Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Molecular Medicine Reports
Join Editorial Board Propose a Special Issue
Print ISSN: 1791-2997 Online ISSN: 1791-3004
Journal Cover
September-2016 Volume 14 Issue 3

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
September-2016 Volume 14 Issue 3

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Pioglitazone affects the OPG/RANKL/RANK system and increase osteoclastogenesis

  • Authors:
    • Fei Xu
    • Yonghui Dong
    • Xin Huang
    • Peng Chen
    • Fengjing Guo
    • Anmin Chen
    • Shilong Huang
  • View Affiliations / Copyright

    Affiliations: Department of Orthopedics, Tongji Hospital Affiliated to Tongji Medical College, Huazhong University of Science and Technology, Wuhan, Hubei 430030, P.R. China
  • Pages: 2289-2296
    |
    Published online on: July 13, 2016
       https://doi.org/10.3892/mmr.2016.5515
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

Thiazolidinediones are traditional anti‑diabetic therapeutic agents that have been associated with bone loss and increased fracture risk. However, the underlying mechanisms of this side effect require further elucidation. The present study aimed to investigate the effect of pioglitazone (PIO), a thiazolidinedione, on osteoblastogenesis, osteoclastogenesis and the osteoprotegerin (OPG) / receptor activator of nuclear factor‑κB ligand (RANKL) / RANK system. The MC3T3‑E1 murine pre‑osteoblastic cell line was treated with PIO and processed for reverse transcription‑quantitative polymerase chain reaction (RT‑qPCR) analysis of OPG, RANKL, peroxisome proliferator‑activated receptor γ (PPARγ), Runt‑related transcription factor 2 (RUNX2), alkaline phosphatase (ALP) and osteocalcin (OCN), and western blotting analysis of OPG and RANKL. The culture medium was collected for ELISA analysis of OPG and RANKL. Murine bone marrow monocytes (BMMCs) were treated with PIO in the presence of RANKL and macrophage‑colony stimulating factor and subjected to tartrate‑resistant acid phosphatase (TRAP) staining and activity measurement, and RT‑qPCR analysis of cathepsin K, TRAP and RANK. Co‑culture of MC3T3‑E1 and BMMCs was performed in the presence of PIO, and TRAP staining was also conducted. PIO inhibited the osteoblastic differentiation of MC3T3‑E1 cells, and promoted the osteoclastic differentiation of BMMCs with or without co‑culturing with MC3T3‑E1 cells. ELISA analysis indicated increased RANKL and decreased OPG expression levels in the medium of MC3T3‑E1 cells treated with PIO. PIO upregulated expression of RANKL and PPARγ and downregulated expression of OPG, RUNX2, ALP and OCN in MC3T3‑E1 cells, while expression levels of RANK in BMMCs remained unchanged. These results suggest that PIO suppresses osteoblastogenesis and enhances osteoclastogenesis. In addition, PIO may also promote osteoclastogenesis by affecting the OPG‑RANKL‑RANK system.

Introduction

Thiazolidinediones (TZDs) are therapeutic agents commonly used to treat patients with type 2 diabetes, they have been demonstrated to affect bone metabolism (1). It has been reported that long-term usage of TZDs in diabetic patients induced bone loss and a higher risk of fracture (2,3).

Bone homeostasis depends on the balance between bone formation by osteoblasts and bone resorption by osteoclasts (4). Bone loss and osteoporosis occur when bone resorption exceeds bone formation, and osteopetrosis may occur when bone formation predominates (5). The molecular osteoprotegerin (OPG) / receptor activator of nuclear factor-κB ligand (RANKL) / RANK axis is important in the regulation of homeostasis (6). OPG and RANKL are secreted by osteoblasts, RANKL mediates osteoclastogenesis by binding RANK expressed by osteoclasts, whereas OPG acts as a decoy receptor of RANKL to prevent osteoclastogenesis (6). Thus, osteoclastogenesis depends on the ratio of OPG to RANKL secreted by osteoblasts (6,7).

TZDs act via peroxisome proliferator-activated receptor γ (PPARγ), which is a member of the nuclear receptor super-family of transcription factors (8), and the predominant factor involved in adipose metabolism. Activation of PPARγ results in adipogenic differentiation in various kinds of progenitor cells (9,10). A number of studies have demonstrated that TZDs inhibit osteoblastogenesis directly, but its effect on osteoclastogenesis remains to be determined. Few studies have investigated the effect of TZDs on the OPG/RANKL/RANK system and the paracrine regulation of osteoclastogenesis.

The present study investigated the direct effect of pioglitazone (PIO), a TZD, on osteoblastogenesis and osteoclastogenesis, and the paracrine mechanisms by which PIO affects osteoclastogenesis were also investigated by performing a co-culture system of a pre-osteoblastic cell line with bone marrow mononuclear cells.

Materials and methods

Reagents

Recombinant murine macrophage colony-stimulating factor (M-CSF) and RANKL were purchased from R&D Systems, Inc. (Minneapolis, MN, USA). The ALP Staining kit and TRAP Staining kit were obtained from Sigma-Aldrich (St. Louis, MO, USA). Anti-RANKL (#4816; rabbit polyclonal; 1:1,000) antibody was obtained from Cell Signaling Technology, Inc. (Danvers, MA, USA) and the anti-OPG (BA1475-1; rabbit polyclonal; 1:100–400) antibody, OPG and RANKL ELISA kits were obtained from Wuhan Boster Biological Technology, Co., Ltd. (Wuhan, China). PIO was obtained from Santa Cruz Biotechnology, Inc. (Dallas, TX, USA).

Cell culture

The MC3T3-E1 murine pre-osteoblastic cell line was purchased from the American Type Culture Collection (Manassas, VA, USA). Cells were cultured in α-modified essential medium (α-MEM; Hyclone; GE Healthcare Life Sciences, Logan, UT, USA) supplemented with 100 U/ml penicillin, 100 μg/ml streptomycin and 10% fetal calf serum (FCS; Gibco; Thermo Fisher Scientific, Inc., Waltham, MA, USA) at 37°C in a humidified atmosphere of 5% CO2. The media was changed every 3 days.

Isolation of monocytes

Bone marrow cells were isolated from the femora of C57BL/6 mice (male; age, 6–8 weeks; weight, 18–22 g; Beijing HFK Bioscience Co., Ltd., Beijing, China). The mice were housed separately in a temperature- and humidity-controlled (20–26°C and 40–70%, respectively) environment, with a 12/12 h light/dark cycle and free access to food and water. The mice were sacrificed by CO2 inhalation and cervical dislocation. The cells were cultured in α-MEM supplemented with 100 U/ml penicillin, 100 μg/ml streptomycin and 15% FCS at 37°C in a humidified atmosphere of 5% CO2. After 24 h of culture, the non-adherent BMMCs were collected. All procedures were approved by the Animal Care and Use Committee, Tongji Medical College, Huazhong University of Science and Technology (Wuhan, China).

Osteoblast differentiation

For differentiation studies, MC3T3-E1 cells were cultured in 6-well plates (Corning Incorporated, Corning, NY, USA) at a density of 5×106 cells/well. After 24 h, the culture medium was replaced with conditioned medium [α-MEM supplemented with 10% FCS, 10 mM β-glycerophosphate (Sigma-Aldrich), 50 μg/ml L-ascorbic acid (Sigma-Aldrich) and 100 nM dexamethasone (Wuhan Boster Biological Technology, Co., Ltd.)] with dimethyl sulfoxide (DMSO; as control; Santa Cruz Biotechnology, Inc.), PIO 0.1 μM or PIO 1 μM for 14 days. The media were changed every 3 days. For the 24 h prior to harvesting, the medium of each well was changed to 2 ml conditioned medium without FCS, and the medium was collected for ELISA analysis. The harvested cells were used to conduct ALP staining and activity measurement, reverse transcription-quantitative polymerase chain reaction (RT-qPCR) and western blotting.

Osteoclast differentiation

BMMCs were cultured in 96-well plates (Corning Incorporated) at a density of 5,000 cells/well in conditioned medium containing 50 ng/ml M-CSF and 50 ng/ml RANKL and were treated with DMSO, 0.1 μM PIO or 1 μM PIO. After 4 days, the cells were harvested and TRAP staining and activity measurement, and western blotting were conducted.

OPG and RANKL ELISA

OPG and RANKL levels in the medium of osteoblast differentiation were analyzed using a commercially available ELISA kit according to the manufacturer's protocols. Each sample was assessed 3 times.

ALP activity and TRAP activity measurement

For measurement of ALP activity, the harvested cells were washed with phosphate-buffered saline (PBS; Gibco; Thermo Fisher Scientific, Inc.) twice prior to the addition of lysis buffer [1.5 M Tris-HCl (pH 9.2), 0.1 M ZnCl2, 0.5 M MgCl2-6H2O, and Triton X-100; Wuhan Boster Biological Technology, Co., Ltd.], and the cells in each well were sonicated for 10 sec. The sonicated samples were added to a substrate solution containing 4-nitrophenyl phosphate (Sigma-Aldrich), 1.5 M alkaline buffer solution (Sigma-Aldrich) and H2O and incubated for 20 min at 37°C. Subsequently, 2 N NaOH was added to the samples to stop the reaction. Absorbance of the samples was measured at a wavelength of 405 nm using a microplate reader (Multiskan™ FC; Thermo Fisher Scientific, Inc.).

For measurement of TRAP activity, the harvested cells were fixed with 10% formalin (Sigma-Aldrich) for 10 min and 95% ethanol for 1 min, and then 100 μl of citrate buffer (50 mM; pH 4.6; Sigma-Aldrich) containing 10 mM sodium tartrate (Sigma-Aldrich) and 5 mM p-nitrophenylphosphate (Sigma-Aldrich) was added to the wells containing fixed cells in the plates. Following incubation for 1 h, enzyme reaction mixtures in the wells were transferred to new plates containing an equal volume of 0.1 N NaOH. Absorbance was measured at a wavelength of 405 nm using a Multiskan™ FC. Each experiment was performed in triplicate.

Co-culture of BMMCs with MC3T3-E1 cells

Using a 6-well Transwell plate (Corning Incorporated), MC3T3-E1 cells were cultured in the lower layer at a density of 5×106 cells/well. After 24 h, the α-MEM medium was changed to α-MEM medium containing DMSO, 0.1 μM PIO or 1 μM PIO, and BMMCs were cultured in the upper layer of the Transwell plate at the density of 5,000 cells/well. The media was changed every 3 days. After 7 days, the cells in the upper layer were harvested to conduct TRAP staining.

RNA isolation and RT-qPCR analysis

Total RNA was isolated using TRIzol (Invitrogen; Thermo Fisher Scientific, Inc.). DNase I, RNase-free (#EN0521) and the RevertAid First Strand cDNA Synthesis kit (all from Thermo Fisher Scientific, Inc.) were used for reverse transcription. The reverse trancription reaction was conducted with total RNA, Oligo (dT)18 primers and nuclease-free water made up to a total volume of 12 μl. This mixture was then incubated at 65°C for 5 min, chilled on ice, spun down and placed back on ice. The 5× reaction buffer (4 μl), RiboLock RNase Inhibitor (1 μl), 10 mM dNTP Mix (2 μl), RevertAid M-MuLV RT (200 U/μl; 1 μl) were then added to a total volume of 20 μl, the mixture was mixed gently and centrifuged prior to incubation for 60 min at 42°C. For qPCR, Thermo Fisher Scientific, Inc. Maxima SYBR Green qPCR Master Mix (2×) Thermal cycling was conducted, which used a three-step cycling protocol: Pre-treatment at 50°C for 2 min, 1 cycle of 95°C for 10 min; 1 cycle of denaturation at 95°C for 15 sec; 40 cycles of annealing at 60°C for 30 sec and extension at 72°C for 30 sec. The forward and reverse primers were obtained from Invitrogen (Thermo Fisher Scientific, Inc.) and are presented in Table I. Data are presented as the mean ± standard deviation for at least three independent experiments. Gene expression analysis was performed using RT-qPCR (iCycler iQ5 System; Bio-Rad Laboratories, Inc., Hercules, CA, USA) and normalized to 18S RNA.

Table I

List of primers.

Table I

List of primers.

GenePrimerProduct sizeAccession no.
18SF: TTCGAACGTCTGCCCTATCAA  50M35283.1
R: ATGGTAGGCACGGGGACTA
PPARγF: GGAAGACCACTCGCATTCCTT121NM_001127330
R: GTAATCAGCAACCATTGGGTCA
RUNX2F: GACTGTGGTTACCGTCATGGC  84NM_001146038
R: ACTTGGTTTTTCATAACAGCGGA
ALPF: GCCTTACCAACTCTTTTGTGCC  61NM_007431
R: GCTTGCTGTCGCCAGTAAC
OCNF: CTGACCTCACAGATCCCAAGC187NM_031368
R: TGGTCTGATAGCTCGTCACAAG
RANKF: CCAGGAGAGGCATTATGAGCA  94AF019046.1
R: ACTGTCGGAGGTAGGAGTGC
Cathepsin KF: GAAGAAGACTCACCAGAAGCAG136NM_007802
R: CTGTATTCCCCGTTGTGTAGC
TRAPF: CACTCCCACCCTGAGATTTGT118NM_001102405
R: CATCGTCTGCACGGTTCTG

[i] Primers are listed in the 5′-3′ direction, and product lengths are presented with the units 'base pairs'. PARγ, peroxisome proliferator-activated receptor γ; RUNX2, Runt-related transcription factor 2; ALP, alkaline phosphatase; OCN, osteocalcin; RANK, receptor activator of nuclear factor-κB; TRAP, tartrate-resistant acid phosphatase; F, forward; R, reverse.

ALP and TRAP staining

Harvested cells were rinsed three times with PBS and fixed for 15 min in 4% paraformaldehyde (Wuhan Boster Biological Technology, Co., Ltd.) at 4°C. The cells were stained with ALP and TRAP using kits according to the manufacturer's protocols. The staining was analyzed using an OsteoMeasure system (Osteometrics, Inc., Atlanta, GA, USA) connected to a Axioskop microscope (Zeiss, Oberkochen, Germany).

Western blotting

Total cell lysates were obtained by lysing cells in radioimmunoprecipitation assay buffer (Wuhan Boster Biological Technology, Co., Ltd.) containing 50 mM Tris-HCl, 150 mM NaCl, 1% NP-40, 0.1% SDS, 0.5% sodium deoxycholate, 2 mM sodium fluoride, 1 mM EDTA, 1 mM EGTA and a protease inhibitor cocktail. Protein concentration was determined using a Pierce BCA protein assay kit (Thermo Fisher Scientific, Inc.). The proteins (20 μg) were separated by 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis, transferred to nitrocellulose membranes, blocked with bovine serum albumin (Wuhan Boster Biological Technology, Co., Ltd.) in Tris-buffered saline with 0.1% Tween-20 (TBST) for 1 h at room temperature, and incubated with primary antibodies (anti-OPG and anti-RANKL) overnight at 4°C. The membrane was washed three times with TBST and incubated with the horseradish peroxidase-conjugated secondary antibodies (BA1039; goat anti-rabbit monoclonal; 1:1,000; Wuhan Boster Biological Technology, Co., Ltd.) for 1 h at room temperature, then washed three further times with TBST. Protein detection was conducted with a Pierce enhanced chemiluminescence detection system (Thermo Fisher Scientific, Inc.). Densitometry was conducted using Quantity One software (Bio-Rad Laboratories, Inc.).

Statistical analysis

All data were presented as the mean ± standard deviation. Statistical analysis was performed using one-way analysis of variance with SPSS software, version 12.0 (SPSS, Inc., Chicago, IL, USA). P<0.05 was considered to indicate a statistically significant difference.

Results

PIO inhibits the differentiation of MC3T3-E1 cells into osteoblasts

To investigate the effect of PIO on osteoblast differentiation, MC3T3-E1 cells were cultured in osteoblastic differentiation media with or without PIO. ALP staining and ALP activity served as biomarkers of osteoblastic differentiation (Fig. 1). As presented in Fig. 1A and B, 1 μM PIO significantly reduced the number of ALP positive osteoblasts and ALP activity when compared with the control group (P<0.05). In addition, expression levels of osteoblastic genes, Runt-related transcription factor 2 (RUNX2) (P<0.01), ALP (P<0.05) and osteocalcin (OCN; P<0.05) were significantly decreased following treatment with 1 μM PIO (Fig. 1C). By contrast, PPARγ was significantly increased (P<0.05; Fig. 1C). No significant alterations were observed following 0.1 μM PIO treatment, apart from in RUNX2 expression.

Figure 1

In vitro analysis of the effect of pioglitazone on osteoblasts. (A) ALP staining of osteoblasts at different pioglitazone concentrations. (B) ALP activities of osteoblast, as a quantitative index. (C) The effect of pioglitazone on gene expression in osteoblasts as analyzed by reverse transcription-quantitative polymerase chain reaction. *P<0.05 vs. control; **P<0.01 vs. control. ALP, alkaline phosphatase; DMSO, dimethyl sulfoxide; PIO, pioglitazone; PPARγ, peroxisome proliferator-activated receptor γ; RUNX2, Runt-related transcription factor 2; OCN, osteocalcin.

PIO promotes the differentiation of BMMCs into osteoclasts

The effect of pioglitazone on osteoclast differentiation was investigated in BMMCs by culturing the cells in the presence of RANKL (50 ng/ml) and M-CSF (50 ng/ml) with or without PIO, and detecting the number of TRAP-positive cells and TRAP activity, which indicate the degree of osteoclast differentiation (Fig. 2). As presented in Fig. 2A, RANKL-mediated osteoclast differentiation was promoted by 1 μM PIO. The number of TRAP-positive cells (Fig. 2C and D) and TRAP activity (Fig. 2B) were significantly increased following treatment with 1 μM PIO. In addition, the gene expression levels of TRAP and cathepsin K, which indicate the function of osteoclasts, were significantly increased (P<0.05; Fig. 2E). Treatment with 0.1 μM PIO did not significantly affect the osteoclast differentiation of BMMCs.

Figure 2

In vitro analysis of pioglitazone effects on osteoclastogenesis. (A and B) Observation of TRAP-positive osteoclasts after 4 days of culture in the presence of macrophage-colony stimulating factor, receptor activator of nuclear factor-κB ligand and different concentrations of PIO. (C) TRAP activity in osteoclasts, as a quantitative index. (D) Counted number of TRAP-positive cells. (E) The effect of PIO on gene expression in osteoblasts was analyzed by reverse transcription-quantitative polymerase chain reaction. *P<0.05 vs. control; **P<0.01 vs. control. TRAP, tartrate-resistant acid phosphatase; DMSO, dimethyl sulfoxide; PIO, pioglitazone; CTSK, cathepsin K.

PIO decreases the OPG/RANKL ratio in osteoblasts

The MC3T3-E1 cells were treated with PIO or DMSO for 7 days, and the mRNA and protein expression levels of OPG and RANKL were analyzed using RT-qPCR and western blotting, respectively. As presented in Fig. 3, the 1 μM PIO group exhibited a significant decrease of the ratio of OPG/RANKL mRNA expression levels (P<0.05) due to decreased OPG and increased RANKL expression levels compared with the control group. Furthermore, the protein expression levels of OPG, RANKL and ratio of OPG to RANKL demonstrated the same trend of change as observed for the mRNA expression levels. The cells treated with 0.1 μM PIO demonstrated no significant difference compared with that of the control group.

Figure 3

Effects of PIO on the OPG/RANKL/RANK system on osteoblasts and osteoclasts. (A) Gene expression in osteoblasts and osteoclasts stimulated by PIO. (B) The effect of PIO on protein expression, OPG and RANKL, in osteoblast and analyzed by western blot. (C) The OPG and RANKL expression in osteoblast quantified. (D) The OPG/RANKL ratio in osteoblasts was decreased by PIO. *P<0.05 vs. control; **P<0.01 vs. control. PIO, pioglitazone; OPG, osteoprotegerin; RANKL, receptor activator of nuclear factor-κB ligand; DMSO, dimethyl sulfoxide.

PIO promotes osteoclastogenesis by modulating the osteoblast and osteoclast cross-talk

The OPG and RANKL expression levels in the osteoblast culture medium of MC3T3-E1 cells were detected by ELISA. Following PIO treatment, OPG expression levels decreased and RANKL expression levels increased, compared with DMSO-treated controls (Table II). Few TRAP positive cells were observed in BMMCs co-cultured with MC3T3-E1 cells without PIO treatment after 7 days (Fig. 4A). Following addition of PIO, an increased number of TRAP positive cells were observed (Fig. 4). Furthermore, the number of TRAP-positive cells among BMMCs in the PIO-treated co-culture system was significantly increased compared with BMMCs untreated with PIO (P<0.05; Fig. 4B). Notably, in these experiments, 0.1 μM PIO demonstrated the same effects as 1 μM pioglitazone, however, the difference was not statistically significant (Fig. 4A and B).

Figure 4

In the co-culture system, PIO was observed to increase osteoclastogenesis of monocytes by osteblasts. (A) Red arrows indicate TRAP-positive cells. PIO and molecules secreted by the osteoblasts increased the TRAP-positive cells compared with the control group. (B) The TRAP activity was detected in the upper layer of the co-culture system, the result demonstrates that the TRAP activity in the PIO groups was increased compared with the control group (*P<0.05). PIO, pioglitazone; TRAP, tartrate-resistant acid phosphatase.

Table II

The OPG and RANKL levels in osteoblast culture medium (detected by ELISA).

Table II

The OPG and RANKL levels in osteoblast culture medium (detected by ELISA).

GeneDMSO (n=3)PIO 0.1 μM (n=3)PIO 1 μM (n=3)
OPG (pg/ml)476.5±26.8431.6±26.18326.12±34.4a
RANKL (pg/ml)792.5±43.1 815.5±33.2  1265.1±79.2b

a P<0.05;

b P<0.01. OPG, osteoprotegerin; RANKL, receptor activator of nuclear factor-κB ligand; DMSO, dimethyl sulfoxide; PIO, piogli-tazone.

Discussion

Pioglitazone inhibited osteoblast differentiation and promoted osteoclast formation

As one of thiazolidinediones that are commonly prescribed for patients with diabetes, PIO is a PPARγ agonist, which may result in bone loss and an increased fracture rate in diabetic patients (2). The present study demonstrated that PIO inhibited osteoblast differentiation and promoted osteoclast formation directly, and enhanced osteoclastogenesis via the OPG/RANKL/RANK system, which is involved in paracrine regulation of osteoclastogenesis.

PIO negatively regulates osteoblast differentiation

Consistently with previous studies, the present study demonstrated that PIO inhibited osteoblastogenesis. Osteoblasts and adipocytes are commonly derived from mesenchymal stem cells (MSCs), and their differentiation is reliant on different stimulating signals. Activation of core binding factor-α1/RUNX2 results in osteoblast formation from MSCs, however, activation of PPARγ results in adipocyte formation (11,12). Competition exists between the differentiation of the two cell types, previous studies have shown that TDZs promote adipocytogenesis at expense of osteoblastogenesis (13–16). Furthermore, silencing PPARγ using synthetic small interfering RNA inhibited adipocyte differentiation and induced osteoblastic differentiation (17). However, the underlying mechanisms remain to be elucidated. In the present study, PIO was observed to upregulate PPARγ and downregulate RUNX2 in parallel with inhibition of osteoblastogenesis. Results from the current study support the findings of Jeon et al (18) that activation of PPARγ interfered with the transactivation ability of RUNX2 and suppressed its expression, thus resulting in the inhibition of OCN (an osteoblast-specific protein) expression. Furthermore, apoptosis of osteoblasts has been proven to be accelerated by TZDs. By contrast, Bruedigam et al (19) demonstrated that rosiglitazone promoted osteoblastogenesis and produced a large quantity of reactive oxygen species and increased apoptosis, which resulted in attenuation of osteoblastogenesis.

PIO increases osteoclastogenesis

Osteoclasts are derived from bone marrow hematopoietic stem cells, which may be stimulated to differentiate by RANKL signaling and PPARγ activation (20). TZDs have been reported to affect osteoclast differentiation, however, results from various previous studies are conflicting. Chan et al (21) demonstrated that ciglitazone, a TZD, suppressed multinucleated osteoclast formation in a dose-dependent manner. Furthermore, Cho et al (15) demonstrated that rosiglitazone attenuated osteoclast formation and bone resorption by preventing RANK and enhancing PPARγ2 expression in osteoclasts. By contrast, Wan et al (22) demonstrated that activation of PPARγ stimulated osteoclastogenesis and bone resorption, and deletion of PPARγ prevented osteoclast formation and resulted in osteopetrosis. Wu et al (23) also demonstrated that rosiglitazone markedly increased the differentiation of mice bone marrow cells into osteoclasts. In the present study, administration of exogenous RANKL and M-CSF, which are required for osteoclast differentiation, demonstrated that PIO exerts a direct effect on promoting differentiation of BMMCs into osteoclasts. Furthermore, contrary to results from Cho et al (15), the RANK expression levels in the cells remained unchanged, which indicated that this effect of PIO may involve PPARγ but not the RANKL-RANK response. Although c-Fos induction, TNF receptor-associated factor 6 and downstream extracellular signal-regulated kinase signaling, PPARγ coactivator 1β and estrogen-related receptor α have been reported to be associated with enhancement of PPARγ-mediated osteoclastogenesis (22,24), the underlying mechanisms remain to be elucidated.

PIO decreases the OPG/RANKL ratio in osteoblasts

The molecular OPG/RANKL/RANK axis participates in regulating bone metabolism, provides paracrine regulation for osteoclastogenesis (25). RANKL, expressed and secreted by osteoblasts, binds the extracellular RANK domain of pre-osteoclasts, and results in expression of specific genes involved in osteoclast differentiation and bone resorption (26). Furthermore, OPG, secreted by osteoblasts, acts as a soluble receptor antagonist for RANKL, to prevent it binding to RANK and decreases osteoclastogenesis (6). Thus, the OPG/RANKL ratio and the expression of RANK in pre-osteoclasts are key in osteoclastogenesis (6,7). However, studies concerning the effect of TZDs on this paracrine regulation are rare.

In the present study, it was observed that the OPG/RANKL ratio decreased, due to a decreased OPG expression level and an elevated RANKL expression level, in osteoblasts in response to treatment with PIO. Furthermore, the expression levels of RANK remained unchanged following PIO treatment. Thus, the results of the present study suggest, in addition to the direct effect, PIO may positively regulate osteoclastogenesis via influencing the OPG/RANKL/RANK axis in the co-culture system mimicking the in vivo bone marrow microenvironment. Consistent with these findings, Lazarenko et al (27) demonstrated that PPARγ activation in osteoblasts promotes osteoclast differentiation by inducing the expression of RANKL. Previous in vitro and in vivo studies have demonstrated that TZD treatment lowers OPG levels (28–30). Contrary to results in the present study, Cho et al (15) demonstrated that rosiglitazone inhibited the RANK protein expression in monocytes induced by RANKL. This difference may be attributed to the higher dose of TZD used. In future experiments a larger range of doses of TZDs should be evaluated.

In conclusion, the present study demonstrates that PIO suppresses osteoblastogenesis and enhances osteoclastogenesis directly. It also decreases the OPG/RANKL ratio in osteoblasts, to promote osteoclast formation via a paracrine mechanism.

Acknowledgments

The present study was supported by the National Natural Sciences Research Program of China (grant no. 81070691).

References

1 

Derosa G: Efficacy and tolerability of pioglitazone in patients with type 2 diabetes mellitus: Comparison with other oral antihyperglycaemic agents. Drugs. 70:1945–1961. 2010. View Article : Google Scholar : PubMed/NCBI

2 

McDonough AK, Rosenthal RS, Cao X and Saag KG: The effect of thiazolidinediones on BMD and osteoporosis. Nat Clin Pract Endocrinol Metab. 4:507–513. 2008. View Article : Google Scholar : PubMed/NCBI

3 

Montagnani A and Gonnelli S: Antidiabetic therapy effects on bone metabolism and fracture risk. Diabetes Obes Metab. 15:784–791. 2013. View Article : Google Scholar : PubMed/NCBI

4 

Raggatt LJ and Partridge NC: Cellular and molecular mechanisms of bone remodeling. J Biol Chem. 285:25103–25108. 2010. View Article : Google Scholar : PubMed/NCBI

5 

Lazner F, Gowen M, Pavasovic D and Kola I: Osteopetrosis and osteoporosis: Two sides of the same coin. Hum Mol Genet. 8:1839–1846. 1999. View Article : Google Scholar : PubMed/NCBI

6 

Khosla S: Minireview: The OPG/RANKL/RANK system. Endocrinology. 142:5050–5055. 2001. View Article : Google Scholar : PubMed/NCBI

7 

Eriksen EF: Cellular mechanisms of bone remodeling. Rev Endocr Metab Disord. 11:219–227. 2010. View Article : Google Scholar : PubMed/NCBI

8 

Lehmann JM, Moore LB, Smith-Oliver TA, Wilkison WO, Willson TM and Kliewer SA: An antidiabetic thiazolidinedione is a high affinity ligand for peroxisome proliferator-activated receptor gamma (PPAR gamma). J Biol Chem. 270:12953–12956. 1995. View Article : Google Scholar : PubMed/NCBI

9 

Tontonoz P, Hu E and Spiegelman BM: Stimulation of adipogenesis in fibroblasts by PPAR gamma 2, a lipid-activated transcription factor. Cell. 79:1147–1156. 1994. View Article : Google Scholar : PubMed/NCBI

10 

MacDougald OA and Lane MD: Transcriptional regulation of gene expression during adipocyte differentiation. Annu Rev Biochem. 64:345–373. 1995. View Article : Google Scholar : PubMed/NCBI

11 

Gimble JM, Robinson CE, Wu X, Kelly KA, Rodriguez BR, Kliewer SA, Lehmann JM and Morris DC: Peroxisome proliferator-activated receptor-gamma activation by thiazolidinediones induces adipogenesis in bone marrow stromal cells. Mol Pharmacol. 50:1087–1094. 1996.PubMed/NCBI

12 

Mabilleau G, Chappard D and Baslé MF: Cellular and molecular effects of thiazolidinediones on bone cells: A review. Int J Biochem Mol Biol. 2:240–246. 2011.PubMed/NCBI

13 

Wang L, Li L, Gao H and Li Y: Effect of pioglitazone on transdifferentiation of preosteoblasts from rat bone mesenchymal stem cells into adipocytes. J Huazhong Univ Sci Technolog Med Sci. 32:530–533. 2012. View Article : Google Scholar : PubMed/NCBI

14 

Liu L, Aronson J and Lecka-Czernik B: Rosiglitazone disrupts endosteal bone formation during distraction osteogenesis by local adipocytic infiltration. Bone. 52:247–258. 2013. View Article : Google Scholar

15 

Cho ES, Kim MK, Son YO, Lee KS, Park SM and Lee JC: The effects of rosiglitazone on osteoblastic differentiation, osteoclast formation and bone resorption. Mol Cells. 33:173–181. 2012. View Article : Google Scholar : PubMed/NCBI

16 

Viccica G, Francucci CM and Marcocci C: The role of PPARγ for the osteoblastic differentiation. J Endocrinol Invest. 33(Suppl 7): S9–S12. 2010.

17 

Yamashita A, Takada T, Nemoto K, Yamamoto G and Torii R: Transient suppression of PPARgamma directed ES cells into an osteoblastic lineage. FEBS Lett. 580:4121–4125. 2006. View Article : Google Scholar : PubMed/NCBI

18 

Jeon MJ, Kim JA, Kwon SH, Kim SW, Park KS, Park SW, Kim SY and Shin CS: Activation of peroxisome proliferator-activated receptor-gamma inhibits the Runx2-mediated transcription of osteocalcin in osteoblasts. J Biol Chem. 278:23270–23277. 2003. View Article : Google Scholar : PubMed/NCBI

19 

Bruedigam C, Eijken M, Koedam M, van de Peppel J, Drabek K, Chiba H and van Leeuwen JP: A new concept underlying stem cell lineage skewing that explains the detrimental effects of thiazolidinediones on bone. Stem Cells. 28:916–927. 2010.PubMed/NCBI

20 

Teitelbaum SL and Ross FP: Genetic regulation of osteoclast development and function. Nat Rev Genet. 4:638–649. 2003. View Article : Google Scholar : PubMed/NCBI

21 

Chan BY, Gartland A, Wilson PJ, Buckley KA, Dillon JP, Fraser WD and Gallagher JA: PPAR agonists modulate human osteoclast formation and activity in vitro. Bone. 40:149–159. 2007. View Article : Google Scholar

22 

Wan Y, Chong LW and Evans RM: PPAR-gamma regulates osteoclastogenesis in mice. Nat Med. 13:1496–1503. 2007. View Article : Google Scholar : PubMed/NCBI

23 

Wu H, Li L, Ma Y, Chen Y, Zhao J, Lu Y and Shen P: Regulation of selective PPARγ modulators in the differentiation of osteoclasts. J Cell Biochem. 114:1969–1977. 2013. View Article : Google Scholar : PubMed/NCBI

24 

Wei W, Wang X, Yang M, Smith LC, Dechow PC, Sonoda J, Evans RM and Wan Y: PGC1beta mediates PPARgamma activation of osteoclastogenesis and rosiglitazone-induced bone loss. Cell Metab. 11:503–516. 2010. View Article : Google Scholar : PubMed/NCBI

25 

Hofbauer LC, Khosla S, Dunstan CR, Lacey DL, Boyle WJ and Riggs BL: The roles of osteoprotegerin and osteoprotegerin ligand in the paracrine regulation of bone resorption. J Bone Miner Res. 15:2–12. 2000. View Article : Google Scholar : PubMed/NCBI

26 

Muruganandan S, Roman AA and Sinal CJ: Adipocyte differentiation of bone marrow-derived mesenchymal stem cells: Cross talk with the osteoblastogenic program. Cell Mol Life Sci. 66:236–253. 2009. View Article : Google Scholar

27 

Lazarenko OP, Rzonca SO, Hogue WR, Swain FL, Suva LJ and Lecka-Czernik B: Rosiglitazone induces decreases in bone mass and strength that are reminiscent of aged bone. Endocrinology. 148:2669–2680. 2007. View Article : Google Scholar : PubMed/NCBI

28 

Park JS, Cho MH, Nam JS, Yoo JS, Ahn CW, Cha BS, Kim KR and Lee HC: Effect of pioglitazone on serum concentrations of osteoprotegerin in patients with type 2 diabetes mellitus. Eur J Endocrinol. 164:69–74. 2011. View Article : Google Scholar

29 

Sultan A, Avignon A, Galtier F, Piot C, Mariano-Goulart D, Dupuy AM and Cristol JP: Osteoprotegerin, thiazolidinediones treatment and silent myocardial ischemia in type 2 diabetic patients. Diabetes Care. 31:593–595. 2008. View Article : Google Scholar

30 

Krause U, Harris S, Green A, Ylostalo J, Zeitouni S, Lee N and Gregory CA: Pharmaceutical modulation of canonical Wnt signaling in multipotent stromal cells for improved osteoinductive therapy. Proc Natl Acad Sci USA. 107:4147–4152. 2010. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Xu F, Dong Y, Huang X, Chen P, Guo F, Chen A and Huang S: Pioglitazone affects the OPG/RANKL/RANK system and increase osteoclastogenesis. Mol Med Rep 14: 2289-2296, 2016.
APA
Xu, F., Dong, Y., Huang, X., Chen, P., Guo, F., Chen, A., & Huang, S. (2016). Pioglitazone affects the OPG/RANKL/RANK system and increase osteoclastogenesis. Molecular Medicine Reports, 14, 2289-2296. https://doi.org/10.3892/mmr.2016.5515
MLA
Xu, F., Dong, Y., Huang, X., Chen, P., Guo, F., Chen, A., Huang, S."Pioglitazone affects the OPG/RANKL/RANK system and increase osteoclastogenesis". Molecular Medicine Reports 14.3 (2016): 2289-2296.
Chicago
Xu, F., Dong, Y., Huang, X., Chen, P., Guo, F., Chen, A., Huang, S."Pioglitazone affects the OPG/RANKL/RANK system and increase osteoclastogenesis". Molecular Medicine Reports 14, no. 3 (2016): 2289-2296. https://doi.org/10.3892/mmr.2016.5515
Copy and paste a formatted citation
x
Spandidos Publications style
Xu F, Dong Y, Huang X, Chen P, Guo F, Chen A and Huang S: Pioglitazone affects the OPG/RANKL/RANK system and increase osteoclastogenesis. Mol Med Rep 14: 2289-2296, 2016.
APA
Xu, F., Dong, Y., Huang, X., Chen, P., Guo, F., Chen, A., & Huang, S. (2016). Pioglitazone affects the OPG/RANKL/RANK system and increase osteoclastogenesis. Molecular Medicine Reports, 14, 2289-2296. https://doi.org/10.3892/mmr.2016.5515
MLA
Xu, F., Dong, Y., Huang, X., Chen, P., Guo, F., Chen, A., Huang, S."Pioglitazone affects the OPG/RANKL/RANK system and increase osteoclastogenesis". Molecular Medicine Reports 14.3 (2016): 2289-2296.
Chicago
Xu, F., Dong, Y., Huang, X., Chen, P., Guo, F., Chen, A., Huang, S."Pioglitazone affects the OPG/RANKL/RANK system and increase osteoclastogenesis". Molecular Medicine Reports 14, no. 3 (2016): 2289-2296. https://doi.org/10.3892/mmr.2016.5515
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team