radiotherapy and chemotherapy (53,54).

Although numerous in vitro and in vivo studies have been conducted to understand the protective effects of genistein against prostate cancer demonstrated by epidemiological studies, the molecular mechanisms that govern how genistein affects the pathogenesis of prostate cancer still remain elusive. It is noteworthy that a major challenge is the wide variability of the effects of genistein depending on the dose, the form of administration, or the timing and duration of exposure (55). Despite the wealth of studies performed in human cell lines and animal models, only a few prospective randomized clinical trials have been conducted to examine the molecular effects of genistein on prostate cancer. In the present study, to the best of our knowledge for the first time, we investigated the effects of genistein intervention on global methylation and gene expression patterns in patients with localized prostate cancer, and identified novel targets that are differentially modulated by genistein supplementation, providing further mechanistic insights into the effects of genistein on prostate carcinogenesis.

Materials and methods

Subjects

Prostate specimens from a clinical trial of genistein supplementation prior to prostatectomy (56) were analyzed for global changes in DNA methylation and gene expression. Participants were recruited from the outpatient clinic at the Department of Urology, Oslo University Hospital, Oslo, Norway between April 2007 and August 2008. The study was approved by the Norwegian Medicines Agency, the Regional Ethics Committee, the Privacy Ombudsman and the Prostate Biobank at the Oslo University Hospital, Aker.

Genome-wide methylation profiling

Total DNA was isolated from frozen prostate tissues using DNeasy Blood and Tissue kit (Qiagen, Valencia, CA, USA) according to the manufacturer's instructions. DNA was submitted to the Emory Integrated Genomics Core for DNA methylation analysis using Illumina HumanMethylation450 BeadChip Microarrays. Methylation data are available on GEO (accession number GSE84749).

Genome-wide expression profiling

Total RNA was extracted from frozen prostate tissues using the mirVana miRNA Isolation kit (Life Technologies, Grand Island, NY, USA), followed by RNA clean-up using the RNeasy Mini kit (Qiagen). Total RNA was submitted to the Emory Integrated Genomics Core for gene expression analysis using the Illumina HumanHT-12 v4 Expression BeadChip Microarray. Microarray data are available on GEO (accession number GSE84748).

Quantitative PCR (qPCR) analysis

RNA was reverse-transcribed into cDNA using iScript cDNA Synthesis kit (Bio-Rad Laboratories, Hercules, CA, USA). Primers were designed using Primer3 tool. Sequences of the primers are listed in Table I. qPCR was performed using iQ SYBR-Green Supermix (Bio-Rad Laboratories) on a Bio-Rad iCycler according to the manufacturer's protocols. Human β-actin gene, which has been shown to be a valid reference gene for normalization of qPCR in human tissue samples of prostate cancer, was used as an internal control in the present study (57). Normal prostate tissue sample was used as the calibrator. The relative changes in gene expression data were analyzed by the 2−ΔΔCT method. Triplicates were run for each sample. Data are presented as the mean ± standard deviation.

Table I

Sequences of the primers used in the quantitative PCR analysis.

Table I

Sequences of the primers used in the quantitative PCR analysis.

Primer namePrimer sequence (5′→3′)
CKS2-FP TTAGTCTCCGGCGAGTTGTTG
CKS2-RP CATAACATGCCGGTACTCGT
JAG1-FP AGTCGTGCATGCTCCAATCG
JAG1-RP CCCCACACACCTTGGCTC
NOTCH3-FP GATGTGGACGAGTGTGCTGG
NOTCH3-RP CAGGCATGGGTTGGGGTC
MMP26-FP GGACTTTGTTGAGGGCTATTTCCA
MMP26-RP GGAGGTGTCGGACCCATCAG
HIF1A-FP CACCACAGGACAGTACAGGAT
HIF1A-RP CGTGCTGAATAATACCACTCACA
CDK6-FP GCTGACCAGCAGTACGAATG
CDK6-RP GCACACATCAAACAACCTGACC
CD24-FP CGCGGACTTTTCTTTTGGGG
CD24-RP ACTGGAATAAATCTGCGTGGGT
AMACR-FP CCGTTCTGTGCTATGGTCCTG
AMACR-RP AGCCTTGGATTTTCCCGCTG
MYC-FP CCTACCCTCTCAACGACAGC
MYC-RP TTGTTCCTCCTCAGAGTCGC
SPP1-FP CAAACGCCGACCAAGGAAAA
SPP1-RP GGCCACAGCATCTGGGTATT
NEU1-FP CGCAGCTATGATGCCTGTGA
NEU1-RP GGTCAGGTTCACTCGGAACTC
ADCY4-FP CCTGGGACCAGGTGTCCTAT
ADCY4-RP CAAGATACAGCCCGAGGACC
β-actin-FP CACAGAGCCTCGCCTTTGCC
β-actin-RP TGACCCATGCCCACCATCAC

[i] qPCR analysis.

Data analysis

Gene expression analysis was performed using GenePattern ComparativeMarkerSelection module (58) comparing genistein-treated tumors to placebo-treated tumors. Illumina Microarray data were filtered to include genes that were detected (P<0.05) in at least one experimental group to result in a dataset of 15918 genes for analysis. The comparative marker selection module of GenePattern was used to compute two-sided Student's t-tests between groups with 10,000 permutations to compute false discovery rates. The random seed used was 779948241. Hierarchical clustering was performed using Cluster software (59) and Java TreeView (60). Methylation microarray analysis was performed in R using CpGassoc module in Bioconductor (61). Data from the 450K probes was filtered to those in which the maximum - minimum β-value was >0.2 to result in 160K probes for differential methylation analysis. CpGassoc was used to identify 162 significant probes that were differentially methylated. Three probes were differentially methylated between genistein-treated tumor samples and placebo-treated tumor samples, three probes were significant between genistein-treated tumor samples and normal samples and 156 were significantly different between placebo-treated tumor samples and normal samples.

Statistical analysis

Mann-Whitney U test (two-tailed) was used to determine significant differences between two groups of data. P<0.05 was considered as statistically significant.

Results

Clinicopathological characteristics

We analyzed prostate tissue samples from a previous study, which was a randomized, placebo-controlled, double-blind Phase 2 clinical trial on Norwegian patients with localized prostate cancer who received 30 mg synthetic genistein or placebo capsules daily for 3–6 weeks before radical prostatectomy (56). The clinical and pathological characteristics of the cases were previously described (56). The availability of frozen tissue limited the sample size in this study and we investigated the DNA methylation and gene expression levels of prostate tumor samples from 10 patients who received genistein and 10 patients who received placebo. Four adjacent normal prostate tissue samples were also analyzed. Clinical data for the 20 patients analyzed here are provided in Table II. There were no statistically significant differences in age, levels of serum PSA and Gleason score between the two treatment groups.

Table II

Clinical data for the 20 patients analyzed in the present study.

Table II

Clinical data for the 20 patients analyzed in the present study.

TreatmentPatient IDGleasonGleason SumStageAgePSA
Genistein (n=10)13+4726812.0
73+4726810.9
83+362596.2
103+473a615.1
133+362587.6
144+373a648.5
174+482616.1
183+362576.0
193+362637.8
203+472687.9
Average (SD)6.7 (0.7)62.7 (4.2)7.8 (2.2)
Placebo (n=10)243+362616.4
253+362574.2
263+473a689.9
274+482699.2
304+372555.1
333+362566.4
343+362637.6
353+473a605.7
383+472629.9
393+362667.0
Average (SD)6.6 (0.7)61.7 (4.9)7.1 (2.0)
Differential methylation in genistein-treated tissue compared with placebo-treated tissue

The genome-wide DNA methylation profiles of a total of 24 prostate samples from tumor or normal tissues were generated using Illumina HumanMethylation450 BeadChip kit. Methylation status of each sample was analyzed for 485,577 sites, covering 21,231 genes. We compared the methylation profiles of genistein-treated tumor samples with placebo-treated cases. In general, methylation changes were modest, and there was no significantly differentially methylated gene after correction for multiple hypothesis testing. However, uncorrected P-values indicated that RBM28 and CYTSB genes were demethylated in genistein-treated tumor samples compared to placebo-treated samples. The lack of statistical significance was likely due to the small numbers of samples analyzed in this study. We did observe 156 probes with significantly increased methylation in placebo-treated tumor tissues vs. normal tissues that were not significant between genistein-treated tumor tissues and normal tissues, suggesting that genistein may have had some demethylation effects (available upon request). These 156 probes corresponded to at least 92 separate genes including ADCY4, ALOX12, HAAO, LRRC4, NEU1, RAPGEFL1 and WNT7B (Table III).

Table III

List of 156 differentially methylated probes (92 genes).

Table III

List of 156 differentially methylated probes (92 genes).

Target IDGene nameP-value (GT vs. PT)P-value (GT vs. N)P-value (PT vs. N)
cg00353923LRRC4; SND1nsns0.000214451
cg00420348EFCAB4Ansns0.000247793
cg00459232CD9nsns0.000270319
cg00494665nsns0.000274219
cg00506168PDXKnsns0.000515556
cg00578638RAPGEFL1nsns3.67E-05
cg01224366PDXKnsns0.000393857
cg01228355CORINnsns0.000881032
cg01233722NFATC4nsns1.51E-05
cg01398859nsns0.000942104
cg01561916HAAOnsns0.00015216
cg01684881FZD2nsns0.000472597
cg01856645DMGDH; BHMT2nsns0.000876054
cg02072400nsns3.73E-05
cg02131967ACEnsns0.000468338
cg02215070AKR1B1nsns0.000607743
cg02493798ALOX12nsns0.000106934
cg02534363NBEAL2nsns0.000263128
cg02659920EPS8L2nsns0.000563556
cg02665650ANKS1Ansns0.000420543
cg02683114C2orf84nsns3.28E-05
cg02915422nsns0.000993538
cg03119308RBM280.000122845nsns
cg03404566ALOX12nsns9.44E-05
cg03407747ALOX12nsns0.000320776
cg03452174RAB34nsns0.000820466
cg03456213C9orf3nsns0.000620827
cg03760483ALOX12nsns0.000249903
cg03762994ALOX12nsns0.000338148
cg03782157nsns0.000566959
cg03787864CYBAnsns0.000360395
cg03955537TBCDnsns0.000449056
cg03957885nsns0.000500821
cg04034767GRASPnsns0.000526517
cg04178858RAPGEFL1nsns0.000378136
cg04194674SRCIN1nsns0.000665658
cg04332818FGF2nsns0.000648814
cg04555220SEMA5Ansns0.000994353
cg04621728nsns0.000680098
cg04797170nsns0.000729496
cg05209996nsns0.000724896
cg05897210DTHD1nsns0.000252462
cg05950572SPON1nsns0.000546993
cg06085985EFCAB4Ansns0.000230613
cg06590173TPM4nsns0.000778707
cg06607764CYTH1nsns0.000254746
cg06749789THAP4nsns0.000864909
cg06763054MTMR7nsns0.000353509
cg06795971TET2nsns0.000140266
cg06835156C14orf70ns0.000524942ns
cg06945399LRRC4; SND1nsns7.67E-05
cg07016556BAHCC1nsns0.000590044
cg07235805PARD6Gnsns0.000661791
cg07251099CD200nsns0.000689192
cg07522516ZAR1nsns0.000692555
cg07834955SFRP5nsns0.000372927
cg07871590LRRC4;SND1nsns0.000127567
cg07924363MGC16121; MIR424; MIR503ns0.000320255ns
cg08194377ANKS1Ansns0.000793165
cg08248285CFL2nsns0.000346449
cg08298946nsns0.000455024
cg08330950nsns0.000195062
cg08421126HAAOnsns0.000388422
cg08572315nsns0.000667361
cg08617833SMARCA1nsns0.000373883
cg09088834NINLnsns0.000442225
cg09246479C22orf45; UPB1nsns0.00010158
cg09456782TMCO3; DCUN1D2nsns0.000792785
cg09480054HAAOnsns0.000295903
cg09580336ATP1A1nsns0.000440859
cg09581551SOBPnsns0.000280079
cg09667289FMN1nsns0.000712725
cg09737314ALOX12nsns0.000673337
cg09920557ACEnsns0.000673976
cg09963123FLJ13197; KLF3nsns0.000654359
cg10445911nsns0.00061326
cg11417025SOSTDC1nsns0.000375888
cg11832404nsns0.000826709
cg11942956EYA4nsns0.00073108
cg12177793NFATC4nsns0.000965995
cg12262378ALOX12nsns0.000115607
cg12451530LOC100302652; GPR75nsns0.000188564
cg12828075INSCnsns0.000784835
cg13616314HS3ST3A1nsns2.38E-05
cg13801416AKR1B1nsns0.000474669
cg13857811SLC7A3nsns0.000228168
cg14032732ECHDC3nsns0.000256212
cg14243778CNTN1nsns0.00077315
cg14254720LRRC8Cnsns0.000920384
cg14287235ADCY4nsns0.000228476
cg14482902SRCIN1nsns0.000344968
cg14500300nsns8.80E-05
cg14603620RAPGEFL1nsns7.94E-05
cg14663984AGRNnsns0.000843468
cg14792081nsns0.000344126
cg15115171nsns0.000503109
cg15673034DLGAP1nsns0.000846318
cg15826437RAPGEFL1nsns0.00029995
cg15998779nsns0.000211956
cg16450577TBCDnsns0.000368573
cg16859884nsns0.000247308
cg16968985SEZ6nsns0.000382576
cg17011709CYP26C1nsns0.000901702
cg17131553TRPS1nsns0.000583708
cg17165580CRABP2nsns0.000197886
cg17479501TBCDnsns0.000197189
cg17496661ns0.0004364740.000459741
cg17624073BAHCC1nsns0.000526316
cg17729667NINLnsns0.000569462
cg18344652CNN3nsns0.000452391
cg19372602nsns0.000864447
cg19467964TBCDnsns0.000196505
cg19499884LZTS2nsns0.000537829
cg19929126TRILnsns0.000632594
cg20132775TRPC1nsns0.000197515
cg20145692COL9A2nsns0.000190537
cg20276377C3orf26; FILIP1L; MIR548Gnsns6.22E-05
cg20383155NEU1; SLC44A4nsns0.000632549
cg20801007EFCAB4Ansns0.000259905
cg20987431ZHX1nsns0.00053928
cg21079003RGMAnsns0.000411886
cg21116447NEU1; SLC44A4nsns0.000990119
cg21543859RUNX2nsns0.000760409
cg21849932LIME1nsns0.000537283
cg21944491LTBP4nsns0.000572287
cg22074576OSBPL5nsns0.00073274
cg22092811C3orf26; FILIP1L; MIR548Gnsns4.30E-05
cg22413388WNT7Bnsns0.000992683
cg22534145SSTR4nsns0.000156886
cg22675801TRILnsns0.000451146
cg22753340NEU1; SLC44A4nsns0.000874186
cg22773555EFCAB4Ansns0.00025263
cg22773661ZAR1nsns0.00033279
cg22871668EYA4nsns0.000392704
cg22878441nsns0.000393322
cg23083315FJX1nsns0.000288759
cg23142799SHISA2nsns0.000157373
cg23396786SFXN5nsns0.000434986
cg23425970HS6ST1nsns0.00016049
cg23563927C10orf93nsns0.000585909
cg23684878nsns0.000735566
cg23926436nsns0.00082097
cg24251193CRABP2nsns0.000141885
cg24331301CDH23nsns0.000549748
cg24878115SSBP4nsns0.000354342
cg24902339CASC2nsns0.000256574
cg25027125CFL2nsns0.000978881
cg25117523CYTH1nsns0.000297582
cg25387565NEU1nsns0.000708206
cg25563256FGF11nsns0.000933724
cg25813864RAPGEFL1nsns0.000174816
cg25834415IF1Ansns0.000894051
Kcg26009486NFATC4nsns0.000293111
cg26360792HAAOnsns0.000297095
cg26558799TBCDnsns0.000570916
cg26607748TPM2nsns0.000773141
cg26846076CYTSB0.000457469nsns
cg27191312nsns0.00012339
cg27299406HAAOnsns0.000380895
cg27347290NEU1; SLC44A4nsns0.000429935
cg27573591SND1; LRRC4nsns0.000183694
rs100331470.00000393nsns

[i] GT, genistein-treated tumor; PT, placebo-treated tumor; N, normal; NS, not significant.

Gene expression profiling changes after genistein treatment

To identify molecular effects of genistein on mRNA levels in prostate cancer, we compared gene expression profiles of genistein-treated tumors with placebo-treated samples. Once again, there were no differentially expressed probes that remained statistically significant after correction for multiple hypothesis testing. However, there were 628 probes that reached nominally significant P-values (available upon request). Hierarchial clustering of this dataset showed strong segregation of patients with and without genistein treatment (Fig. 1). The genes with nominally significant P-values included NOTCH3, JAG1, CKS2, HIF1A, CDK6, MYC, CD24, AMACR, MMP26 and SPP1 genes (Table IV). NEU1 and ADCY4 did not reach nominal significance but had a trend towards significance, and integration of the methylation data with the paired gene expression profiling data indicated decreased methylation status and increased expression levels of ADCY4 and NEU1 genes in genistein-treated cases.

Table IV

Genes with differential gene expression analyzed by qPCR.

Table IV

Genes with differential gene expression analyzed by qPCR.

Gene symbolGene expression fold-change
MicroarrayqPCR
CKS2−2.02−2.50
NOTCH31.722.08
HIF1A−1.63−1.80
CDK6−2.87−1.57
JAG11.916.00
NEU1a1.771.50
ADCY4a1.671.60
MYC−1.57−2.30
CD24−2.02−2.64
AMACR−1.95−2.14
MMPP26−2.78−2.84
SPP1−2.36−3.09

{ label (or @symbol) needed for fn[@id='tfn3-ijo-51-01-0223'] } Fold changes are genistein-tumor/placebo-tumor

a DNA methylation status is correlated with gene expression in NEU1 and ADCY4. qPCR, quantitative PCR.

Validation of microarray data

We investigated the expression levels of 12 selected genes (Table IV) in all 24 samples analyzed by microarrays using qPCR, and observed that microarray data were correlated with qPCR results (Fig. 2). The increase in the qPCR expression levels of NOTCH3 and JAG1 genes in genistein-treated tumors compared to placebo-treated tumors were statistically significant by Mann-Whitney U test.

Enrichment analysis

We performed gene enrichment analysis on the 628 nominally significant probes that were differentially expressed between genistein and placebo samples (Table V) using Ingenuity Pathway Analysis (62) and the DAVID Knowledgebase (63). P-value indicates hypergeometric distribution P-values of overlap for gene sets and functional categories. FDR indicates false discovery rate corrected P-values of overlap. Activation z-score is an indication of the consistency of up and downregulated members of a gene set such as a biological function (top table) or targets of an upstream regulator (middle table). Activation z-scores >2 or <−2 are statistically significant for consistency of activation or inhibition. Molecules indicate the number of molecules in the set of 628 analyzed probes that overlap with a given category. Mechanistic network indicates the total number of target genes of an upstream regulator, and the number of overlapping genes is indicated in parentheses. We observed enrichment for terms associated with angiogenesis, apoptosis, epithelial to mesenchymal transition, tumor progression and PDGF binding. Analysis of potential upstream regulators by IPA analysis suggested that PTEN and PDGF were activated, while MYC, β-estradiol, glucocorticoid receptor NR3C1 and interferon-γ were repressed in response to genistein treatment.

Table V

Enrichment analysis of 628 nominally significant probes differentially expressed between genistein and placebo groups.

Table V

Enrichment analysis of 628 nominally significant probes differentially expressed between genistein and placebo groups.

AnalysisP-valueActivation z-scoreNo. of moleculesFunction
IPA5.92E-080.77318Progression of tumor
IPA4.88E-071.01355Abdominal neoplasm
IPA1.09E-061.92728Differentiation of tumor cell lines
IPA1.34E-06−1.01719 Epithelial-mesenchymal transition
IPA7.46E-062.41222Neuroendocrine tumor
IPA7.98E-052.05428Necrosis of tumor

AnalysisP-value of overlapActivation z-scoreMechanistic networkUpstream regulator

IPA3.85E-08−0.692184 (16)NR3C1
IPA1.21E-071.681112 (9)PDGFB
IPA2.71E-07−1.385167 (15)β-estradiol
IPA2.15E-06−0.832144 (13)IFNG
IPA2.17E-061.608141 (16)PTEN
IPA4.59E-06−2.995133 (13)MYC

AnalysisFDRActivation z-scoreNo. of moleculesTerm

DAVID7.90E-04NA17GO:0005840 ribosome
DAVID1.19E-02NA34mitochondrion
DAVID2.00E-02NA16GO:0001568 blood vessel development
DAVID1.77E-02NA10GO:0019838 growth factor binding
DAVID3.52E-02NA7GO:0008629 induction of apoptosis by intracellular signals
DAVID3.16E-02NA4GO:0048407 platelet-derived growth factor binding

Discussion

To the best of our knowledge, the present study is the first highlighting the effects of genistein on global changes in DNA methylation and gene expression in patients from a clinical trial of genistein in prostate cancer. Integrative analysis of whole genome methylation and expression profiling identified a number of candidate differentially methylated sites and expressed sites between placebo and genistein groups. However, the differences between placebo and genistein groups were not statistically significant after correction for multiple hypothesis testing, possibly due to the small number of the cases in this study. Although the genistein-induced alterations are not significant, these results may help to elucidate the molecular mechanisms underlying the activities of genistein in prostate cancer. Genome-wide DNA methylation arrays showed that a number of genes, including RBM28 and CYTSB, appeared to be demethylated in the genistein-treated tumor samples compared to the samples in the placebo group. However, we did not observe any alterations in the expression levels of these genes. Among the differentially expressed genes identified by microarray analysis were CKS2, NOTCH3, HIF1A, CDK6, JAG1, NEU1, ADCY4, MYC, CD24, AMACR, MMP26 and SPP1. Microarray data were confirmed by qPCR analysis of these genes. Other genes with nominal significance by microarray but not tested by qPCR included ZNF639, CRIM1, PGC and USP54 (available upon request).

It is of interest to note that DNA methylation status was inversely correlated with gene expression for the NEU1 and ADCY4 genes, which had decreased methylation, and increased mRNA expression in the genistein group in comparison with placebo group. Our finding showing the potential of genistein for DNA demethylation is consistent with the previously reported data that suggest genistein acts as a DNMT inhibitor, thereby causing the demethylation of CpG islands in the promoters of genes. For example, genistein has been shown to reactivate the hypermethylated-silenced tumor suppressor genes, including p16INK4a, retinoic acid receptor β (RARβ) and O6-methylguanine methyltransferase (MGMT), in prostate and esophageal cancer cells (46). Moreover, genistein has been implicated in demethylation of WNT5a promoter in colon cancer cells (64). One of the genes shown to be demethylated by genistein in the present study is ADCY4, which is a member of the family of adenylate cyclases, the membrane-bound enzymes that catalyze formation of the secondary messenger cyclic adenosine monophosphate (cAMP) (65). Consistent with our finding, it has been recently shown that ADCY4 is a DNA methylation marker representing early epigenetic events in prostate tumorigenesis, supporting our hypothesis that genistein may reverse the pattern of DNA methylation in ADCY4 in prostate cancer (66). The other gene that was modulated by genistein intervention in the present study was NEU1, which is a lysosomal sialidase involved in glycoconjugate catabolism and cellular signaling, including immune responses and elastin receptor-mediated signal transduction (67). In fact, NEU1 is critical for desialylation of integrin β4 and inhibition of FAK, leading to suppression of liver metastases in colon cancer (68). Kato et al (69) has reported that NEU1 overexpression resulted in suppression of lung metastasis in melanoma. In addition, suppression of NEU1 by miR-125b has been shown to promote migration, invasion and metastasis in gastric cancers (70). However, NEU1 can also have pro-metastatic effects in pancreatic and ovarian cancers (71), and thus it is not entirely clear what the overall impact of increased NEU1 levels might be in prostate cancer. Therefore, it is important to examine the NEU1 expression changes at the protein level, and molecular and cellular studies are required to assess the functional consequences of changes induced by NEU1 upregulation in prostate cancer cells.

Among the differentially expressed genes that were validated by qPCR, only the expression of NOTCH3 and JAG1 mRNAs were significantly higher in the genistein group compared to the placebo group by qPCR. Based on our findings at mRNA level without any confirmation at the protein or functional level, it would be speculative to suggest that Notch signaling may play a role in the mechanism of action of genistein on prostate cancer. NOTCH3 is important for TGFβ-induced EMT in prostate cancer (72), and is induced by hypoxia and contributes to prostate cancer progression (73). The Notch ligand JAG1 is also associated with more aggressive prostate cancer (74,75), EMT and angiogenesis (76). However, a tumor suppressive role of Notch signaling has also been reported in hypoxia-induced neuroendocrine differentiation of prostate cancer cells as well as in other cancer types including bladder cancer, hematological malignancies, glioma, thyroid carcinoma and lung cancer (7782), indicating the possibility that increased NOTCH3/JAG1 expression by genistein treatment may improve outcomes through its tumor suppressor function. Our data suggest that further studies to delineate the effect of genistein on the Notch signaling pathway in prostate cancer may be warranted.

Enrichment analyses of mRNA changes induced by genistein indicated that subtle changes in gene expression observed between genistein and placebo samples are consistent with many previously reported effects of genistein on critical tumor pathways including PTEN, PDGF, MYC, β-estradiol, glucocorticoid receptor and interferon-γ (41,8389). Genistein appeared to promote PTEN activity and inhibit MYC activity, consistent with its potential utility in improving outcomes in prostate cancer.

In summary, our results indicate that genistein intervention induces modulation of several genes, including NOTCH3, JAG1, ADCY4 and NEU1, suggesting that these genes may have the potential to be novel molecular targets of genistein in prostate cancer. These genes are involved in many critical biological processes including cell cycle, angiogenesis, cellular immune response and intracellular signal transduction, providing additional insight into the multiple molecular pathways involved in prostate tumorigenesis. However, further mechanistic studies are required to investigate the effects of genistein on the regulation of the expression of these genes at the protein level and cellular functions. These findings may then contribute towards designing novel strategies for prevention and treatment of prostate cancer. One caveat of gene expression profiling studies is the incapability of identification of mechanisms of action that are modulated at post-transcriptional level, suggesting the possibility that genistein may alter additional cellular processes. Another point that needs to be made is timing and duration of exposure to genistein. Case control studies have demonstrated that high consumption of soy early in life (during childhood and/or adolescence) is associated with 25–60% reductions in breast cancer risk (90,91). Similarly, high soy intake at puberty, the period during which prostate undergoes androgen-induced growth, might be more effective in prevention of prostate cancer. A limitation of the present study is the small number of patient samples. Further large randomized controlled clinical trials would provide more definitive results of the effects of genistein on patient prostate tissues.

Acknowledgments

The present study was supported in part by the Emory Integrated Genomics Core (EIGC), which is subsidized by the NCI Cancer Center Support Grant P30CA138292 and Emory University School of Medicine and is one of the Emory Integrated Core Facilities. It was further supported by a Soy Research Award from the Soy Health Research Program of the United Soybean Board.

References

1 

Siegel RL, Miller KD and Jemal A: Cancer statistics, 2016. CA Cancer J Clin. 66:7–30. 2016. View Article : Google Scholar : PubMed/NCBI

2 

Prostate Cancer Facts and Figures 2016. American Cancer Society Inc; Atlanta, GA: 2016

3 

Dunn MW and Kazer MW: Prostate cancer overview. Semin Oncol Nurs. 27:241–250. 2011. View Article : Google Scholar : PubMed/NCBI

4 

Sartor AO: Progression of metastatic castrate-resistant prostate cancer: Impact of therapeutic intervention in the post-docetaxel space. J Hematol Oncol. 4:182011. View Article : Google Scholar : PubMed/NCBI

5 

Skolarus TA, Wolf AMD, Erb NL, Brooks DD, Rivers BM, Underwood W III, Salner AL, Zelefsky MJ, Aragon-Ching JB, Slovin SF, et al: American Cancer Society prostate cancer survivorship care guidelines. CA Cancer J Clin. 64:225–249. 2014. View Article : Google Scholar : PubMed/NCBI

6 

Hieronymus H, Schultz N, Gopalan A, Carver BS, Chang MT, Xiao Y, Heguy A, Huberman K, Bernstein M, Assel M, et al: Copy number alteration burden predicts prostate cancer relapse. Proc Natl Acad Sci USA. 111:11139–11144. 2014. View Article : Google Scholar : PubMed/NCBI

7 

Ferlay J, Bray F, Pisani P and Parkin DM: Globocan 2000: Cancer Incidence, Mortality and Prevalence Worldwide. IARC Press; Lyon: 2001

8 

Jemal A, Bray F, Center MM, Ferlay J, Ward E and Forman D: Global cancer statistics. CA Cancer J Clin. 61:69–90. 2011. View Article : Google Scholar : PubMed/NCBI

9 

Kimura T: East meets West: Ethnic differences in prostate cancer epidemiology between East Asians and Caucasians. Chin J Cancer. 31:421–429. 2012. View Article : Google Scholar

10 

Reinli K and Block G: Phytoestrogen content of foods–a compendium of literature values. Nutr Cancer. 26:123–148. 1996. View Article : Google Scholar

11 

Adlercreutz H, Markkanen H and Watanabe S: Plasma concentrations of phyto-oestrogens in Japanese men. Lancet. 342:1209–1210. 1993. View Article : Google Scholar : PubMed/NCBI

12 

Morton MS, Chan PS, Cheng C, Blacklock N, Matos-Ferreira A, Abranches-Monteiro L, Correia R, Lloyd S and Griffiths K: Lignans and isoflavonoids in plasma and prostatic fluid in men: Samples from Portugal, Hong Kong, and the United Kingdom. Prostate. 32:122–128. 1997. View Article : Google Scholar : PubMed/NCBI

13 

Hwang YW, Kim SY, Jee SH, Kim YN and Nam CM: Soy food consumption and risk of prostate cancer: A meta-analysis of observational studies. Nutr Cancer. 61:598–606. 2009. View Article : Google Scholar : PubMed/NCBI

14 

Van Poppel H and Tombal B: Chemoprevention of prostate cancer with nutrients and supplements. Cancer Manag Res. 3:91–100. 2011. View Article : Google Scholar : PubMed/NCBI

15 

Barnes S, Peterson TG and Coward L: Rationale for the use of genistein-containing soy matrices in chemoprevention trials for breast and prostate cancer. J Cell Biochem (Suppl). S22:181–187. 1995. View Article : Google Scholar

16 

Takimoto CH, Glover K, Huang X, Hayes SA, Gallot L, Quinn M, Jovanovic BD, Shapiro A, Hernandez L, Goetz A, et al: Phase I pharmacokinetic and pharmacodynamic analysis of unconjugated soy isoflavones administered to individuals with cancer. Cancer Epidemiol Biomarkers Prev. 12:1213–1221. 2003.PubMed/NCBI

17 

Gardner CD, Oelrich B, Liu JP, Feldman D, Franke AA and Brooks JD: Prostatic soy isoflavone concentrations exceed serum levels after dietary supplementation. Prostate. 69:719–726. 2009. View Article : Google Scholar : PubMed/NCBI

18 

Bloedon LT, Jeffcoat AR, Lopaczynski W, Schell MJ, Black TM, Dix KJ, Thomas BF, Albright C, Busby MG, Crowell JA, et al: Safety and pharmacokinetics of purified soy isoflavones: Single-dose administration to postmenopausal women. Am J Clin Nutr. 76:1126–1137. 2002.PubMed/NCBI

19 

Yildiz F: Phytoestrogens in functional foods. CRC Press; Boca Raton, FL: 2005, https://doi.org/10.1201/9781420027594urisimplehttps://doi.org/10.1201/9781420027594. View Article : Google Scholar

20 

Morito K, Hirose T, Kinjo J, Hirakawa T, Okawa M, Nohara T, Ogawa S, Inoue S, Muramatsu M and Masamune Y: Interaction of phytoestrogens with estrogen receptors alpha and beta. Biol Pharm Bull. 24:351–356. 2001. View Article : Google Scholar : PubMed/NCBI

21 

Chang WY and Prins GS: Estrogen receptor-beta: Implications for the prostate gland. Prostate. 40:115–124. 1999. View Article : Google Scholar : PubMed/NCBI

22 

Kumar R, Verma V, Jain A, Jain RK, Maikhuri JP and Gupta G: Synergistic chemoprotective mechanisms of dietary phytoestrogens in a select combination against prostate cancer. J Nutr Biochem. 22:723–731. 2011. View Article : Google Scholar

23 

Wang J, Eltoum IE and Lamartiniere CA: Genistein chemoprevention of prostate cancer in TRAMP mice. J Carcinog. 6:32007. View Article : Google Scholar : PubMed/NCBI

24 

Davis JN, Kucuk O and Sarkar FH: Expression of prostate-specific antigen is transcriptionally regulated by genistein in prostate cancer cells. Mol Carcinog. 34:91–101. 2002. View Article : Google Scholar : PubMed/NCBI

25 

Bektic J, Berger AP, Pfeil K, Dobler G, Bartsch G and Klocker H: Androgen receptor regulation by physiological concentrations of the isoflavonoid genistein in androgen-dependent LNCaP cells is mediated by estrogen receptor beta. Eur Urol. 45:245–251; discussion 251. 2004. View Article : Google Scholar : PubMed/NCBI

26 

Shen JC, Klein RD, Wei Q, Guan Y, Contois JH, Wang TT, Chang S and Hursting SD: Low-dose genistein induces cyclin-dependent kinase inhibitors and G(1) cell-cycle arrest in human prostate cancer cells. Mol Carcinog. 29:92–102. 2000. View Article : Google Scholar : PubMed/NCBI

27 

Davis JN, Singh B, Bhuiyan M and Sarkar FH: Genistein-induced upregulation of p21WAF1, downregulation of cyclin B, and induction of apoptosis in prostate cancer cells. Nutr Cancer. 32:123–131. 1998. View Article : Google Scholar

28 

Raffoul JJ, Wang Y, Kucuk O, Forman JD, Sarkar FH and Hillman GG: Genistein inhibits radiation-induced activation of NF-kappaB in prostate cancer cells promoting apoptosis and G2/M cell cycle arrest. BMC Cancer. 6:1072006. View Article : Google Scholar : PubMed/NCBI

29 

Li Y and Sarkar FH: Down-regulation of invasion and angiogenesis-related genes identified by cDNA microarray analysis of PC3 prostate cancer cells treated with genistein. Cancer Lett. 186:157–164. 2002. View Article : Google Scholar : PubMed/NCBI

30 

Guo Y, Wang S, Hoot DR and Clinton SK: Suppression of VEGF-mediated autocrine and paracrine interactions between prostate cancer cells and vascular endothelial cells by soy isoflavones. J Nutr Biochem. 18:408–417. 2007. View Article : Google Scholar

31 

Li Y, Che M, Bhagat S, Ellis KL, Kucuk O, Doerge DR, Abrams J, Cher ML and Sarkar FH: Regulation of gene expression and inhibition of experimental prostate cancer bone metastasis by dietary genistein. Neoplasia. 6:354–363. 2004. View Article : Google Scholar : PubMed/NCBI

32 

Zhang LL, Li L, Wu DP, Fan JH, Li X, Wu KJ, Wang XY and He DL: A novel anti-cancer effect of genistein: Reversal of epithelial mesenchymal transition in prostate cancer cells. Acta Pharmacol Sin. 29:1060–1068. 2008. View Article : Google Scholar : PubMed/NCBI

33 

Kumi-Diaka JK, Hassanhi M, Merchant K and Horman V: Influence of genistein isoflavone on matrix metalloproteinase-2 expression in prostate cancer cells. J Med Food. 9:491–497. 2006. View Article : Google Scholar

34 

Kazi A, Daniel KG, Smith DM, Kumar NB and Dou QP: Inhibition of the proteasome activity, a novel mechanism associated with the tumor cell apoptosis-inducing ability of genistein. Biochem Pharmacol. 66:965–976. 2003. View Article : Google Scholar : PubMed/NCBI

35 

Kumi-Diaka J, Sanderson NA and Hall A: The mediating role of caspase-3 protease in the intracellular mechanism of genistein-induced apoptosis in human prostatic carcinoma cell lines, DU145 and LNCaP. Biol Cell. 92:595–604. 2000. View Article : Google Scholar

36 

Lee J, Ju J, Park S, Hong SJ and Yoon S: Inhibition of IGF-1 signaling by genistein: Modulation of E-cadherin expression and downregulation of β-catenin signaling in hormone refractory PC-3 prostate cancer cells. Nutr Cancer. 64:153–162. 2012. View Article : Google Scholar

37 

Xu L and Bergan RC: Genistein inhibits matrix metalloproteinase type 2 activation and prostate cancer cell invasion by blocking the transforming growth factor beta-mediated activation of mitogen-activated protein kinase-activated protein kinase 2-27-kDa heat shock protein pathway. Mol Pharmacol. 70:869–877. 2006. View Article : Google Scholar : PubMed/NCBI

38 

Davis JN, Kucuk O and Sarkar FH: Genistein inhibits NF-kappaB activation in prostate cancer cells. Nutr Cancer. 35:167–174. 1999. View Article : Google Scholar

39 

Li Y and Sarkar FH: Inhibition of nuclear factor kappaB activation in PC3 cells by genistein is mediated via Akt signaling pathway. Clin Cancer Res. 8:2369–2377. 2002.PubMed/NCBI

40 

Akiyama T, Ishida J, Nakagawa S, Ogawara H, Watanabe S, Itoh N, Shibuya M and Fukami Y: Genistein, a specific inhibitor of tyrosine-specific protein kinases. J Biol Chem. 262:5592–5595. 1987.PubMed/NCBI

41 

Park CE, Yun H, Lee EB, Min BI, Bae H, Choe W, Kang I, Kim SS and Ha J: The antioxidant effects of genistein are associated with AMP-activated protein kinase activation and PTEN induction in prostate cancer cells. J Med Food. 13:815–820. 2010. View Article : Google Scholar : PubMed/NCBI

42 

Raschke M, Rowland IR, Magee PJ and Pool-Zobel BL: Genistein protects prostate cells against hydrogen peroxide-induced DNA damage and induces expression of genes involved in the defence against oxidative stress. Carcinogenesis. 27:2322–2330. 2006. View Article : Google Scholar : PubMed/NCBI

43 

Swami S, Krishnan AV, Moreno J, Bhattacharyya RS, Gardner C, Brooks JD, Peehl DM and Feldman D: Inhibition of prostaglandin synthesis and actions by genistein in human prostate cancer cells and by soy isoflavones in prostate cancer patients. Int J Cancer. 124:2050–2059. 2009. View Article : Google Scholar : PubMed/NCBI

44 

Adjakly M, Bosviel R, Rabiau N, Boiteux JP, Bignon YJ, Guy L and Bernard-Gallon D: DNA methylation and soy phytoestrogens: Quantitative study in DU-145 and PC-3 human prostate cancer cell lines. Epigenomics. 3:795–803. 2011. View Article : Google Scholar : PubMed/NCBI

45 

Vardi A, Bosviel R, Rabiau N, Adjakly M, Satih S, Dechelotte P, Boiteux JP, Fontana L, Bignon YJ, Guy L, et al: Soy phytoestrogens modify DNA methylation of GSTP1, RASSF1A, EPH2 and BRCA1 promoter in prostate cancer cells. In Vivo. 24:393–400. 2010.PubMed/NCBI

46 

Fang MZ, Chen D, Sun Y, Jin Z, Christman JK and Yang C: Reversal of hypermethylation and reactivation of 16INK4a, RARbeta, and MGMT genes by genistein and other isoflavones from soy. Clin Cancer Res. 11:7033–7041. 2005. View Article : Google Scholar : PubMed/NCBI

47 

Majid S, Dar AA, Shahryari V, Hirata H, Ahmad A, Saini S, Tanaka Y, Dahiya AV and Dahiya R: Genistein reverses hyper-methylation and induces active histone modifications in tumor suppressor gene B-Cell translocation gene 3 in prostate cancer. Cancer. 116:66–76. 2010.

48 

Kikuno N, Shiina H, Urakami S, Kawamoto K, Hirata H, Tanaka Y, Majid S, Igawa M and Dahiya R: Genistein mediated histone acetylation and demethylation activates tumor suppressor genes in prostate cancer cells. Int J Cancer. 123:552–560. 2008. View Article : Google Scholar : PubMed/NCBI

49 

Li Y, Kong D, Ahmad A, Bao B, Dyson G and Sarkar FH: Epigenetic deregulation of miR-29a and miR-1256 by isoflavone contributes to the inhibition of prostate cancer cell growth and invasion. Epigenetics. 7:940–949. 2012. View Article : Google Scholar : PubMed/NCBI

50 

Rabiau N, Trraf HK, Adjakly M, Bosviel R, Guy L, Fontana L, Bignon YJ and Bernard-Gallon DJ: miRNAs differentially expressed in prostate cancer cell lines after soy treatment. In Vivo. 25:917–921. 2011.PubMed/NCBI

51 

Chen Y, Zaman MS, Deng G, Majid S, Saini S, Liu J, Tanaka Y and Dahiya R: MicroRNAs 221/222 and genistein-mediated regulation of ARHI tumor suppressor gene in prostate cancer. Cancer Prev Res (Phila). 4:76–86. 2011. View Article : Google Scholar

52 

Chiyomaru T, Yamamura S, Fukuhara S, Hidaka H, Majid S, Saini S, Arora S, Deng G, Shahryari V, Chang I, et al: Genistein up-regulates tumor suppressor microRNA-574-3p in prostate cancer. PLoS One. 8:e589292013. View Article : Google Scholar : PubMed/NCBI

53 

Hillman GG, Forman JD, Kucuk O, Yudelev M, Maughan RL, Rubio J, Layer A, Tekyi-Mensah S, Abrams J and Sarkar FH: Genistein potentiates the radiation effect on prostate carcinoma cells. Clin Cancer Res. 7:382–390. 2001.PubMed/NCBI

54 

Li Y, Kucuk O, Hussain M, Abrams J, Cher ML and Sarkar FH: Antitumor and antimetastatic activities of docetaxel are enhanced by genistein through regulation of osteoprotegerin/receptor activator of nuclear factor-kappaB (RANK)/RANK ligand/MMP-9 signaling in prostate cancer. Cancer Res. 66:4816–4825. 2006. View Article : Google Scholar : PubMed/NCBI

55 

Spagnuolo C, Russo GL, Orhan IE, Habtemariam S, Daglia M, Sureda A, Nabavi SF, Devi KP, Loizzo MR, Tundis R, et al: Genistein and cancer: Current status, challenges, and future directions. Adv Nutr. 6:408–419. 2015. View Article : Google Scholar : PubMed/NCBI

56 

Katoh M: Network of WNT and other regulatory signaling cascades in pluripotent stem cells and cancer stem cells. Curr Pharm Biotechnol. 12:160–170. 2011. View Article : Google Scholar

57 

Mori R, Wang Q, Danenberg KD, Pinski JK and Danenberg PV: Both beta-actin and GAPDH are useful reference genes for normalization of quantitative RT-PCR in human FFPE tissue samples of prostate cancer. Prostate. 68:1555–1560. 2008. View Article : Google Scholar : PubMed/NCBI

58 

Reich M, Liefeld T, Gould J, Lerner J, Tamayo P and Mesirov JP: GenePattern 2.0. Nat Genet. 38:500–501. 2006. View Article : Google Scholar : PubMed/NCBI

59 

Eisen MB, Spellman PT, Brown PO and Botstein D: Cluster analysis and display of genome-wide expression patterns. Proc Natl Acad Sci USA. 95:14863–14868. 1998. View Article : Google Scholar : PubMed/NCBI

60 

Saldanha AJ: Java Treeview - extensible visualization of micro-array data. Bioinformatics. 20:3246–3248. 2004. View Article : Google Scholar : PubMed/NCBI

61 

Barfield RT, Kilaru V, Smith AK and Conneely KN: CpGassoc: An R function for analysis of DNA methylation microarray data. Bioinformatics. 28:1280–1281. 2012. View Article : Google Scholar : PubMed/NCBI

62 

http://www.qiagen.com/ingenuityurisimplehttp://www.qiagen.com/ingenuity. Qiagen's Ingenuity Pathway Analysis.

63 

Dennis G Jr, Sherman BT, Hosack DA, Yang J, Gao W, Lane HC and Lempicki RA: DAVID: Database for Annotation, Visualization, and Integrated Discovery. Genome Biol. 4:32003. View Article : Google Scholar

64 

Wang Z and Chen H: Genistein increases gene expression by demethylation of WNT5a promoter in colon cancer cell line SW1116. Anticancer Res. 30:4537–4545. 2010.PubMed/NCBI

65 

Gao BN and Gilman AG: Cloning and expression of a widely distributed (type IV) adenylyl cyclase. Proc Natl Acad Sci USA. 88:10178–10182. 1991. View Article : Google Scholar : PubMed/NCBI

66 

Brikun I, Nusskern D, Gillen D, Lynn A, Murtagh D, Feczko J, Nelson WG and Freije D: A panel of DNA methylation markers reveals extensive methylation in histologically benign prostate biopsy cores from cancer patients. Biomark Res. 2:252014. View Article : Google Scholar : PubMed/NCBI

67 

Monti E, Bonten E, D'Azzo A, Bresciani R, Venerando B, Borsani G, Schauer R and Tettamanti G: Sialidases in vertebrates: A family of enzymes tailored for several cell functions. Adv Carbohydr Chem Biochem. 64:403–479. 2010. View Article : Google Scholar : PubMed/NCBI

68 

Uemura T, Shiozaki K, Yamaguchi K, Miyazaki S, Satomi S, Kato K, Sakuraba H and Miyagi T: Contribution of sialidase NEU1 to suppression of metastasis of human colon cancer cells through desialylation of integrin beta4. Oncogene. 28:1218–1229. 2009. View Article : Google Scholar : PubMed/NCBI

69 

Kato T, Wang Y, Yamaguchi K, Milner CM, Shineha R, Satomi S and Miyagi T: Overexpressing of lysosomal-type sialidase leads to suppression of metastasis associated with reversion of malignant phenotype in murine B16 melanoma cells. Int J Cancer. 92:797–804. 2001. View Article : Google Scholar : PubMed/NCBI

70 

Chang S, He S, Qiu G, Lu J, Wang J, Liu J, Fan L, Zhao W and Che X: MicroRNA-125b promotes invasion and metastasis of gastric cancer by targeting STARD13 and NEU1. Tumour Biol. 37:12141–12151. 2016. View Article : Google Scholar : PubMed/NCBI

71 

Haxho F, Neufeld RJ and Szewczuk MR: Neuraminidase-1: A novel therapeutic target in multistage tumorigenesis. Oncotarget. 7:40860–40881. 2016.PubMed/NCBI

72 

Liu L, Chen X, Wang Y, Qu Z, Lu Q, Zhao J, Yan X, Zhang H and Zhou Y: Notch3 is important for TGF-β-induced epithelial-mesenchymal transition in non-small cell lung cancer bone metastasis by regulating ZEB-1. Cancer Gene Ther. 21:364–372. 2014. View Article : Google Scholar : PubMed/NCBI

73 

Danza G, Di Serio C, Ambrosio MR, Sturli N, Lonetto G, Rosati F, Rocca BJ, Ventimiglia G, del Vecchio MT, Prudovsky I, et al: Notch3 is activated by chronic hypoxia and contributes to the progression of human prostate cancer. Int J Cancer. 133:2577–2586. 2013.PubMed/NCBI

74 

Terada N, Shiraishi T, Zeng Y, Aw-Yong KM, Mooney SM, Liu Z, Takahashi S, Luo J, Lupold SE, Kulkarni P, et al: Correlation of Sprouty1 and Jagged1 with aggressive prostate cancer cells with different sensitivities to androgen deprivation. J Cell Biochem. 115:1505–1515. 2014. View Article : Google Scholar : PubMed/NCBI

75 

Pedrosa AR, Graça JL, Carvalho S, Peleteiro MC, Duarte A and Trindade A: Notch signaling dynamics in the adult healthy prostate and in prostatic tumor development. Prostate. 76:80–96. 2016. View Article : Google Scholar

76 

Pedrosa AR, Trindade A, Carvalho C, Graça J, Carvalho S, Peleteiro MC, Adams RH and Duarte A: Endothelial Jagged1 promotes solid tumor growth through both pro-angiogenic and angiocrine functions. Oncotarget. 6:24404–24423. 2015. View Article : Google Scholar : PubMed/NCBI

77 

Danza G, Di Serio C, Rosati F, Lonetto G, Sturli N, Kacer D, Pennella A, Ventimiglia G, Barucci R, Piscazzi A, et al: Notch signaling modulates hypoxia-induced neuroendocrine differentiation of human prostate cancer cells. Mol Cancer Res. 10:230–238. 2012. View Article : Google Scholar

78 

Rampias T, Vgenopoulou P, Avgeris M, Polyzos A, Stravodimos K, Valavanis C, Scorilas A and Klinakis A: A new tumor suppressor role for the Notch pathway in bladder cancer. Nat Med. 20:1199–1205. 2014. View Article : Google Scholar : PubMed/NCBI

79 

Hernandez Tejada FN, Galvez Silva JR and Zweidler-McKay PA: The challenge of targeting notch in hematologic malignancies. Front Pediatr. 2:542014. View Article : Google Scholar : PubMed/NCBI

80 

Giachino C, Boulay JL, Ivanek R, Alvarado A, Tostado C, Lugert S, Tchorz J, Coban M, Mariani L, Bettler B, et al: A tumor suppressor function for Notch signaling in forebrain tumor subtypes. Cancer Cell. 28:730–742. 2015. View Article : Google Scholar : PubMed/NCBI

81 

Jaskula-Sztul R, Eide J, Tesfazghi S, Dammalapati A, Harrison AD, Yu XM, Scheinebeck C, Winston-McPherson G, Kupcho KR, Robers MB, et al: Tumor-suppressor role of Notch3 in medullary thyroid carcinoma revealed by genetic and pharmacological induction. Mol Cancer Ther. 14:499–512. 2015. View Article : Google Scholar

82 

Sriuranpong V, Borges MW, Ravi RK, Arnold DR, Nelkin BD, Baylin SB and Ball DW: Notch signaling induces cell cycle arrest in small cell lung cancer cells. Cancer Res. 61:3200–3205. 2001.PubMed/NCBI

83 

Liu YL, Zhang GQ, Yang Y, Zhang CY, Fu RX and Yang YM: Genistein induces G2/M arrest in gastric cancer cells by increasing the tumor suppressor PTEN expression. Nutr Cancer. 65:1034–1041. 2013. View Article : Google Scholar : PubMed/NCBI

84 

Su SJ, Yeh TM, Chuang WJ, Ho CL, Chang KL, Cheng HL, Liu HS, Cheng HL, Hsu PY and Chow NH: The novel targets for anti-angiogenesis of genistein on human cancer cells. Biochem Pharmacol. 69:307–318. 2005. View Article : Google Scholar : PubMed/NCBI

85 

Jagadeesh S, Kyo S and Banerjee PP: Genistein represses telomerase activity via both transcriptional and posttranslational mechanisms in human prostate cancer cells. Cancer Res. 66:2107–2115. 2006. View Article : Google Scholar : PubMed/NCBI

86 

Mahmoud AM, Al-Alem U, Ali MM and Bosland MC: Genistein increases estrogen receptor beta expression in prostate cancer via reducing its promoter methylation. J Steroid Biochem Mol Biol. 152:62–75. 2015. View Article : Google Scholar : PubMed/NCBI

87 

Whirledge S, Senbanjo LT and Cidlowski JA: Genistein disrupts glucocorticoid receptor signaling in human uterine endometrial Ishikawa cells. Environ Health Perspect. 123:80–87. 2015.

88 

Bhamre S, Sahoo D, Tibshirani R, Dill DL and Brooks JD: Gene expression changes induced by genistein in the prostate cancer cell line LNCaP. Open Prostate Cancer J. 3:86–98. 2010. View Article : Google Scholar

89 

Ghaemi A, Soleimanjahi H, Razeghi S, Gorji A, Tabaraei A, Moradi A, Alizadeh A and Vakili MA: Genistein induces a protective immunomodulatory effect in a mouse model of cervical cancer. Iran J Immunol. 9:119–127. 2012.PubMed/NCBI

90 

Korde LA, Wu AH, Fears T, Nomura AM, West DW, Kolonel LN, Pike MC, Hoover RN and Ziegler RG: Childhood soy intake and breast cancer risk in Asian American women. Cancer Epidemiol Biomarkers Prev. 18:1050–1059. 2009. View Article : Google Scholar : PubMed/NCBI

91 

Lee SA, Shu XO, Li H, Yang G, Cai H, Wen W, Ji BT, Gao J, Gao YT and Zheng W: Adolescent and adult soy food intake and breast cancer risk: Results from the Shanghai Women's Health Study. Am J Clin Nutr. 89:1920–1926. 2009. View Article : Google Scholar : PubMed/NCBI

Related Articles

Journal Cover

July 2017
Volume 51 Issue 1

Print ISSN: 1019-6439
Online ISSN:1791-2423

Sign up for eToc alerts

Recommend to Library

Copy and paste a formatted citation
APA
Bilir, B., Sharma, N.V., Lee, J., Hammarstrom, B., Svindland, A., Kucuk, O., & Moreno, C.S. (2017). Effects of genistein supplementation on genome‑wide DNA methylation and gene expression in patients with localized prostate cancer. International Journal of Oncology, 51, 223-234. https://doi.org/10.3892/ijo.2017.4017
MLA
Bilir, B., Sharma, N. V., Lee, J., Hammarstrom, B., Svindland, A., Kucuk, O., Moreno, C. S."Effects of genistein supplementation on genome‑wide DNA methylation and gene expression in patients with localized prostate cancer". International Journal of Oncology 51.1 (2017): 223-234.
Chicago
Bilir, B., Sharma, N. V., Lee, J., Hammarstrom, B., Svindland, A., Kucuk, O., Moreno, C. S."Effects of genistein supplementation on genome‑wide DNA methylation and gene expression in patients with localized prostate cancer". International Journal of Oncology 51, no. 1 (2017): 223-234. https://doi.org/10.3892/ijo.2017.4017