This article is mentioned in:

Introduction

Mycoplasma pneumoniae (M. pneumoniae) is one of the most important pathogenic microorganisms that cause respiratory tract infections in humans, especially in children. Pneumonia caused by M. pneumoniae is a common cause of acquired pneumonia in children and includes both upper and lower airway infections (1). In recent years, early onset and incidence of pneumonia due to M. pneumonia has increased. Furthermore, the incidence of disease in infants and young children has also been gradually increasing. M. pneumoniae has been detected in approximately 40% of children infected with community-acquired pneumonia (CAP), out of which 18% required hospitalization (2,3).

The alveolar epithelium is the first layer damaged upon infection by pathogenic microorganisms. The alveolar epithelium is the target of inflammatory cells and mediators. Once activated, inflammatory and effector cells release cytokines, such as tumor necrosis factor, and intercellular adhesion molecules (4) and participate in the inflammatory response in the lungs (5). Injury of alveolar epithelial cells is a critical step in the development of pneumonia and eventually results in an imbalance of body fluids. The growth status of alveolar epithelial cells is an important factor that can promote the loss of cell defense function during the development of pneumonia. For example, a previous study showed that TGFβ-1 inhibited induced epithelial-mesenchymal transition in an alveolar epithelial cell line (6). Caspase-3 caspase is the most important effect in the process of cell apoptosis, participate in a variety of diseases in development, especially with lung related diseases are closely related (7,8), so we think that caspase-3 in the occurrence and development of pneumonia is very important. The current study reviewed the studies on the prognostic and predictive significances of B cell lymphoma (Bcl)-2 family proteins in lung diseases for its closely related to cell apoptosis (9,10). We also considered potential treatment strategies which could target apoptotic proteins in lung carcinoma cells.

In this study, alveolar epithelial cells were infected with M. pneumonia to determine the corresponding effects on cell growth and apoptosis. Changes in the expression of specific cytokines were also investigated to understand the relationship between apoptosis and cytokine expression. Finally, by investigating cell growth-associated proteins, we aimed to explore the mechanisms by which M. pneumoniae infection affects alveolar epithelial cell growth. We also hope to provide a theoretical basis for further research on M. pneumonia pathogenesis that would aid in the development of new strategies for the treatment of M. pneumoniae infection. In addition, the purpose of this study was to investigate the mechanism of the development of M. pneumonia pathogenesis and to provide a basis for the treatment by studying the relationship between caspase-3, Bcl-2 and M. pneumoniae infection affects alveolar epithelial cell growth.

Materials and methods

Cells and Mycoplasma pneumoniae

A549 type II alveolar epithelial cell line was obtained from American Type Culture Collection (ATCC; Rockville, Maryland, USA). Cells were grown in RMPI 1640 medium with 10% fetal bovine serum (FBS) (Gibco Life Technologies, Carlsbad, CA, USA), 1% 100 U/ml penicillin, and 1% 100 mg/ml streptomycin sulfate. Cells were incubated in a humidified incubator with 5% CO2 at 37°C. MP strain M129 was cultured in SP-4 broth medium at 37°C until the medium turned to a peach yellow color. M. pneumoniae were dislodged with a dish scraper and suspended in sterile saline. The resulting M. pneumoniae mixture was passed through a 25-gauge needle ten times. A fraction of the M. pneumoniae was serially diluted and plated onto pleuropneumonia-like organism (PPLO) blood agar, after which the CFU counts were determined as previously described. M. pneumoniae M129 grew slowly, yielding extremely small colonies after culturing in PPLO blood agar for 7 days at 37°C (11). Plates were then overlaid with blood agar, and colonies were visible as hemolytic plaques after 2 days. The original stock was diluted to 1×108 cells/50 µl aliquot and stored at −80°C. All subsequent experiments were performed with aliquots from the same frozen stock (12).

Exposure of alveolar epithelial cells to M. pneumoniae

A549 cells were cultured in RPMI 1640 medium supplemented with 10% FBS in a 5% CO2 at 37°C. After reaching 70% confluence, cells were serum-starved for 24 h to ensure that cell apoptosis and related signaling pathways that are potentially activated by serum are returned to basal levels before exposure to M. pneumoniae at the indicated multiplicity of infection or to various inhibitors or transfection with small interfering RNA (siRNA). The siRNA against caspase-3 and negative control (NC) were chemically synthesized by Shanghai GenePharma Co., Ltd (Shanghai, China). Samples in the control group were exposed to sterile phosphate-buffered saline (PBS).

Quantitative real-time PCR

Total RNA was extracted from the cells with TRIzol reagent (Invitrogen, Carlsbad, CA, USA). cDNA was synthesized using miScript Reverse Transcription kit (Qiagen N.V., Venlo, The Netherlands). Primers for caspase-3 and GAPDH were synthesized by GenePharma Co., Ltd. PCR runs were performed in triplicate. Primers for the target genes are presented in Table I.

Table I. Primers sequences used for quantitative polymerase chain reaction.

Table I.

Primers sequences used for quantitative polymerase chain reaction.

Gene	Sense primer (5′→3′)	Antisense primer (5′→3′)
GAPDH	CGGAGTCAACGGATTTGGTCGTAT	AGCCTTCTCCATGGTGGTGAAGAC
Caspase-3	GCAAACCTCAGGGAAACATT	TTTTCAGGTCAACAGGTCCA
Bcl-2	TTCTTTGAGTTCGGTGGGGTC	TGCATATTTGTTTGGGGCAGG

[i] Bcl-2, B cell lymphoma-2.

Flow cytometry and terminal deoxynucleotidyl transferase-mediated deoxyuridine triphosphate in situ nick end labeling (TUNEL) analysis

Cells were collected and washed twice with cold PBS solution to remove floating cells before analysis using the Annexin V-APC Apoptosis Detection kit (Nanjing KeyGen BioTech Co., Ltd.,. Nanjing, China). Apoptosis was monitored using a flow cytometer (BD Biosciences, Franklin Lakes, NJ, USA). TUNEL detection kit (Roche Diagnostics, Ltd., Shanghai, China) was used to detect cell apoptosis following the manufacturer's instructions. Cells were counterstained with DAPI and examined with a fluorescence microscope.

Cell proliferation assay

The Cell Counting Kit-8 (CCK-8; Dojindo Molecular Technologies, Inc., Kumamoto, Japan) assay was used for cell proliferation analysis following the manufacturer's instructions. Cells treated with M. pneumoniae were seeded at a density of 5×103 cells per well in 96-well plates and exposed for varying incubation periods (0, 24, 48, 72 h). The absorbance was measured at 450 nm (Thermo Fisher Scientific, Inc., Waltham, MA, USA).

Cytokine analysis

The effects of M. pneumoniae treatment on secretion of cytokines into culture medium by alveolar epithelial cells were determined using ELISA assays (R&D Systems, Inc., Minneapolis, MN, USA) or MILLIPLEX MAP Human Cytokine/Chemokine Magnetic Bead multiplex assay (Millipore, Billerica, MA, USA) according to manufacturer's instructions.

Western blot analysis

Extracted proteins were resolved via SDS-PAGE and analyzed via western blotting. Antibodies used for western blotting were purchased from Cell Signaling Technology (Danvers, MA, USA). Following incubation with horseradish peroxidase-coupled secondary anti-mouse/rabbit (Beyotime Institute of Biotechnology, Jiangsu, China), protein bands were visualized with ECL Blotting Detection Reagents (Millipore).

Statistical analysis

Student's t-test was used to analyze the differences between groups. Data were presented as means ± SD. Statistical analysis was performed using SPSS 17.0 (SPSS, Inc., Chicago, IL, USA). P<0.05 was considered statistically significant. All experiments were independently performed at least three times.

Results

M. pneumoniae infection promotes apoptosis in A549 type II alveolar epithelial cells

After treatment with M. pneumoniae, apoptosis in A549 cells was detected using flow cytometry and TUNEL assay. Flow cytometry results showed that apoptosis rates at 0, 12, and 24 h were 8.3, 23.5, and 45.3%, respectively after treatment with M. pneumonia, respectively (Fig. 1A). However, apoptosis rates in cells treated for 12 and 24 h were significantly higher than those in the 0 h group (P<0.05). Similarly, results of the TUNEL assay showed that A549 cells exposed to M. pneumoniae at 12 and 24 h showed considerably higher apoptosis rates compared to those in the 0 h group (Fig. 1B).

Figure 1. M. pneumoniae promoted apoptosis in type II alveolar epithelial cells. (A) Flow cytometry results showing gradual increase in apoptosis rates in alveolar epithelial cells through the ratio of percentage of apoptosis. **P<0.01 vs. 0 h group; ##P<0.01 vs. 24 h group. (B) TUNEL assay results showed apoptosis rates of A549 cells after 0, 12, and 24 h of treatment. Data are presented as means ± standard deviation. M. pneumoniae, Mycoplasma pneumoniae; TUNEL, terminal deoxynucleotidyl transferase-mediated deoxyuridine triphosphate in situ nick end labeling.

M. pneumoniae infection influences protein expression in type II alveolar epithelial cells

M. pneumoniae influenced the apoptosis rates of A549 cells. Hence, we explored the changes in the expression of proteins involved in apoptosis. mRNA levels of caspase-3 and Bcl-2 were measured via real-time PCR. Results showed that transcriptional expression of caspase-3 increased with prolonged exposure to M. pneumoniae, with expression peaking at 24 h incubation (P<0.05; Fig. 2A). However, mRNA levels of Bcl-2 showed opposite expression patterns (Fig. 2B). In addition, results of real-time PCR were validated by western blotting, which showed similar changes in caspase-3 and Bcl-2 expression (Fig. 2C).

Figure 2. Caspase-3 and Bcl-2 expression levels in type II alveolar epithelial cells following M. pneumoniae infection. (A and B) mRNA levels of caspase-3 and Bcl-2 based on real-time PCR. (A) **P<0.01 vs. 0 h group, #P<0.05 vs. 24 h group; (B) *P<0.05/**P<0.01 vs. 0 h group, #P<0.05 vs. 24 h group. (C) Protein levels of caspase-3 and Bcl-2 based on western blotting. Data are presented as means ± SD. Bcl-2, B cell lymphoma-2; M. pneumoniae, Mycoplasma pneumoniae.

M. pneumoniae infection suppresses proliferation of type II alveolar epithelial cells

CCK-8 assay was performed to determine the effect of M. pneumoniae infection on A549 cell proliferation. OD values at 450 nm in the CCK-8 assay revealed marked differences in the proliferation of A549 cells treated with M. pneumoniae at three different treatment periods (P<0.05; Fig. 3A). A549 cells showed the lowest cell proliferation after treatment for 24 h. M. pneumoniae exposure also resulted in downregulation of JNK protein levels and upregulation of phosphorylated JNK levels (Fig. 3B).

Figure 3. M. pneumoniae inhibits proliferation of alveolar epithelial cells. (A) Results of the CCK-8 assay showing reduced proliferation of A549 cells. *P<0.05 vs. 0 h group. (B) Protein levels of JNK and p-JNK after M. pneumoniae infection. Data are presented as means ±standard deviation. M. pneumoniae, Mycoplasma pneumoniae; CCK-8, Cell Counting Kit-8; p-, phosphorylated; JNK, janus kinase; OD, optical density.

M. pneumoniae exposure stimulates interleukin (IL)-4, IL-6, and IL-13 secretion and suppresses IL-10 secretion in A549 cells

Proliferation and apoptosis of alveolar epithelial cells were found to be closely associated with IL secretion. In this study, the concentrations of IL-4, IL-6, and IL-13 in the culture supernatant of alveolar epithelial cells were observed to increase with increasing incubation periods after stimulation by M. pneumoniae, and significant differences were observed among groups incubated for 0, 12, and 24 h (P<0.05; Fig. 4). By contrast, IL-10 levels decreased with prolonged exposure to M. pneumonia and showed significant differences among the three treatment periods (P<0.05; Fig. 4C).

Figure 4. Changes in IL-4, IL-6, IL-10, and IL-13 levels due to M. pneumoniae infection. (A) IL-4 levels were increased by M. pneumoniae treatment. (B) Upregulation of IL-6 by M. pneumoniae treatment. (C) Downregulation of IL-10 by M. pneumoniae treatment. (D) Upregulation of IL-13 by M. pneumoniae treatment. Data are presented as means ± SD *P<0.05/**P<0.01 vs. 0 h group; #P<0.05/##P<0.01 vs. 24 h group. IL, interleukin; M. pneumoniae, Mycoplasma pneumoniae.

Inhibiting caspase-3 expression reversed the apoptosis-promoting effects of M. pneumoniae infection

In this study, we used siRNA interference to inhibit protein expression of caspase-3 in alveolar epithelial cells and further explored the mechanisms underlying M. pneumoniae-induced cell apoptosis. After siRNA interference, mRNA levels of caspase-3 in siRNA group treated for 24 h were found to be lower than that in the NC group (Fig. 5A). The siRNA group and NC group showed significant differences in apoptosis rates after stimulation with M. pneumoniae for 24 h (P<0.05; Fig. 5B). Results of the TUNEL assay showed that treatment with siRNA targeting caspase-3 suppressed M. pneumoniae-induced apoptosis in A549 cells (Fig. 5C). IL-6 and IL-10 levels also showed similar changes in expression upon M. pneumoniae treatment as Fig. 4. M. pneumoniae infection produces an opposite effect on the secretion of IL-6 and IL-10 by alveolar epithelial cells. But when transferred with siRNA of caspase-3, IL-6 and IL-10 secreted by cells infected M. pneumoniae showed the opposite changes, IL-6 decreases and IL-10 increases. These results also suggested that caspase-3 siRNA increased the level of IL-10 and reduced the level of IL-6 of alveolar epithelial cells. This may be due to the effect of siRNA of caspase-3 on cell apoptosis, and further affect the secretion of alveolar epithelial cells (P<0.05; Fig. 5D). Inhibition of caspase-3 expression abolished the effects of M. pneumoniae infection on alveolar epithelial cells and induced corresponding changes in Bcl-2 protein levels (Fig. 5E).

Figure 5. Inhibiting caspase-3 expression reversed the apoptosis-promoting effects of M. pneumoniae. (A) siRNA interference inhibits caspase-3 expression.**P<0.01 vs. NC. (B) M. pneumoniae and siRNA of caspase-3 changed the apoptosis of A549 based on flow cytometry. **P<0.01 vs. MP + NC; ##P<0.01 vs. MP + siRNA. (C) TUNEL results showed apoptosis of A549 cells in different treatment groups. (D) Changes in IL-6 and IL-10 levels as a result of M. pneumoniae infection and siRNA interference detected based on ELISA. *P<0.05/**P<0.01 vs. MP + NC; ##P<0.01 vs. MP + siRNA. (E) Caspase-3 and Bcl-2 levels following treatment with M. pneumoniae and siRNA. Data are presented as means ± standard deviation. MP/M. pneumoniae, Mycoplasma pneumoniae; siRNA, small interfering RNA; NC, negative control; TUNEL, terminal deoxynucleotidyl transferase-mediated deoxyuridine triphosphate in situ nick end labeling; IL, interleukin; Bcl-2, B cell lymphoma-2.

Discussion

M. pneumoniae is the most common cause of CAP and has been recognized to trigger multiple chronic airway disease, especially in children (13,14). M. pneumoniae was detected in 30% of pediatric CAP and in over 50% of children aged 5 years and above (15). Moreover, M. pneumoniae is one of the major pathogens responsible for clinical child respiratory tract infection, including Mycoplasma pneumoniae pneumonia (MPP) (16). However, MPP is usually considered as a self-limited disease that can also lead to refractory Mycoplasma pneumoniae pneumonia (RMPP), wherein clinical and radiological deterioration can persist despite macrolide antibiotic therapy for 7 days or longer (17). Previous studies have shown that age is highly correlated with the development of MPP, and immunological response has been widely recognized to play an important role in MPP pathogenesis (18,19).

Alveolar epithelial cells synthesize and secrete cytokines, which are involved in lung inflammation, and are divided into type I and type II alveolar epithelial cells (20). Type I alveolar epithelial cells cover most of the surface of the alveoli and are the sites of gas exchange (21). Type II alveolar epithelial cells function to reduce alveolar surface tension and stabilize alveolar size (22). Injury of alveolar epithelial cells is an important step in the development of pneumonia that results in an imbalance in body fluids. Cell apoptosis is an important mechanism responsible for the loss of defense function of alveolar epithelial cells in the pathogenesis of pneumonia (23). Apoptosis includes two primary mechanisms, namely, the external death receptor pathway and internal pathway. The external death receptor pathway is activated by an external death ligand, whereas the internal pathway is triggered by an internal apoptotic signal. These two pathways act in concert with the caspase signaling cascade and leads to DNA damage and apoptosis (24). Caspase-3 and other executioner caspase have long been recognized as key proteases mediating cell destruction during apoptotic cell death (25). Therefore, in this study, we also speculated that M. pneumoniae infection-inducted apoptosis in alveolar epithelial is associated with caspase-3 expression. Fortunately, our results showed that M. pneumoniae infection can increase caspase-3 protein levels, but inhibiting caspase-3 expression via siRNA interference reversed apoptosis caused by M. pneumoniae infection. However, activation of the JNK signaling pathway can induce caspase-3 activation in in tumor cells and serves as a key step in tumor growth inhibition (26).

In pneumonia pathogenesis, cytokines play an important role in intercellular signaling, including inflammation. The balance between proinflammatory factors, such as TNF, IL-1, IL-6, and 1L-8, and anti-inflammatory factors, such as IL-10, is essential for regulating immune responses. Previous studies demonstrated that the number of cleared apoptotic neutrophils and expression of proinflammatory cytokines are elevated in mice with MPP and causes more severe lung inflammation and higher mortality rates (27). Infection with M. pneumoniae can lead to an imbalance in inflammatory responses that induce the transition from apoptosis to cell death, thereby increasing the severity of lung inflammation (28). The strong association between inflammation and cell survival is reflected by the high IL-6 levels, which suppress cell apoptosis by regulating all hallmarks and multiple signaling pathways involved in inflammation (29). Inhibition of IL-6-induced proinflammatory responses mediated by the JAK/STAT and NF-κB signaling cascades was found to be directly associated with apoptosis (30).

This study investigated M. pneumonia-induced apoptosis in A549 alveolar epithelial cell. Results from both flow cytometry and TUNEL assays showed that M. pneumoniae promoted apoptosis in A549 cells. Western blotting was performed to explore the association between MPP and apoptosis in A549 cells, and results showed that caspase-3 expression and Bcl-2 mRNA and protein levels changed after M. pneumoniae treatment. M. pneumoniae infection also inhibited proliferation of alveolar epithelial cells and promoted the progression of pneumonia. Induction of IL-6 and IL-10 by M. pneumoniae can also promote the progression of pneumonia in children by influencing apoptosis in alveolar epithelial cells. We also inhibited the expression of caspase-3, a key protein involved in cell apoptosis, via siRNA knockdown, which abolished the apoptosis caused by M. pneumoniae. Thus, the results indicate that caspase-3 is a key mediator of M. pneumoniae-induced apoptosis. These results suggest that inhibiting caspase-3 expression can reduce apoptosis in alveolar epithelial cells, which is a key step in MPP pathogenesis. Thus, the present findings provide new directions for the treatment of MPP in children.

Acknowledgements

The authors thank Professor Bin Xia in Chinese Medical University for his great contribution to this study. The present study was supported by the Natural Science Foundation of Jilin Province (JL2015K23A05).

References