Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Molecular Medicine Reports
Join Editorial Board Propose a Special Issue
Print ISSN: 1791-2997 Online ISSN: 1791-3004
Journal Cover
January 2013 Volume 7 Issue 1

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
January 2013 Volume 7 Issue 1

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Establishment of an optimized PCR method using sequence-specific primers for screening multiple gene polymorphisms simultaneously

  • Authors:
    • Rui Yang
    • Jun-He Zhang
    • Guo-Yan Yuan
  • View Affiliations / Copyright

    Affiliations: Department of Life Science and Technology, Xinxiang Medical University, Xinxiang, Henan 453003, P.R. China, Department of Biochemistry and Molecular Biology, Xinxiang Medical University, Xinxiang, Henan 453003, P.R. China, Department of Neurosurgery, The First Affiliated Hospital of Xinxiang Medical University, Weihui, Henan 453100, P.R. China
  • Pages: 201-204
    |
    Published online on: October 9, 2012
       https://doi.org/10.3892/mmr.2012.1122
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

The present study aimed to explore the factors that affect polymerase chain reaction using sequence-specific primers (PCR-SSP) and to establish an optimized PCR-SSP method for detecting multiple gene polymorphisms simultaneously. The amplification system parameters, including the concentrations of Mg2+, dNTPs, pfu Taq, primers and control primers, were optimized using the designed PCR-SSP reactions. The resulting optimized reaction system was used to determine the melting temperature of the genomic DNA and the cycling parameters. The optimized PCR-SSP method was used to analyze the polymorphisms of the following genes: mutations -308A/G and -238G/A in TNF-α, -174G/C in IL-6 and C/T mutation at exon 188 of CYP2D6 *10B. The PCR-SSP amplification system was optimized; in a 20 µl reaction system, the quantities of Mg2+, dNTPs, pfu Taq, primers, control primers and genomic DNA were 3.25 µM, 0.5 mM, 2.5 units, 0.5 µM, 0.2 µM and 0.15 µg, respectively. The cycling system comprised 5 start cycles and took 15 min to melt a genomic DNA sample using a touchdown protocol. The optimized PCR-SSP is suitable for polymorphism analysis of polygenic SNPs in large genomic DNA samples and a number of different genes.

Introduction

The presence of specific human gene single nucleotide polymorphisms (SNP) has been associated with susceptibility to several diseases (1). Evidence has demonstrated that polymorphisms have substantial clinical effects on the prevalence, incidence and prognosis of various major diseases, including asthma in children which is associated with IL-13 (1,2) and TNF-α-308A/G (3), Alzheimer’s disease (4,5), human mental diseases (6,7), chronic obstructive pulmonary disease (8,9) and cardiovascular disease (10). These diseases are often associated with the deoxyribonucleic acid (DNA) sequences of the genes, in particular with the SNPs. A very accurate prediction of diseases present may be obtained by genotyping the relevant SNPs. Large-scale samples are required to analyze and reveal the relationships between disease and SNPs.

At present, the following methods are typically used: i) polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP), a method which demands highly pure PCR products, large quantities and restriction enzyme sites for the SNP to be detected. Detection using this method would be very costly and time consuming for large samples. ii) Sequencing, a method that has high costs and is unsuitable for the quick analysis of many clinical samples. iii) PCR using sequence-specific primers (PCR-SSP), a method that is based on a critical PCR process with detection of the amplified product by agarose gel electrophoresis. The rapid and simple PCR amplification makes the technique suitable for screening SNPs that are related to disease, treatments and drug choice, particularly by large-sample polygenic genotyping. Thus, it is a more favorable prospect for the clinical testing of gene polymorphisms. However, multiple factors affect the PCR process. During PCR-SSP, the sequence primers are required to be combined and controlled with specific primers in the same reaction mixture in the test tube to ensure that if amplification failure occurs, it results from mismatched primers rather than from a failure of the amplification system. Therefore, the reaction parameters have a significant effect which may limit the applications of the method in the detection of SNPs (11).

For this purpose, the parameters for the cycling and operation systems were optimized to establish a protocol suitable for the convenient, rapid and accurate polygenic genotyping of a large number of samples.

Materials and methods

DNA

Genomic DNA from human peripheral blood donated by researchers was prepared and used by our laboratory. The animal genomic DNA was from healthy Kunming mice provided by The Animal Experimental Center of Xinxiang Medical University. The DNA extraction kit used was a universal genomic DNA extraction kit SK1341 (Sangon Co. Ltd., Shanghai, China).

Primers

The PCR-SSP method optimized in our laboratory was tested to analyze polymorphisms of the following genes: -308A/G mutations in TNF-α, COMT 472 coding sequence G/A, the C/T mutation at exon 188 of CYP2D6 *10B, mouse PPARγ and mouse β-actin. The primers (synthesized by Sangon Co. Ltd., Shanghai, China) used in the experiment are shown in Table I.

Table I

Primer sequences, amplification size for the single locus PCR-SSP and sequencing.

Table I

Primer sequences, amplification size for the single locus PCR-SSP and sequencing.

Gene namePrimer sequences (5′ to 3′)Product size (bp)
Human β-globin gene (12)F: GAA GAG CCA AGG ACA GGT AC
R: CAA CTT CAT CCA CGT TCA CC
268
TNFα-308A/G (13)F: TCC TCC CTG CTC CGA TTC CG
Ra: CAA TAA GTT TTG AGG GGC ATG A
Rb: CAA TAA GTT TTG AGG GGC ATG G
104
CYP2D6 *10B exon 188 C/T (7)F: ACC AGG CCC CTC CAC CGG
Ra: AGG GGG CCT GGT GG
Ra: AGG GGG CCT GGT GA
397
COMT 472 coding sequence G/AF: ACT GTG GCT ACT CAG CTG TG
Ra: TGC ACA CCT TGT CCT TCA C
Rb: TGC ACA CCT TGT CCT TCA T
138
Mouse β actin (14)F: CCAGGGTGTGATGGTGGGAATG
R: CGCACGATTTCCCTCTCAGCTG
510
Mouse PPARγ (15)F: GACCACTCGCATTCCTTT
R: CCACAGACTCGGCACTCA
265
Method optimization

The amplification system parameters, including the concentrations of Mg2+, dNTPs, pfu Taq, primers and control primers, were optimized using designed PCR-SSP reactions. The optimized reaction system was used to determine the melting temperature of the sample DNA and the cycling parameters.

The PCR products were examined on a 2% agarose gel (Shanghai Sangon Biological Engineering Technology & Service Co. Ltd., Shanghai, China). The amplified products were confirmed under UV light following ethidium bromide staining to determine the optimum parameters. The molecular standard used was GeneRuler™ 100 bp DNA Ladder (Sangon Co. Ltd.). Pfu Taq DNA (Promega Corporation, Madison, WI, USA) and PTC-100 PCR machine (Biogene, Richardson, TX, USA) were used.

Results

Reaction system

The amplification was performed in a 20 μl reaction volume and the effect of varying each of the parameters was studied while the others were kept constant. Firstly, the volume of 25 mmol/l Mg2+ was varied from 1 to 5 μl. Other parameters were DNA from 50 to 100 ng, 20 mM Tris-HCl (pH 8.4), 50 mM KCl, 0.5 mM of each dNTP, 0.7 μM of each primer (Table I) and 3 units Pfu Taq DNA polymerase. As shown in Fig. 1a, 3 μl was the optimal amount of Mg2+. Secondly, after the optimal Mg2+ concentration was determined, the effects of different final dNTP concentrations on the amplification were compared in the range 0.25–1.0 mM, added in increments of 0.25M. Fig. 1b reveals that 0.5 mM dNTPs was optimal. The optimal quantity of pfu Taq DNA polymerase was 2.5 units; it was evaluated in the range 1.0–3.5 units, added in increments of 0.5 units. The optimal common primer concentration was 0.5 μM; it was evaluated in the range 0.3–0.9 μM and added in increments of 0.2 μM (Fig. 1c and d). Finally, the ratio of the internal control primer concentration to the specific primer concentration was optimized after the other optimal concentrations had been determined. As shown in Fig. 1e, the optimum ratio was 2/5.

Figure 1

PCR-SSP system parameters optimization. (a) Variation of Mg2+ concentration in PCR. Lane 1: GeneRuler™ 100 bp DNA Ladder; lanes 2, 3, 4 and 5: 5, 3, 2 and 1 μl 25 mM Mg2+ in buffer, respectively. (b) Effect of different dNTP concentrations on PCR. Lanes 1, 2, 3 and 4: 0.25, 0.5, 0.75 and 1.0 mmol/l dNTPs in the PCR mixture, respectively; lane 5: GeneRuler 100 bp DNA Ladder. (c) Effect of different concentrations of pfu Taq in PCR. Lane 1: GeneRuler 100 bp DNA Ladder; lanes 2, 3, 4, 5, 6 and 7: 1.0, 1.5, 2.0, 2.5, 3.0 and 3.5 units of pfu Taq DNA in PCR mixture, respectively. (d) Different concentrations of common primers in the PCR system. Lanes 1, 2, 3 and 4: 0.3, 0.5, 0.7 and 0.9 μmol/l primers, respectively; lane 5: GeneRuler 100 bp DNA Ladder. (e) Different ratios of internal control primers to specific primers in the PCR system. Lane 3: GeneRuler 100 bp DNA Ladder; lanes 1, 2, 4 and 5: the ratio of internal control primers to common primers of 2/5, 4/5, 1 and 1.5. PCR-SSP, polymerase chain reaction using sequence-specific primers; DNA, deoxyribonucleic acid.

Cycling and validation

The primers, PCR mixture and electrophoresis conditions were as previously described. The optimal thermocycler conditions for the amplification were evaluated, including 95°C for 1, 3, 5, 10, 15 and 20 min, 95°C for 50 sec, 56°C for 50 sec and 72°C for 60 sec, followed by 72°C for 10 min. The denaturation times were evaluated and revealed an optimal duration time of 15 min (Fig. 2a). For certain SNPs that were difficult to amplify by conventional PCR, evaluation was performed by touchdown and modified touchdown PCR (Figs. 2b and c).

Figure 2

Optimized parameters of the PCR-SSP cycling. (a) Different denaturation times in PCR cycling. Lane 4: GeneRuler™ 100 bp DNA Ladder; lanes 1, 2, 3, 5, 6 and 7: denaturation times of 1, 3, 5, 10, 15 and 20 min, respectively. (b) Different touchdown programs used in PCR. Lanes 1 and 2: conventional PCR; lane 3: GeneRuler 100 bp DNA Ladder; lane 4: a common touchdown program; lane 5: optimized touchdown PCR. (c) Different SNPs tested by the optimized touchdown program. PCR-SSP, polymerase chain reaction using sequence-specific primers.

The same primers were used in the optimized PCR: 20 μl reaction system contained 2 μl 1X PCR buffer, 3 μl 25 mmol/l MgCl2, positive control primer at a final concentration of 0.2 μmol/l, the common primer and primers a or b at final concentrations of 0.5 μmol/l, dNTP at a final concentration of 0.5 mmol/l and 2.5 units pfu Taq DNA polymerase. The PCR programs used the touchdown cycling method were: 95°C for 15 min, 95°C for 30 sec, 70°C for 1 min and 72°C for 10 min repeated for 5 cycles; 95°C for 30 sec, 69.5°C for 1 min, then decreased by 0.5°C every cycle, 72°C for 1.5 min, repeated for 30 cycles; and 72°C for 10 min.

The modified PCR-SSP reaction system and touchdown cycling were used to evaluate human SNPs and mouse genes. TNF-α-308A/G, C/T at exon 188 of CYP2D6 *10B, COMT 472 G/A, mouse PPARγ and mouse β-actin were analyzed. Fig. 2c clearly shows the amplified bands.

Discussion

To optimize the protocol for the simultaneous polymorphism analysis of SNPs in large samples of multiple genes, the reaction was performed in 20 μl liquid mixture. The Mg2+ concentration is more important to the polymerase, hence it was optimized first. For other parameters, conventional concentrations were utilized for smooth optimization.

PCR-SSP is based on the principle that recombinant Taq DNA polymerase is more specific for the oligonucleotide primers that completely match the target gene. If a primer that completely matches one genotype of the allele is designed and the PCR process is strictly controlled, then the matching primer will be amplified (positive results), whereas the mismatched primer will not (negative results). The results of PCR-SSP are interpreted based on whether an amplification band is visible, and the amplified products of two lanes are used to determine the genotype of a sample. Considering that numerous factors affect a PCR procedure, an internal reference must be used for each reaction. The internal reference generally used is the human globin gene, which is universally present in the conserved region of the human genome. In reactions showing positive bands, the amplification band of the internal reference may be present, attenuated or absent depending on the concentration of the specific primer pair and internal reference primer pair (16–18).

Primer concentrations are very significant in PCR-SSP reactions (11) to avoid false negative results. The optimized common primer concentration is 0.5 μM and the ratio of internal control primer to specific primer is 2/5.

If the amplification reaction occurs smoothly, the DNA template must be a single band. Human genes are extremely complicated. Thus, the denaturation time was optimized. The results indicated that 15 min is the optimum duration for human and mouse genes. To avoid Taq polymerase inactivation, 2.5 units pfu Taq were used, which is slightly higher than the usual concentration.

The proposed optimized method is similar to the touchdown method and standard PCR protocols, with the exception of a special cycling program in which a series of gradually decreasing annealing temperatures was set. Furthermore, a variety of primers were added to the reaction system so that different target gene specific sequences were amplified satisfactorily. The basic principle of this approach was to choose an annealing temperature that was 15°C higher than the calculated annealing temperature. This temperature was gradually decreased back to the annealing temperature and then finally reduced further to 5°C lower than the annealing temperature. Such a strategy ensures that the first hybridization between the primer and the template occurs under the most complementary conditions and it may be cycled at different denaturing and annealing temperatures.

In conclusion, a PCR-SSP protocol modified to optimize the diagnosis of diseases associated with multiple gene polymorphisms has been developed. This PCR-SSP protocol is faster and less expensive than the currently used procedures, particularly in the primary screening of large samples and various point mutations.

Acknowledgements

This study was supported by the Natural Science Foundation of Henan Province, China [No: 12A310005]; National Natural Science Foundation of China [No: 30970055]; and Xinxiang Medical University Projects [No: ZD200936, ZD2011-17].

References

1 

Knight JC: Functional implications of genetic variation in non-coding DNA for disease susceptibility and gene regulation. Clin Sci (London). 104:493–501. 2003. View Article : Google Scholar : PubMed/NCBI

2 

He JQ, Chan-Yeung M, Becker AB, et al: Genetic variants of the IL13 and IL4 genes and atopic diseases in at-risk children. Genes Immun. 4:385–389. 2003. View Article : Google Scholar : PubMed/NCBI

3 

Zhang Y, Zhang J, Tian C, et al: The -308 G/A polymorphism in TNF-α gene is associated with asthma risk: an update by meta-analysis. J Clin Immunol. 31:174–185. 2011.

4 

Faltraco F, Bürger K, Zill P, et al: Interleukin-6–174 G/C promoter gene polymorphism C allele reduces Alzheimer’s disease risk. J Am Geriatr Soc. 51:578–579. 2003.

5 

Licastro F, Grimaldi LM, Bonafé M, et al: Interleukin-6 gene alleles affect the risk of Alzheimer’s disease and levels of the cytokine in blood and brain. Neurobiol Aging. 24:921–926. 2003.

6 

Eley TC, Tahir E, Angleitner A, et al: Association analysis of MAOA and COMT with neuroticism assessed by peers. Am J Med Genet B Neuropsychiatr Genet. 120B:90–96. 2003. View Article : Google Scholar : PubMed/NCBI

7 

Roh HK, Kim CE, Chung WG, Park CS, Svensson JO and Bertilsson L: Risperidone metabolism in relation to CYP2D6*10 allele in Korean schizophrenic patients. Eur J Clin Pharmacol. 57:671–675. 2001.

8 

He JQ, Foreman MG, Shumansky K, et al: Associations of IL6 polymorphisms with lung function decline and COPD. Thorax. 64:698–704. 2009. View Article : Google Scholar : PubMed/NCBI

9 

Córdoba-Lanús E, de-Torres JP, López-Aguilar C, et al: Association of IL-6 gene polymorphisms and COPD in a Spanish population. Resp Med. 102:1805–1811. 2008.

10 

Elmas E, Bugert P, Popp T, et al: The P-selectin gene polymorphism Val168Met: a novel risk marker for the occurrence of primary ventricular fibrillation during acute myocardial infarction. J Cardiovasc Electrophysiol. 21:1260–1265. 2010. View Article : Google Scholar

11 

Fugger L, Morling N, Ryder LP, Odum N and Svejgaard A: Technical aspects of typing for HLA-DP alleles using allele-specific DNA in vitro amplification and sequence-specific oligonucleotide probes. Detection of single base mismatches. J Immunol Methods. 129:175–185. 1990. View Article : Google Scholar

12 

Bon MA, van Oeveren-Dybicz A and van den Bergh FA: Genotyping of HLA-B27 by real-time PCR without hybridization probes. Clin Chem. 46:1000–1002. 2000.PubMed/NCBI

13 

Yang R, Yang X, Qian C and Liu J: Rapid detection of gene polymorphism of clinical pediatrics diseases by PCR-SSP. J Appl Clin Pediatrics. 21:687–688. 2006.(In Chinese).

14 

Schäffler A, Weigert J, Neumeier M, Schölmerich J and Buechler C: Regulation and function of collagenous repeat containing sequence of 26-kDa protein gene product ‘cartonectin’. Obesity (Silver Spring). 15:303–313. 2007.

15 

Grottkau BE, Purudappa PP and Lin YF: Multilineage differentiation of dental pulp stem cells from green fluorescent protein transgenic mice. Int J Oral Sci. 2:21–27. 2010. View Article : Google Scholar : PubMed/NCBI

16 

Aldener-Cannavá A and Olerup O: HLA-DOB1 “low-resolution” typing by PCR amplification with sequence-specific primers (PCR-SSP). Eur J Immunogenet. 21:447–455. 1994.

17 

Zetterquist H and Olerup O: Identification of the HLA-DRB1*04, -DRB1*07, and -DRB1*09 alleles by PCR amplification with sequence-specific primers (PCR-SSP) in 2 hours. Hum Immunol. 34:64–74. 1992.

18 

Olerup O and Zetterquist H: HLA-DR typing by PCR amplification with sequence-specific primers (PCR-SSP) in 2 hours: an alternative to serological DR typing in clinical practice including donor-recipient matching in cadaveric transplantation. Tissue Antigens. 39:225–235. 1992. View Article : Google Scholar

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Yang R, Zhang J and Yuan G: Establishment of an optimized PCR method using sequence-specific primers for screening multiple gene polymorphisms simultaneously. Mol Med Rep 7: 201-204, 2013.
APA
Yang, R., Zhang, J., & Yuan, G. (2013). Establishment of an optimized PCR method using sequence-specific primers for screening multiple gene polymorphisms simultaneously. Molecular Medicine Reports, 7, 201-204. https://doi.org/10.3892/mmr.2012.1122
MLA
Yang, R., Zhang, J., Yuan, G."Establishment of an optimized PCR method using sequence-specific primers for screening multiple gene polymorphisms simultaneously". Molecular Medicine Reports 7.1 (2013): 201-204.
Chicago
Yang, R., Zhang, J., Yuan, G."Establishment of an optimized PCR method using sequence-specific primers for screening multiple gene polymorphisms simultaneously". Molecular Medicine Reports 7, no. 1 (2013): 201-204. https://doi.org/10.3892/mmr.2012.1122
Copy and paste a formatted citation
x
Spandidos Publications style
Yang R, Zhang J and Yuan G: Establishment of an optimized PCR method using sequence-specific primers for screening multiple gene polymorphisms simultaneously. Mol Med Rep 7: 201-204, 2013.
APA
Yang, R., Zhang, J., & Yuan, G. (2013). Establishment of an optimized PCR method using sequence-specific primers for screening multiple gene polymorphisms simultaneously. Molecular Medicine Reports, 7, 201-204. https://doi.org/10.3892/mmr.2012.1122
MLA
Yang, R., Zhang, J., Yuan, G."Establishment of an optimized PCR method using sequence-specific primers for screening multiple gene polymorphisms simultaneously". Molecular Medicine Reports 7.1 (2013): 201-204.
Chicago
Yang, R., Zhang, J., Yuan, G."Establishment of an optimized PCR method using sequence-specific primers for screening multiple gene polymorphisms simultaneously". Molecular Medicine Reports 7, no. 1 (2013): 201-204. https://doi.org/10.3892/mmr.2012.1122
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team