Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Molecular Medicine Reports
Join Editorial Board Propose a Special Issue
Print ISSN: 1791-2997 Online ISSN: 1791-3004
Journal Cover
December-2017 Volume 16 Issue 6

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
December-2017 Volume 16 Issue 6

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Case Report Open Access

Gene screening facilitates diagnosis of complicated symptoms: A case report

  • Authors:
    • Hong Duan
    • Di Zhang
    • Jing Cheng
    • Yu Lu
    • Huijun Yuan
  • View Affiliations / Copyright

    Affiliations: Department of Surgery, Institute of Otolaryngology, Chinese PLA General Hospital, Beijing 100853, P.R. China
    Copyright: © Duan et al. This is an open access article distributed under the terms of Creative Commons Attribution License.
  • Pages: 7915-7922
    |
    Published online on: September 22, 2017
       https://doi.org/10.3892/mmr.2017.7590
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

Gene mutation has an important role in disease pathogenesis; therefore, genetic screening is a useful tool for diagnosis. The present study screened pathogenic genes, ectodysplasin A (EDA) and lamin A/C (LMNA), in a patient with suspected syndromic hearing impairment and various other symptoms including tooth and skin abnormalities. Large‑scale sequencing of 438 deafness‑associated genes and whole‑genome sequencing was also performed. The present findings did not identify copy number variation and mutations in EDA; therefore, excluding the possibility of EDA‑initiated ectodermal dysplasia syndrome. A synonymous mutation in LMNA, possibly due to a splicing abnormality, did not elucidate the pathogenesis of Hutchinson‑Gilford progeria syndrome. Whole‑genome sequencing revealed copy number variations or mutations in various candidate genes which may elucidate part of the symptoms observed. The copy number variations and mutations were also used to identify single nucleotide variations (SNVs) in crystallin mu (CRYM), RAB3 GTPase activating protein catalytic subunit 1 (RAB3GAP1) and Wnt family member 10A (WNT10A), implicated in deafness, hypogonadism and tooth/skin abnormalities, respectively. The importance of an existing SNV in CRYM and a novel SNV in RAB3GAP1 in pathogenesis remains to be further elucidated. The WNT10A p.G213S mutation was confirmed to be the etiological cause of tooth agenesis and ectodermal dysplasia as previously described. It was concluded that a mutation in WNT10A may be the reason for some of the symptoms observed in the patient; however, other genes may also be involved for other symptoms. The findings of the present study provide putative gene mutations that require further investigation in order to determine their roles in pathogenesis.

Introduction

Among 278 million suffering from deafness worldwide, half are induced by hereditary factors, with 200 to 300 genes having been identified (1). Based on the presence of other symptoms, hearing impairment may be divided into syndromic (SHL, ~30%) and nonsyndromic hearing loss (NSHL) (2,3). SHL has >400 types of symptoms in the skin, outer ears, eyes and endocrine metabolism. The present study examined a Chinese patient originally suspected to have certain types of SHL. The proband exhibited deafness along with various additional symptoms, including dry loose skin, tooth decay and hypotonia. These phenotypes partially conform to the symptoms of some diseases and syndromes, such as Hutchinson-Gilford progeria syndrome (HGPS) and congenital ectodermal dysplasia syndrome (4–7). HGPS is a rare syndrome characterized by slow growth, prominent eyes, protruding ears, a small chin, hair loss, ageing skin and loss of subcutaneous fat tissue. (8,9) Generally, patients were born normal; however, ageing occurs rapidly, leading to alterations in various organs (10). Some of the proband's symptoms also fall within those of ectodermal dysplasia syndrome (skin and tooth abnormality), whereas other diseases are also possible due to the multiple symptoms of the patient, such as hypogonadism. Genetically, HGPS occurs due to an autosomal dominant inheritance of a mutant lamin A/C (LMNA) gene (11). Ectodermal dysplasia syndrome is attributed to copy number variations (CNVs) or mutations in ectodysplasin A (EDA) gene family members, including EDA, EDA receptor (EDAR) and EDAR-associated death domain. (12,13) Therefore, genetic screening is of the utmost importance for diagnosis and treatment.

Given the possibility of HGPS and ectodermal dysplasia syndromes for the patient, sequencing of LMNA exons was performed, followed by CNV examination of EDA gene family members; however, no pathogenic clues were identified. Subsequently, 438 deafness-associated genes were sequenced, in order to identify if these mutations in these genes are associated with the patient's phenotypes. Whole-genome sequencing (WGS) was performed in order to identify potential pathogenic genes that may account for the symptoms observed. The obtained gene list with CNVs or single nucleotide variations (SNVs) was compared with the Human/Mouse Disease Connection database, other SNV-related databases and previous studies in order to identify potential candidate genes. Multiple genes were selected for further analysis.

Case report

Patient, ethics, consent and permission

Clinical information about the patient, aged 4, male, and the parents was collected in June 2014, followed by a systemic health check up, under signed informed consent forms to participate and publish the data in accordance with the Ethics Committee of the Chinese PLA General Hospital (Beijing, China). Peripheral blood (5 ml) was collected for genomic DNA (gDNA) isolation.

Sequencing of the HGPS-associated LMNA gene

Primers were based on the NCBI reference sequence of LMNA (Genbank, NM_001282625) and were designed by Shanghai Genesky Biotech Co., Ltd. (Shanghai, China) to amplify exons with ~50 bp of flanking introns. Primer sequences are presented in Table I. Polymerase chain reaction (PCR) products were purified for sequencing. PCR was performed by Shanghai Genesky Biotech Co., Ltd.

Table I.

Amplification primers of LMNA gene.

Table I.

Amplification primers of LMNA gene.

ExonsForward (5′-3′)Reverse (5′-3′)Length (bp)
1 CCAGGAGCAAGCCGAGAG ACAATTCCCCTTGACACTGC990
2 GGATGCCCTCTCCTGGTAAT GGCTCTGAAATCAGGTGACAG700
3 CCTGGACCTGTTTCCACAT TAACCTGGGAGCTGAGTGCT680
4 CCTAGTGGACAGGGAGTTGG CCTGAGTTGGGCATCACTG640
5 TAGCAGTGATGCCCAACTCA GCCATCTGACTCCACATCCT640
6,7 CTCTGGGGAAGCTCTGATTG TCTCACAGCCAAAGAGTCCA1,130
8,9 CAGGGGTGTGTGTAGATGGA GTTTGCCTACTGGGTGGAGA860
10 AAGTTGCAGGTGGTCACTGG GAAAGTTCCCACTCCCTTCC600
11 GCACAGAACCACACCTTCCT GGTGGGCTGTCTAGGACTCA800
12 CATCCTGCCCCTCTTGTCT TTTTGCTTGTGTTTTTCCTTCA520
Multiplex ligation-dependent probe amplification (MLPA) for EDA testing

MLPA was used for genetic testing of EDA using P183 kit according to the manufacturer's instructions (MRC-Holland, Amsterdam, Netherlands). DNA was denatured and hybridized with SALSA probe mix, followed by ligation and polymerase chain reaction amplification. Capillary electrophoresis was performed to generate fragment length and peak area using Genemapper software, version 3.0 (Thermo Fisher Scientific, Inc., Waltham, MA, USA). Copy number ratio was denoted as peak area ratio of patient vs. references. A ratio between 0.7 and 1.3 indicated a normal individual, whereas the subject may be diagnosed with ectodermal dysplasia syndrome when the value falls between 1.7 and 2.3. Tests were repeated when the value was near the aforementioned boundaries.

Sequencing of hearing impairment-associated genes

A total of 2 µg gDNA was sheared with NEBNext® dsDNA Fragmentase (New England Biolabs, Inc., Ipswich, MA, USA) and end repaired with DNA End Repair Mix (Thermo Fisher Scientific, Inc.), followed by 3′-end adenylation (A-tailing kit; Generay Biotech Co., Ltd., Shanghai, China) and adaptor ligation (NEBNext® Multiplex Oligos for Illumina®; New England BioLabs, Inc.) according to the respective manufacturer's instructions. PCR was performed with a primer cocktail using NEBNext® Ultra™ II DNA Library Prep kit (New England BioLabs, Inc.), followed by purification. The thermocycling conditions were as follows: 98°C for 30 sec, 10 cycles of 98°C for 10 sec, 60°C for 30 sec and 72°C for 30 sec, followed by 72°C for 5 min. Subsequently, the library was pooled, hybridized and purified prior to another round of PCR amplification with the same thermocycling conditions as the ones stated above. Finally, samples were mounted on the Illumina HiSeq 2000 loading unit for sequencing.

WGS procedure

WGS was performed using Illumina TruSeq Nano DNA HT Sample prep kit (Illumina, Inc., San Diego, CA, USA) and HiSeq X system (Illumina, Inc.), according to the manufacturer's protocol. For CNV analysis, sequences of 6 unrelated individuals were used as references. For SNV analysis, the criteria for gene selection were as follows: i) Existing mutations in HGMD; ii) conservation analysis; iii) frequency <0.001 in 1,000 genomes or <0.01 in its own genome; iv) frequency in ESP6500 <0.01; v) single nucleotide polymorphism (SNP) calling quality not L (L meaning that the SNP cannot be called by either the GAKT or varscan programs), and the ratio of genotyping quality L <50%; vi) homology is 1; and vii) zero occurrence in the Genesky database. SNP calling was performed using Genome Analysis Toolkit (version 3.7, Broad Institute; software.broadinstitute.org/gatk) and VarScan (version 2.4.0; Genome Institute at Washington University; genome.wustl.edu). An SNP was labeled as ‘H’ if it was identified by both programs, whereas the quality was ‘M’ when it was detected by only one. The quality was further downgraded if there were short tandem repeats, indel or homologous sequences flanking the SNP. SNPs labeled as ‘H’ were selected in priority. The overall quality of SNP genotyping was ‘L’ or ‘M’; therefore, if one sample was graded as ‘L’ or ‘M’ those graded as ‘L’ were selected. Genes with sorting intolerant from tolerant (SIFT) values <0.05 were selected, as SIFT values indicate the impact of the mutation on protein functions. Additionally, sites with mutation taster scores have a higher probability of mutation. The original gene list was narrowed down according to the aforementioned criteria and genes associated with hearing impairment and HGPS were selected as priority. The list of genes carrying CNV or SNV was matched with the patient's symptoms, including progeria, either in the gene list or the Human-Mouse Disease Connection database (www.informatics.jax.org/mgihome/homepages/humanDisease.shtml). Genes of interest were selected for further analysis. An extensive search in existing literature was performed for the refined genes, in order to identify whether the detected mutations in the current patient had been reported to be the pathogenic cause of the phenotypes observed.

Clinical check up of the family

The patient exhibited ageing skin loosening following birth, with limited skin elasticity and subcutaneous fat storage. He exhibited progeroid symptoms without age pigment deposition. Facial skin loosening was moderate; however, there was abnormal development in hair and teeth, with evident tooth decay. The patient had slow reaction to external forces and low muscle tension; however, no abnormality in eyesight, intelligence and overall skeletal development (no bone integration or bone loss) was observed. Additionally, no obvious abnormalities were detected in the nervous system check up. However, the development of the gonads was limited (Fig. 1).

Figure 1.

Systemic check up of the patients revealed (A and B) ageing symptoms in the skin, (C) undescended testes and (D) falling off of teeth.

The patient was not treated after birth. At age 1, the child was diagnosed with severe deafness. No abnormality was observed in skull/temporal bone computed tomography and skull/internal auditory canal magnetic resonance imaging scan prior to artificial cochlea implantation. The patient exhibited high aminotransferase levels; however, no chromosomal abnormality was identified. Following artificial cochlea implantation in 2013, hearing and skin resilience improved. His parents and sister were also examined and were determined to be in healthy condition. The patient was initially suspected to be deaf and have HGPS; therefore, genetic screening was used for diagnosis.

LMNA gene mutation

No mutation was identified in the exons of the HGPS-associated gene LMNA. Exon sequencing of LMNA for the patient and his parents revealed no mutation of LMNA in the family.

MLPA analysis excluded EDA syndrome

EDA peaks for the patient and reference samples are presented in the MLPA histogram of Fig. 2 along with their ratios. Copy number ratios were ~1, suggesting no change in copy number. Therefore, ectodermal dysplasia syndrome due to dysfunction of EDA was excluded for this patient.

Figure 2.

Multiplex ligation-dependent probe amplification analysis of ectodermal dysplasia-associated genes. DNA was denatured and hybridized with SALSA probe mix, followed by ligation and polymerase chain reaction amplification. Capillary electrophoresis was performed to generate fragment length and peak area using GeneMapper version 3.0 software. Copy number ratio is denoted as the ratio of peak area of patient vs. peak area of references. Blue color peaks represent the patient sample, whereas the red color peaks were reference.

Mutations of deafness-associated genes

Mono-allelic heterozygous mutations were identified in some genes, including coenzyme Q6 monooxygenase, FGFR3, melanogenesis associated transcription factor (MITF), otoferlin, DNA polymerase γ catalytic subunit (POLG) and usherin (USH2A). Mutation of these genes may contribute to other unrelated symptoms. For instance, a POLG mutation may lead to a mitochondrial DNA depletion syndrome, which is characterized by tubulopathy, seizures, respiratory distress, diarrhea and lactic acidosis, which were inconsistent with the majority of the phenotypes observed in the proband. Mutations in some of these genes were also revealed in WGS, and therefore will be discussed further in the following section.

WGS revealed multiple genes that may account for specific symptoms

WGS identified CNV and SNV. From the CNV analysis, 2,653 genes were determined to have half or less copy numbers. Conversely, the remaining 720 genes had copy numbers ~2. For the SNV analysis, WGS confirmed the mutations of the aforementioned deafness-associated gene sequencing. Additionally, a full list of genes with autosomal dominant and recessive inheritance patterns were identified.

The genes of interest were identified by searching the lists against the symptoms. Briefly, their mutations were checked in the literature to see what symptoms they may cause. They were categorized according to the phenotypes of the patient in Table II. Some of these genes or their SNVs have been well-characterized and have been identified to be responsible for various diseases. For instance, USH2A and CDH23 were determined to be involved in the pathogenesis of Usher syndrome (14,15). However, none of the identified genes were capable of simultaneously explaining the majority of the symptoms present in the proband, suggesting that the disease may not be attributed to a monogene and multiple genetic lesions may cooperatively contribute to the presentations in the patient. Additionally, the exact SNVs in a number of the listed genes were never reported to be pathogenic in any of the literature, let alone the symptoms presented by the proband in our study. In some cases, the diseases associated with the genes were reported to present major symptoms that were not observed in the present case, such as the Donnai-Barrow syndrome which occurs due to LRP2 mutation (16). Therefore, the majority of the listed genes were filtered out and only SNVs in the LMNA, DNA polymerase δ 1, catalytic subunit (POLD1), crystallin mu (CRYM), RAB3 GTPase activating protein catalytic subunit 1 (RAB3GAP1) and Wnt family member 10A (WNT10A) genes were further discussed.

Table II.

Patient phenotypes, associated genes, mutations and diseases attributed to alterations in the genes.

Table II.

Patient phenotypes, associated genes, mutations and diseases attributed to alterations in the genes.

A, Aging/progeria

Gene nameDiseaseRefSeq mRNACNV/SNV
LRP1NANM_002332 c.12161A>T:p.Y4054F
EDNRAMandibulofacial dysostosis with alopeciaNM_001166055 c.503T>C:p.L168P
POLGMitochondrial DNA depletion syndromeNM_001126131 c.1840T>C:p.Y614H
SREBF1NANM_001005291 c.547G>A:p.A183T
CANXNANM_001024649 c.418C>A:p.L140M
BAK1NANM_001188Splicing
POLD1Mandibular hypoplasia, deafness, progeroid features and lipodystrophy syndromeNM_001256849 c.1932C>G:p.D644E
LRP2Donnai-barrow syndromeNM_004525CNV ratio=0.54
CISD2Wolfram syndromeNM_001008388CNV ratio=2.03
VCAM1NANM_001078CNV ratio=0.52
CASP7NANM_033338CNV ratio=0.52
SLC18A2NANM_003054CNV ratio=0.60
IL15NANM_000585CNV ratio=0.60
ADH5NANM_000671CNV ratio=0.58
SLC6A3NANM_001044CNV ratio=0.53
HMGCRNANM_000859CNV ratio=0.58
DLDNANM_000108CNV ratio=0.58
DDCNANM_001082971CNV ratio=0.59
MSRANANM_001135670CNV ratio=1.84
GSNNANM_000177CNV ratio=0.52
MLIPNANM_001281746CNV ratio=0.54

B, Deafness

Gene nameDiseaseRefSeq mRNACNV/SNV

USH2AUsher syndrome IINM_206933 c.5608C>T:p.R1870W c.9340C>T:p.P3114S
CDH23Usher syndromeNM_022124 c.5418C>G:p.D1806E
CRYM NM_001888.4Splicing
COQ6Nephrotic syndromeNM_182476 c.186C>A:p.D62E
FBXO2NANM_012168Splicing
STRCNANM_153700 c.179T>C:p.F60S
VPS13BCohen syndromeNM_152564 c.11884C>G:p.P3962A
OTOF NM_194248 c.2123G>A:p.R708Q
CISD2Wolfram syndrome CNV ratio=2.03
LRP2Donnai-barrow syndromeNM_004525CNV ratio=0.54
SMCHD1Facioscapulohumeal muscular dystrophyNM_015295 c.4071T>G:p.I1357M
POLD1Mandibular hypoplasia, deafness, ProgeroidNM_001256849 c.1932C>G:p.D644E
features, and lipodystrophy syndromeNM_001256849 c.1932C>G:p.D644E
POLGMitochondrial DNA depletion syndromeNM_001126131 c.1840T>C:p.Y614H

C, Hypogonadism

Gene nameDiseaseRefSeq mRNACNV/SNV

RAB3GAPWarburg syndrome, martsolf syndromeNM_012233 c.1175G>A:p.R392Q
MITFWarburg syndromeNM_198158 c.1235C>T:p.T412I
MAGEL2Prader-willi syndromeNM_019066 c.1425_1445del:p.475_482del
KISS1 NM_002256 c.417delA:p.X139W
NRP2 NM_201266 c.1333A>C:p.I445L
CISD2Wolfram syndromeNM_001008388CNV ratio=2.031485778
POLD1Mandibular hypoplasia, deafness, progeroid features and lipodystrophy syndromeNM_001256849 c.1932C>G:p.D644E
Fras1Fraser syndromeNM_025074CNV ratio=0.59
NM_025074 c.9356A>G:p.N3119S

D, Hypotonia

Gene nameDiseaseRefSeq mRNACNV/SNV

MAGEL2Prader-willi syndromeNM_019066 c.1425_1445del:p.475_482del
POLGMitochondrial DNA depletion syndromeNM_001126131 c.1840T>C:p.Y614H
SMCHD1Facioscapulohumeral muscular dystrophyNM_015295 c.4071T>G:p.I1357M

E, Tooth development

Gene nameDiseaseRefSeq mRNACNV/SNV

EDNRAMandibulofacial dysostosis with alopeciaNM_001166055 c.503T>C:p.L168P
POLD1Mandibular hypoplasia, deafness, progeroid features and lipodystrophy syndromeNM_001256849 c.1932C>G:p.D644E
WNT10A Odonto-onycho-dermal dysplasiaNM_025216 c.637G>A:p.G213S

[i] Genes in italics were associated with >1 symptom. NA, no definite disease is reported to be linked to the gene mutation.

Discussion

The proband exhibited multiple symptoms, including deafness, ageing and hypogonadism, which partially conform to the symptoms of HGPS and ectodermal dysplasia syndrome. HGPS is a rare hereditary disease which occurs due to autosomal dominant inheritance of mutant LMNA, the product of which promotes nuclear membrane deformation and reduces cellular lifespan (17). Previous studies identified the following pathogenic mutations c.1824C>T (p.Gly608Gly), c.1822G>A (p.Gly608Ser), c.1821G>A (p.Val607Val), c.1968+1G>A (18,19). Pathogenic mutations such as c.1824C>T (p.Gly608Gly), do not alter the amino acid sequence; however, they activate a hidden cleavage site, which leads to the deletion of 50 amino acids in the resulting protein (20,21). The present study also identified a synonymous SNV of c.1698C>T, p.His566His (chr1:156107534, NM_001282626, rs4641) at the splice region. However, the allele frequency carrying this SNV is 26.55% according to ExAC Browser database; therefore, excluding the possibility of rare HGPS in the current patient.

Another gene of interest is POLD1, the defects of which (serine 605 loss or R507C substitution at exon 13) lead to loss of δ DNA polymerase activity and impairment of proof-reading exonuclease activity (22–24). This may lead to mandibular dysplasia with deafness and progeroid features (MDP), which is characterized by lipodystrophy, deafness, a small lower jaw, low testosterone levels, claw toes, joint stiffness and hypogonadism (25). However, the nonsynonymous SNV detected in this patient is 1932C>G at exon 16 in POLD1 gene (rs80214209), which has been reported in >90 individuals, particularly in East Asia according to ExAC Browser database. Given that the MDP syndrome is an extremely rare syndrome with only 5 reported cases exhibiting a different POLD1 SNV (24), it is unlikely that the SNV in POLD1 observed in the present study leads to MDP syndrome. The molecular pathogenesis that results in progeria-like features remains to be further elucidated.

Ectodermal dysplasia syndrome occurs partially due to mutations and CNVs in EDAs (12,13). The protein products of these genes participate in signaling pathways that regulate interactions between the ectoderm and mesoderm, critical for the formation of skin, hair, teeth and sweat glands. However, no CNV or SNV were detected in the EDAs; therefore, this case is unlikely to be EDA-caused ectodermal dysplasia. However, it is possible that ectodermal dysplasia may be induced by other gene mutations; for example, c.637G>A, p.G213S of WNT10A.

Deafness may be induced by mutations in multiple genes, such as USH2A, CDH23 as listed in Table II. A dominant splicing alteration (rs189371585) in the CRYM gene was identified as a candidate etiological gene for deafness, with an allele frequency of 0.46% in the 1,000 genome phase 1 population according to the SNP database (dbSNP). Alterations of CRYM (X315Y and K314T) have been determined to lead to autosomal dominant NSHL (26–28). However, the pathogenic changes previously observed occurred due to an amino acid substitution (26), whereas the present case exhibited alterations in splicing. At present, no existing literature is available to link this alteration to any pathogenic consequences. Further functional analysis is required to confirm the biological effects of this splicing mutation.

Mutations in several genes may give rise to hypogonadism, including MITF and KiSS-1 metastasis-suppressor. Additionally, diseases associated with mutations in RAB3GAP1 include Warburg Micro syndrome and Martsolf syndrome (29–33). Leiden open source variation database archived nonsense mutations at c.1174 that led to the production of truncated protein terminating at p.R392 and contributed to Warburg Micro Syndrome. The novel SNV of c.1175G>A in RAB3GAP1 identified in the present study led to a p.R392Q amino acid substitution. Albeit at the same position, no previous studies have reported the pathogenic role of the SNV (p.R392Q) detected in the present study in Warburg Micro syndrome. Additionally, Warburg Micro syndrome is an autosomal recessive disease; however, only the symptom of hypogonadism was consistent with the present case. Therefore, the function of the RAB3GAP1 mutation in the current proband remains unclear.

The present study was unable to identify definitive gene lesions that may account for the aforementioned symptoms. However, an SNV in WNT10A was confirmed to be etiological of tooth agenesis and ectodermal dysplasia. WNT10A produces a protein that triggers the Wnt pathway, which is important for development and oncogenesis. Mutations in the WNT10A gene may lead to aberrant development, such as odonto-onycho-dermal dysplasia, featured by tooth agenesis and ectodermal dysplasia (34–40). Previous studies also demonstrated some overlapping functions of WNT10A with EDAs in inducing hypodontia and ectodermal dysplasia (41–43). Ectodermal dysplasia syndrome exhibits a broad range of symptoms, including but not confined to abnormality of hair growth, absence or malformation of some or all teeth, inability to perspire, impairment or loss of hearing or vision and irregular skin pigmentation. The case presented here conforms to these symptoms in terms of tooth agenesis and hearing loss. Using WGS, a non-synonymous SNV of c.637G>A, p.G213S in WNT10A was detected. This mutation has been previously reported to be the etiological variant leading to tooth agenesis (35,43). In the absence of alterations in EDA members, this variant may also give rise to ectodermal dysplasia (34). Therefore, the gene screening performed in the present study identified the function of the WNT10A mutation p.G213S in the induction of tooth agenesis, skin abnormalities and hearing loss.

In conclusion, although further investigation is required to confirm the pathogenic role of some of the SNVs identified in inducing the phenotypes observed, the present study provides an example of the use of genetic screening tools for the diagnosis of a patient with putative syndromic deafness. However, the symptoms were ultimately determined to be attributed to multiple genetic lesions as opposed to a single gene, the present study determined that a WNT10A mutation contributes to the tooth agenesis and ectodermal dysplasia observed in the patient. Additionally, a novel SNV of CRYM and an existing SNV of RAB3GAP1 were identified, their function in inducing deafness and hypogonadism require further exploration. The present study provided an example of the use gene screening tools in the diagnosis of a patient with complicated symptoms.

Acknowledgements

The authors would like to thank the family members for their participation and support in the present study. The present study was supported by the National High Technology Research and Development Program of China (863 Program) (grant no. 2007AA02E466) and the National Natural Science Foundation of China both to Dr. Huijun Yuan (grant no. 30571018).

Glossary

Abbreviations

Abbreviations:

HGPS

Hutchinson-Gilford progeria syndrome

NSHL

nonsyndromic hearing loss

SHL

syndromic hearing loss

EDA

ectodermal dysplasia

WGS

whole-genome sequencing

CNV

copy number variation

SNV

single nucleotide variations

References

1 

Shearer AE, Eppsteiner RW, Booth KT, Ephraim SS, Gurrola J II, Simpson A, Black-Ziegelbein EA, Joshi S, Ravi H, Giuffre AC, et al: Utilizing ethnic-specific differences in minor allele frequency to recategorize reported pathogenic deafness variants. Am J Hum Genet. 95:445–453. 2014. View Article : Google Scholar : PubMed/NCBI

2 

Yamamoto N, Okuyama H, Hiraumi H, Sakamoto T, Matsuura H and Ito J: The outcome of cochlear implantation for mitochondrial disease patients with syndromic hearing loss. Otol Neurotol. 36:e129–e133. 2015. View Article : Google Scholar : PubMed/NCBI

3 

Dai ZY, Sun BC, Huang SS, Yuan YY, Zhu YH, Su Y and Dai P: Correlation analysis of phenotype and genotype of GJB2 in patients with non-syndromic hearing loss in China. Gene. 570:272–276. 2015. View Article : Google Scholar : PubMed/NCBI

4 

Lamartine J: Towards a new classification of ectodermal dysplasias. Clin Exp Dermatol. 28:351–355. 2003. View Article : Google Scholar : PubMed/NCBI

5 

Yavuz I, Baskan Z, Ulku R, Dulgergil TC, Dari O, Ece A, Yavuz Y and Dari KO: Ectodermal dysplasia: Retrospective study of fifteen cases. Arch Med Res. 37:403–409. 2006. View Article : Google Scholar : PubMed/NCBI

6 

Guler N, Cildir S, Iseri U, Sandalli N and Dilek O: Hypohidrotic ectodermal dysplasia with bilateral impacted teeth at the coronoid process: A case rehabilitated with mini dental implants. Oral Surg Oral Med Oral Pathol Oral Radiol Endod. 99:E34–E38. 2005. View Article : Google Scholar : PubMed/NCBI

7 

Yavuz I, Kiralp S and Baskan Z: Hypohidrotic ectodermal dysplasia: A case report. Quintessence Int. 39:81–86. 2008.PubMed/NCBI

8 

Fukuo K and Ogihara T: Hutchinson-Gilford progeria syndrome. Ryoikibetsu Shokogun Shirizu. 318–320. 2000.(In Japanese). PubMed/NCBI

9 

Sinha JK, Ghosh S and Raghunath M: Progeria: A rare genetic premature ageing disorder. Indian J Med Res. 139:667–674. 2014.PubMed/NCBI

10 

Mazereeuw-Hautier J, Wilson LC, Mohammed S, Smallwood D, Shackleton S, Atherton DJ and Harper JI: Hutchinson-Gilford progeria syndrome: Clinical findings in three patients carrying the G608G mutation in LMNA and review of the literature. Br J Dermatol. 156:1308–1314. 2007. View Article : Google Scholar : PubMed/NCBI

11 

Vetter U, Pontz B, Zauner E, Brenner RE and Spranger J: Osteogenesis imperfecta: A clinical study of the first ten years of life. Calcif Tissue Int. 50:36–41. 1992. View Article : Google Scholar : PubMed/NCBI

12 

Yasuda M, Kishi C, Yokoyama Y, Amano H and Ishikawa O: Case of X-linked hypohidrotic ectodermal dysplasia with a novel EDA missense mutation. J Dermatol. 42:907–908. 2015. View Article : Google Scholar : PubMed/NCBI

13 

Salas-Alanis JC, Wozniak E, Mein CA, Mckinster CC Duran, Ocampo-Candiani J, Kelsell DP, Hua R, Garza-Rodriguez ML, Choate KA and Saldaña HA Barrera: Mutations in EDA and EDAR genes in a large mexican hispanic cohort with hypohidrotic ectodermal dysplasia. Ann Dermatol. 27:474–477. 2015. View Article : Google Scholar : PubMed/NCBI

14 

Jiang L, Liang X, Li Y, Wang J, Zaneveld JE, Wang H, Xu S, Wang K, Wang B, Chen R and Sui R: Comprehensive molecular diagnosis of 67 Chinese Usher syndrome probands: High rate of ethnicity specific mutations in Chinese USH patients. Orphanet J Rare Dis. 10:1102015. View Article : Google Scholar : PubMed/NCBI

15 

Sodi A, Mariottini A, Passerini I, Murro V, Tachyla I, Bianchi B, Menchini U and Torricelli F: MYO7A and USH2A gene sequence variants in Italian patients with Usher syndrome. Mol Vis. 20:1717–1731. 2014.PubMed/NCBI

16 

Pober BR, Longoni M and Noonan KM: A review of Donnai-Barrow and facio-oculo-acoustico-renal (DB/FOAR) syndrome: Clinical features and differential diagnosis. Birth Defects Res A Clin Mol Teratol. 85:76–81. 2009. View Article : Google Scholar : PubMed/NCBI

17 

De S, andre-Giovannoli A, Bernard R, Cau P, Navarro C, Amiel J, Boccaccio I, Lyonnet S, Stewart CL, Munnich A, Le Merrer M and Lévy N: Lamin a truncation in hutchinson-gilford progeria. Science. 300:20552003. View Article : Google Scholar : PubMed/NCBI

18 

Kieran MW, Gordon L and Kleinman M: New approaches to progeria. Pediatrics. 120:834–841. 2007. View Article : Google Scholar : PubMed/NCBI

19 

Moulson CL, Fong LG, Gardner JM, Farber EA, Go G, Passariello A, Grange DK, Young SG and Miner JH: Increased progerin expression associated with unusual LMNA mutations causes severe progeroid syndromes. Hum Mutat. 28:882–889. 2007. View Article : Google Scholar : PubMed/NCBI

20 

Chu Y, Xu ZG, Xu Z and Ma L: Hutchinson-Gilford progeria syndrome caused by an LMNA mutation: A case report. Pediatr Dermatol. 32:271–275. 2015. View Article : Google Scholar : PubMed/NCBI

21 

Eriksson M, Brown WT, Gordon LB, Glynn MW, Singer J, Scott L, Erdos MR, Robbins CM, Moses TY and Berglund P: Recurrent de novo point mutations in lamin A cause Hutchinson-Gilford progeria syndrome. Nature. 423:293–298. 2003. View Article : Google Scholar : PubMed/NCBI

22 

Pelosini C, Martinelli S, Ceccarini G, Magno S, Barone I, Basolo A, Fierabracci P, Vitti P, Maffei M, Santini F, et al: Identification of a novel mutation in the polymerase delta 1 (POLD1) gene in a lipodystrophic patient affected by mandibular hypoplasia, deafness, progeroid features (MDPL) syndrome. Metabolism. 63:1385–1389. 2014. View Article : Google Scholar : PubMed/NCBI

23 

Weedon MN, Ellard S, Prindle MJ, Caswell R, Allen H Lango, Oram R, Godbole K, Yajnik CS, Sbraccia P, Novelli G, et al: An in-frame deletion at the polymerase active site of POLD1 causes a multisystem disorder with lipodystrophy. Nat Genet. 45:947–950. 2013. View Article : Google Scholar : PubMed/NCBI

24 

Lessel D, Hisama FM, Szakszon K, Saha B, Sanjuanelo AB, Salbert BA, Steele PD, Baldwin J, Brown WT, Piussan C, et al: POLD1 germline mutations in patients initially diagnosed with werner syndrome. Hum Mutat. 36:1070–1079. 2015. View Article : Google Scholar : PubMed/NCBI

25 

Shastry S, Simha V, Godbole K, Sbraccia P, Melancon S, Yajnik CS, Novelli G, Kroiss M, Garg A, et al: A novel syndrome of mandibular hypoplasia, deafness and progeroid features associated with lipodystrophy, undescended testes, and male hypogonadism. J Clin Endocrinol Metab. 95:E192–197. 2010. View Article : Google Scholar : PubMed/NCBI

26 

Abe S, Katagiri T, Saito-Hisaminato A, Usami S, Inoue Y, Tsunoda T and Nakamura Y: Identification of CRYM as a candidate responsible for nonsyndromic deafness, through cDNA microarray analysis of human cochlear and vestibular tissues. Am J Hum Genet. 72:73–82. 2003. View Article : Google Scholar : PubMed/NCBI

27 

Yoshimura H, Takumi Y, Nishio SY, Suzuki N, Iwasa Y and Usami S: Deafness gene expression patterns in the mouse cochlea found by microarray analysis. PLoS One. 9:e925472014. View Article : Google Scholar : PubMed/NCBI

28 

Oshima A, Suzuki S, Takumi Y, Hashizume K, Abe S and Usami S: CRYM mutations cause deafness through thyroid hormone binding properties in the fibrocytes of the cochlea. J Med Genet. 43:e252006. View Article : Google Scholar : PubMed/NCBI

29 

Morris-Rosendahl DJ, Segel R, Born AP, Conrad C, Loeys B, Brooks SS, Müller L, Zeschnigk C, Botti C, Rabinowitz R, et al: New RAB3GAP1 mutations in patients with warburg micro syndrome from different ethnic backgrounds and a possible founder effect in the Danish. Eur J Hum Genet. 18:1100–1106. 2010. View Article : Google Scholar : PubMed/NCBI

30 

Aligianis IA, Morgan NV, Mione M, Johnson CA, Rosser E, Hennekam RC, Adams G, Trembath RC, Pilz DT, Stoodley N, et al: Mutation in Rab3 GTPase-activating protein (RAB3GAP) noncatalytic subunit in a kindred with Martsolf syndrome. Am J Hum Genet. 78:702–707. 2006. View Article : Google Scholar : PubMed/NCBI

31 

Handley MT and Aligianis IA: RAB3GAP1, RAB3GAP2 and RAB18: Disease genes in Micro and Martsolf syndromes. Biochem Soc Trans. 40:1394–1397. 2012. View Article : Google Scholar : PubMed/NCBI

32 

Handley MT, Morris-Rosendahl DJ, Brown S, Macdonald F, Hardy C, Bem D, Carpanini SM, Borck G, Martorell L, Izzi C, et al: Mutation spectrum in RAB3GAP1, RAB3GAP2 and RAB18 and genotype-phenotype correlations in warburg micro syndrome and Martsolf syndrome. Hum Mutat. 34:686–696. 2013. View Article : Google Scholar : PubMed/NCBI

33 

Asahina M, Endoh Y, Matsubayashi T, Fukuda T and Ogata T: Novel RAB3GAP1 compound heterozygous mutations in Japanese siblings with Warburg Micro syndrome. Brain Dev. 38:337–340. 2016. View Article : Google Scholar : PubMed/NCBI

34 

Clauss F, Waltmann E, Barriere P, Hadj-Rabia S, Manière MC and Schmittbuhl M: Dento-maxillo-facial phenotype and implants-based oral rehabilitation in ectodermal dysplasia with WNT10A gene mutation: Report of a case and literature review. J Craniomaxillofac Surg. 42:e346–351. 2014. View Article : Google Scholar : PubMed/NCBI

35 

Mues G, Bonds J, Xiang L, Vieira AR, Seymen F, Klein O and D'Souza RN: The WNT10A gene in ectodermal dysplasias and selective tooth agenesis. Am J Med Genet A. 164A:1–2460. 2014.PubMed/NCBI

36 

Adams BB: Odonto-onycho-dermal dysplasia syndrome. J Am Acad Dermatol. 57:732–733. 2007. View Article : Google Scholar : PubMed/NCBI

37 

Yang J, Wang SK, Choi M, Reid BM, Hu Y, Lee YL, Herzog CR, Kim-Berman H, Lee M, Benke PJ, et al: Taurodontism, variations in tooth number and misshapened crowns in Wnt10a null mice and human kindreds. Mol Genet Genomic Med. 3:40–58. 2015. View Article : Google Scholar : PubMed/NCBI

38 

Kimura R, Watanabe C, Kawaguchi A, Kim YI, Park SB, Maki K, Ishida H and Yamaguchi T: Common polymorphisms in WNT10A affect tooth morphology as well as hair shape. Hum Mol Genet. 24:2673–2680. 2015. View Article : Google Scholar : PubMed/NCBI

39 

Mostowska A, Biedziak B, Zadurska M, Matuszewska-Trojan S and Jagodziński PP: WNT10A coding variants and maxillary lateral incisor agenesis with associated dental anomalies. Eur J Oral Sci. 123:1–8. 2015. View Article : Google Scholar : PubMed/NCBI

40 

Kantaputra P, Kaewgahya M, Jotikasthira D and Kantaputra W: Tricho-odonto-onycho-dermal dysplasia and WNT10A mutations. Am J Med Genet A. 164A:1–1048. 2014. View Article : Google Scholar : PubMed/NCBI

41 

Bergendal B, Klar J, Stecksén-Blicks C, Norderyd J and Dahl N: Isolated oligodontia associated with mutations in EDARADD AXIN2, MSX1 and PAX9 genes. Am J Med Genet A. 155A:1–1622. 2011.PubMed/NCBI

42 

Arzoo PS, Klar J, Bergendal B, Norderyd J and Dahl N: WNT10A mutations account for (1/4) of population-based isolated oligodontia and show phenotypic correlations. Am J Med Genet A. 164A:1–359. 2014.PubMed/NCBI

43 

He H, Han D, Feng H, Qu H, Song S, Bai B and Zhang Z: Involvement of and interaction between WNT10A and EDA mutations in tooth agenesis cases in the Chinese population. PLoS One. 8:e803932013. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Duan H, Zhang D, Cheng J, Lu Y and Yuan H: Gene screening facilitates diagnosis of complicated symptoms: A case report. Mol Med Rep 16: 7915-7922, 2017.
APA
Duan, H., Zhang, D., Cheng, J., Lu, Y., & Yuan, H. (2017). Gene screening facilitates diagnosis of complicated symptoms: A case report. Molecular Medicine Reports, 16, 7915-7922. https://doi.org/10.3892/mmr.2017.7590
MLA
Duan, H., Zhang, D., Cheng, J., Lu, Y., Yuan, H."Gene screening facilitates diagnosis of complicated symptoms: A case report". Molecular Medicine Reports 16.6 (2017): 7915-7922.
Chicago
Duan, H., Zhang, D., Cheng, J., Lu, Y., Yuan, H."Gene screening facilitates diagnosis of complicated symptoms: A case report". Molecular Medicine Reports 16, no. 6 (2017): 7915-7922. https://doi.org/10.3892/mmr.2017.7590
Copy and paste a formatted citation
x
Spandidos Publications style
Duan H, Zhang D, Cheng J, Lu Y and Yuan H: Gene screening facilitates diagnosis of complicated symptoms: A case report. Mol Med Rep 16: 7915-7922, 2017.
APA
Duan, H., Zhang, D., Cheng, J., Lu, Y., & Yuan, H. (2017). Gene screening facilitates diagnosis of complicated symptoms: A case report. Molecular Medicine Reports, 16, 7915-7922. https://doi.org/10.3892/mmr.2017.7590
MLA
Duan, H., Zhang, D., Cheng, J., Lu, Y., Yuan, H."Gene screening facilitates diagnosis of complicated symptoms: A case report". Molecular Medicine Reports 16.6 (2017): 7915-7922.
Chicago
Duan, H., Zhang, D., Cheng, J., Lu, Y., Yuan, H."Gene screening facilitates diagnosis of complicated symptoms: A case report". Molecular Medicine Reports 16, no. 6 (2017): 7915-7922. https://doi.org/10.3892/mmr.2017.7590
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team