Open Access

Cellular and molecular changes to chondrocytes in an in vitro model of developmental dysplasia of the hip‑an experimental model of DDH with swaddling position

  • Authors:
    • Bo Ning
    • Rui Jin
    • Lin Wan
    • Dahui Wang
  • View Affiliations

  • Published online on: August 13, 2018     https://doi.org/10.3892/mmr.2018.9384
  • Pages: 3873-3881
  • Copyright: © Ning et al. This is an open access article distributed under the terms of Creative Commons Attribution License.

Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )


Abstract

The aim of the present study was to assess the cellular and molecular changes to chondrocytes in a developmental dysplasia of the hip (DDH) model and to investigate the early metabolism of chondrocytes in DDH. Neonatal Wistar rats were used for the DDH model with swaddling position. Primary cultures of chondrocytes were prepared at serial interval stages (2, 4, 6 and 8 weeks) to investigate cellular proliferation. The expression of collagen II and aggrecan mRNA was detected to assess the anabolic ability of chondrocytes. The expression of matrix metallopeptidase (MMP)‑13 and ADAM metallopeptidase with thrombospondin type 1 motif 5 (ADAMTS‑5) mRNA was measured to investigate the degradation of collagen II and aggrecan, respectively. Morphological changes were observed in coronal dissection samples after the removal of fixation. Primary chondrocytes at serial intervals were assessed using a Cell Counting Kit‑8 assay and the results revealed that DDH chondrocytes had more proliferative activity. The expression of collagen II mRNA was upregulated at 2 weeks and was more sensitive to mechanical loading compared with aggrecan. Similar changes occurred at 6 weeks. Furthermore, MMP‑13 and ADAMTS‑5 mRNA expression levels were upregulated at 2 weeks. It was also demonstrated that DDH chondrocytes exhibited high proliferative activity at the early stages and degeneration later.

Introduction

Developmental dysplasia of the hip (DDH) is one of the most common malformations affecting the lower extremities in children. If a stable and concentric reduction is maintained after close reduction, the acetabulum has the potential to remodel and resume normal growth and development. Furthermore, if younger patients are at the onset of treatment, this results in a greater potential for acetabular remodeling (15). The use of magnetic resonance imaging has resulted in enhanced consideration of the importance of acetabular cartilage in hip remodeling (6,7). Chondrocytes, one of the important components of cartilage, serve a critical role in maintaining the function and biological features of cartilage. However, it is difficult to obtain hip cartilage from DDH patients due to ethical constraints. Consequently, the function and pathophysiology of chondrocytes in the hips of patients with DDH cannot be in investigated in vivo. In addition, it is not possible to obtain cultured human chondrocytes from patients with DDH. Due to these constraints, animal models are used to improve our understanding of chondrocytes in DDH in vivo. A rat model of unilateral DDH was established by Sijbrandij (8), and since then various experimental animals have been used to show that remodeling of the acetabulum is possible after the removal of fixation (9,10). However, previous studies mainly focused on the morphological and histological alterations of abnormal hips and the corresponding cartilage (1113). Furthermore, since the swaddle position in infants is considered to be an important risk for the development of DDH, the model designed by the principle is thought to be an accurate model of cartilage in human DDH and may be suitable for further investigations (14). The authors previously developed a successful neonatal rat model of DDH corresponding to the swaddling position of the hip and early cartilage degeneration in DDH (10).

The aim of the present study was to assess the features of chondrocytes in DDH cartilage via primary cell culture in vitro. DDH models of neonatal Wistar rats were prepared in the present study and serial sections of hip cartilage were isolated and incubated primarily to investigate the cellular characteristics after the removal of fixation.

Materials and methods

Experimental animal models

All experimental protocols were approved by the Animal Ethical Committee of Fudan University (Shanghai, China). A total of 80 male specific pathogen free neonatal Wistar rats (~5 g) were purchased from the Animal Research Institute of Medical College of Fudan University. Feeding environment was as follows: Temperature, 21–26°C, relative humidity 45–65%, ventilation for 8–12 times/h, 12-h light/dark cycle. The rats were fed with sterile pure water and adequate feed (HFK bio-technology, Beijing, China). Rats in the experimental DDH group (n=40) were immobilized, with the hip and knee fixed in an extended position with medical tapes for 10 days as described in our previous study (10,12). Following the removal of the fixation, rats were allowed to move freely in their cage for 2, 4, 6 or 8 weeks. Rats were sacrificed and the hips were isolated for macro-morphological examination and primary cell culture of the articular cartilage. Rats in the control group (n=40) were allowed to move freely throughout the study period.

Coronal histology and morphometry

Hips were isolated and fixed in 4% paraformaldehyde for 24 h in room temperature and decalcified with 10% EDTA, following which they were dissected through the longitudinal line from the ilium to the ischium of acetabulum. An abnormal association between the acetabulum and femoral head was observed in the experimental DDH group. The largest coronal that was selected from sections (5-µm) and acetabular index was measured. The acetabular depth ratio (ADR=depth/width ×100%) was measured to assess changes in the acetabulum (Fig. 1A). The acetabular index (AI) was defined as the ratio of depth: Width measured using the reference line presented in Fig. 1A. The long line is identified as the width diameter of the longitudinal acetabulum from the upper edge to the distal border, excluding the rim of labrum. The short line is the perpendicular line to the width diameter of the acetabulum, and the curved line represents the acetabular shape following the removal of fixation.

Primary cell culture protocol

Primary cell culture was performed using the modified Manning method (15). Cartilage was obtained from the hips under sterile conditions, minced into 1 mm3 pieces with scissors and digested using 0.25% Trypsin-EDTA and 2% collagenase II (Invitrogen; Thermo Fisher Scientific, Inc., Waltham, MA, USA). Tissues were passed through a 0.25 µm molecular filter and the cell suspension was centrifuged at 240 × g for 5 min in room temperature. The resulting pellet was resuspended in fresh Dulbecco's modified Eagle's medium (DMEM; Sigma-Aldrich; Merck KGaA, Darmstadt, Germany), supplemented with 10% fetal bovine serum (Sigma-Aldrich; Merck KGaA), 5 µg/ml penicillin and 5 µg/ml streptomycin. The final cell density was 5×106 cells/ml and the suspension was incubated at 37°C in an atmosphere containing 5% CO2 overnight, to allow primary chondrocytes to adhere. The medium was replaced with fresh DMEM every two days. Cells were then identified using collagen II immunofluorescence staining.

Chondrocyte identification using collagen II immunofluorescence

The medium was discarded and cells were rinsed three times with PBS for 5 min. Cell samples were fixed with 4% paraformaldehyde for 30 min at room temperature, following which, they were blocked in 0.2% Triton X-100 (PBST; Sigma-Aldrich; Merck KGaA) mixed with goat serum (Sigma-Aldrich; Merck KGaA) for 30 min at 37°C. Cells were immunoblotted and incubated overnight at 4°C with primary antibodies against collagen II (cat. no. ab34712; Abcam, Cambridge, UK; 1:100). The specimens were incubated for 1 h with secondary antibodies goat anti-rabbit IgG Alexa Fluor® 488 (cat. no. ab150077 Abcam; 1:200) at room temperature in the dark. Finally, specimens were stained with DAPI at room temperature and then viewed under an inverted fluorescence microscope (excitation wavelength 488 nm, magnification 200X) and images were captured. Collagen II staining at different time (2, 4, 6 and 8 weeks) was assessed and the number of cells was counted using Image Plus Pro 6.0 (Media Cybernetics, Inc., Rockville, MD, USA).

Cell proliferation kinetics and growth curve

Primary cells were seeded in a 96-well plate at a density of 4,000 cells/200 µl and the number of chondrocytes was assessed using a Cell Counting Kit (CCK)-8 (DJDB4000X; Dojindo Molecular Technologies, Inc., Kumamoto, Japan) each day for 1 week. The optical density (OD) value of CCK-8 absorbance was measured at a wavelength of 450 nm using an ELISA reader and used to construct the growth curve.

Cell cycle analysis

Samples were centrifuged at 300 × g for 3 min at 4°C, then collected and rinsed with cold PBS. Cells were then fixed with 70% cold ethanol at 4°C overnight, then the cell were treated with Cell Cycle Detection kit (KGA512, Nanjing KeyGen Biotech Co., Ltd., Nanjing, China). Cell cycle analysis was performed using flow cytometry equipment (FACSAria II; BD Biosciences, Franklin Lakes, NJ, USA) and the data were collected using FlowJo analysis software (FlowJo-10.5.0; Flowjo LLC, Ashland, OR, USA). The number of cells in each phase of the cell cycle was recorded and the proportion of cells in S-phase was taken to be representative of proliferative activity.

mRNA expression levels of collagen II, aggrecan, matrix metallopeptidase (MMP)-13 and ADAM metallopeptidase with thrombospondin type 1 motif 5 (ADAMTS-5)

Total RNA was extracted from the monolayer confluent chondrocytes using TRIzol® (Invitrogen; Thermo Fisher Scientific, Inc.) and the purity and integrity were assayed using spectrophotometry and 10% agarose-gel electrophoresis respectively. The OD values of these mRNAs were detected between 1.8 and 2.0. A total of 1 µg RNA was transcribed to produce cDNA using a ReverTra Ace qPCR RT kit (Toyobo, Life Science, Osaka, Japan) according to the manufacturer's protocol. The yield was quantified spectrophotometrically.

Reverse transcription-quantitative polymerase chain reaction (RT-qPCR) (Denaturing 94°C, 60 sec; 40 cycles (Denaturing 94°C, 10 sec; annealing and extension 60°C, 30 sec) was performed using 5 µl cDNA (100 ng), 2 µl each primer (10 µM), 25 µl SYBR Green Real-time PCR Master Mix (Toyobo, Life Science) and 16 µl water to give a total volume of 50 µl. The RT-qPCR was programmed to an initial step of 10 min at 95°C for polymerase activity, followed by 40 cycles of 15 sec denaturation at 95°C, 15 sec annealing at 60°C, and 45 sec extension at 72°C. The expression levels of MMP-13, Collagen 2a1, ADAMTS-4 and ADAMTS-5 were normalized to β-actin. All primers used are listed in Table I. The results were quantified using the 2_∆∆Cq method (16).

Table I.

Primers used for amplification of target genes and β-actin.

Table I.

Primers used for amplification of target genes and β-actin.

GeneSequence (5′-3)
Collagen II
  F ACGCTCAAGTCGCTGAACAA
  R TCAATCCAGTAGTCTCCGCTCT
Aggrecan
  F TCCAAACCAACCCGACAAT
  R TCTCATAGCGATCTTTCTTCTGC
MMP-13
  F TACGAGCATCCATCCCGAGACC
  R AACCGCAGCACTGAGCCTTTTC
ADAMTS-5
  F GGCTGTGGTGTGCTGTG
  R CTGGTCTTTGGCTTTGAAC
β-actin
  F GGAGATTACTGCCCTGGCTCCTA
  R GACTCATCGTACTCCTGCTTGCTG

[i] F, forward; R, reverse; MMP-13, matrix metallopeptidase; ADAMTS-5, ADAM metallopeptidase with thrombospondin type 1 motif 5.

Statistical analysis

Data are expressed as the mean ± standard error of the mean. Statistical significance was determined using one-way analysis of variance and paired t-tests. The bonferroni method was used for post hoc tests. Data were analyzed using SPSS software, version 16.0 (SPSS, Inc., Chicago, IL, USA). Each experiment was repeated three times. P<0.05 was considered to indicate a statistically significant difference.

Results

Model and morphometry

Gross observations of the coronal dissection morphology of the hip are presented in Fig. 1A. A distinct DDH model was identified in the experimental DDH group, with dislocational hips observed (Fig. 1A). The acetabular index (AI) was significantly lower in the DDH rats compared with the control group at all time points (P<0.001; Fig. 1B).

Immunofluorescence staining of collagen II and evaluation of cell proliferation

The expression of collagen II was used to identify chondrocytes. No apparent differences in cell morphology were observed between the control and experimental DDH groups (Fig. 2A). Cell morphology varied, with cobblestone, ellipse and polygonal shapes observed after the primary cells had adhered (Fig. 2A). In addition, cell proliferation was assessed by counting cells following staining with DAPI (Fig. 2B). The results revealed increased proliferation in the experimental DDH group compared with the control group at all time points (P<0.001).

Cell growth curve

At 2 weeks, the growth curve for the experimental DDH group began to enter the linear phase, the slope of which was greater than the control group, which indicated an increased trend of proliferation (Fig. 3A). However, no significant differences in the linear phase slope were observed between groups at 4 weeks. This suggested that proliferation in the experimental DDH group slowed over time (Fig. 3B). Furthermore, at week 6 the slope of the linear phase was reversed (Fig. 3C); this was maintained until 8 weeks with the experimental DDH group exhibiting a decreased slope (Fig. 3D).

Number of cells in S phase increases during DDH

Flow cytometry was performed to measure the proportion of cells in each phase of the cell cycle at different time points (Fig. 4). S-phase is when DNA synthesis occurs, and is therefore reflective of cell proliferation. At all time points, a greater number of cells in the experimental DDH group were in S-phase compared with the control group (P<0.001; Fig. 4A). Following the 2 week period, a gradual increase in the proportion of cells in S-phase was observed in the experimental DDH group over time (Fig. 4C). A reduced number of cells were observed in G1-phase in the experimental DDH group compared with the control, particularly at 2 and 8 weeks (Fig. 4B). The number of experimental DDH cells in G2-phase was also lower compared with the control group, particularly at 2 weeks (Fig. 4D). A significant increase in experimental DDH cells in the S-phase was observed at 2 and 8 weeks (Fig. 4C).

mRNA expression levels of collagen II, aggrecan, MMP-13 and ADAMTS-5 are varied at different time-points in DDH

The mRNA expression levels were investigated using RT-qPCR (Fig. 5). Collagen II mRNA expression in the experimental DDH group was upregulated at 2 weeks after the removal of fixation, and downregulated at 4 weeks. However, a significant reversal was present at 6 weeks followed by a downregulation again at 8 weeks (Fig. 5A). The expression of MMP-13 mRNA was overexpressed in DDH cells compared with the control group at 2 weeks, decreased at 4 weeks and then this expression gradually increased during the following weeks (Fig. 5C). Aggrecan expression levels were significantly different between the experimental DDH and control groups at weeks 4 and 8; however, no significant differences were observed at weeks 2 and 6 (Fig. 5B). Conversely ADAMTS-5 mRNA in the DDH group was significantly different at weeks 2, 6 and 8 compared with the control (Fig. 5D).

Discussion

The DDH model of neonatal rats shows that the swaddling position is a mechanical risk factor that plays an important role in the pathogenesis of DDH. Previous studies of DDH models have revealed that the hip may be remodeled after the removal of fixation, which resembles close reduction treatment in human infants with DDH (17). Furthermore, Yamamoto (2) reported that shorter fixation duration gave better results. It has also been reported that the DDH is able to be completely reversed to prevent degeneration (18). Nevertheless, the results of the present study were not consistent with previous reports due to the failure to achieve close reduction; although remodeling of the macro-morphology was observed in the early stage, degeneration increased irreversibly with skeletal maturity (10,12). However, changes may be associated with cartilage content and resulting differences in mechanical features at different ages. In addition, the maintenance of subluxation resulted in no complete reduction, as the long duration of immobilization made the cartilage suffer from more abnormal weight-bearing. These kinds of changes leading to cartilage degeneration can be observed in clinical DDH X rays.

The histological and gross observation results revealed that remodeling occurred with proliferation at an early stage. Few studies focus on cellular proliferation of the chondrocytes, no matter whether or not the cells are loaded with abnormal mechanical forces. It is therefore important to investigate the proliferative ability at a cellular level (19). Chondrocytes in patients with DDH suffer from a variety of stresses, including shear, compression and tension loading, and so it is difficult to analyze the relationship between cell proliferation and mechanical loading. A number of studies have investigated the association between simple stress in vitro and cell proliferation and demonstrated that proliferation is associated with the type, intensity and mode of stress (2025). In addition, a novel method for assessing articular cartilage chondrocytes in vivo has been described (26). However, the effects of different types of stress loading on the cartilage cannot be examined in vivo in a rat model, as the hip volume is too small. In the present study, cell proliferation was assessed using cell cycle analysis, and CCK-8 assays.

Cell cycle progression is the predominant means of regulating cell proliferation and differentiation, and so increasing our understanding of cell cycle progression in DDH chondrocytes may be beneficial. Changes in the number of cells in S-phase at 2 weeks may be due to an increase in proliferative ability following the transient removal of compress loading. The changes at weeks 4 and 6 may occur as a result of sustained complex loading due to mobilization, and accumulation of the proliferative cells may be a compensational reaction to maintain cartilage function. However, it is unclear why at 8 weeks cell numbers decreased while the proportion of cells in S-phase increased. Although an increase in S-phase cells indicated early proliferative activity, the proportion of cells in G0/G1-phase was significantly lower in the experimental DDH group compared with the control group, suggesting that proliferation and differentiation may be elevated in DDH chondrocytes. Nevertheless, the proliferation index regarding the S-phase accounted for the cell proliferative ability at the actual time points, while CCK-8 results indicated proliferative kinetics according to the slope of the growth curve. The results revealed that proliferation occurred faster soon after the removal of fixation in DDH chondrocytes.

The relationship between cartilage remodeling and cell proliferation has recently been reported by assessing the spatial reorganization of superficial chondrocytes in the early stages of osteoarthritis (27). Furthermore, a clear association has been reported between cell proliferation and ECM metabolism (28). Further investigation is required to discover further details regarding changes in ECM metabolism in DDH chondrocytes in response to changes in loading.

Collagen II and aggrecan provide the cartilage with tensile and compressive strength by forming a meshwork of collagen II in which the interstices are filled with aggrecans (29,30). MMPs and ADAMTSs secreted by chondrocytes are the two main groups of proteases in the ECM that mediate the degradation of collagen II and aggrecan. mRNA was extracted from primary cells and the expression of Col2a1 and aggrecan were assessed along with MMP-13 and ADAMTS-5 expression.

Homeostasis of the cellular environment is important for the function of the cartilage, maintaining a balance between the structural components and their proteolytic enzymes in response to dynamic loading (31). If chondrocyte metabolism is disrupted due to abnormal mechanical stresses and degradation of the ECM, the chondrocytes will initiate a compensational mechanism to counteract the inappropriate mechanical loading. Studies have revealed that cartilage regeneration and degeneration are dependent on the duration, quality and strength of abnormal loading (32,33). However, results have indicated that the metabolism of collagen in response to abnormal loading is different to that of aggrecan (20). As such, the upregulation of collagen II independent of aggrecan is considered to be a marker for early degeneration in DDH experiments as well as early osteoarthritis (11,3436). In the present study, no significant differences in expression were observed between collagen II and aggrecan at 2 weeks. However, both were upregulated during the period after the transient removal of fixation (37). Collagen II rather than aggrecan demonstrated a difference between DDH and control group, while collagen II expression was downregulated at 8 weeks after modeling, which followed a gradual elevation until 6 weeks. Conversely, aggrecan mRNA expression was downregulated until 8 weeks post-modeling. The expression levels of MMP-13 and ADAMTS-5 were significantly affected by ECM synthesis and increased at 2 weeks, which was associated with the compression loading being released. Furthermore, following re-mobilization of the hip, the expression of both proteases was downregulated. MMP-13 and ADAMTS-5 have been reported to have an important effect in early degeneration during loading stress (38). Furthermore, ADAMTS-5 expression is higher than collagen II and aggrecan during the early stages of DDH and lower in the later stages, suggesting that ADAMTS-5 is more sensitive to changes in loading stress and serves a predominant role in hip remodeling in the early stages following load removal. If complete reduction is achieved, the expression of ADAMS-5 mRNA is reversible and cartilage degeneration may be prevented, as reported by Karsdal et al (39). A study by Breckon et al (40) involving a 14-year-old patient with DDH suggested that MMP-13 was not essential for the remodeling of cartilage growth and chondrocyte proliferation. Conversely, other studies have reported that MMP-13 serves an important role in cartilage development and ECM remodeling. Previous studies have revealed that MMP-13 and ADAMTS-5 expression levels are closely associated with stress activity (37,41,42), suggesting that several signal pathways could play complex roles in mediating chondrocyte metabolism in DDH cartilage. MMP-13 and ADAMTS-5 were upregulated during the early degeneration of cartilage and then downregulated sharply. This result suggests that DDH degeneration may be reversible during DDH degeneration.

It has previously been reported that collagen expression is associated with the longitudinal and transverse distribution and intensity of weight-bearing (4347). A phenomenon known as dedifferentiation can occur during cell culture, and in the present study, early alternations in DDH cartilage at the cellular and molecular levels in vivo and in vitro resulted in no complete reduction and subluxation in consequence. This does not influence our results; although alternative findings in different tests were observed, the expression of target molecules was unaffected. Changes at the molecular level, which are the initial promoters of progressive degeneration, were not observed. Therefore, in future studies it will be interesting to focus on it whether the early degeneration occurs after the operations of DDH at molecular level and what time will be appropriate for the operation so that the degeneration could be prevented completely.

In conclusion, although complete reduction was not achieved after the removal of fixation, transient remodeling of the hip occurred over time, which was indicative of high proliferative activity in the chondrocytes as well as cell cycle progression at the early stage. However, degeneration occurred at the later stage. These results suggested that MMP-13 and ADAMTS-5 serve a dominant role not only in the remodeling phase but also in the degeneration stage.

Acknowledgements

Not applicable.

Funding

No funding was received.

Availability of data and materials

All data generated or analyzed during this study are included in this published article.

Authors' contributions

DW designed the experiments and revised the paper. BN, RJ and LW performed the experiments and wrote the paper. BN and LW analyzed the data. BN and DW read and revised the paper.

Ethics approval and consent to participate

All methods in this study were approved by the Research Medical Ethics Committee of Fudan University. All experimental protocols were performed in accordance with the Institutional Ethics Committee of the Animal Ethical Committee of Fudan University.

Patient consent for publication

Not applicable.

Competing interests

The authors declare they have no competing interests.

References

1 

Nelitz M and Reichel H: Nonsurgical treatment of developmental dysplasia of the hip. Orthopade. 37:550552–555. 2008.(In German). View Article : Google Scholar : PubMed/NCBI

2 

Yamamoto N: Changes of the acetabular cartilage following experimental subluxation of the hip joint in rabbits. Nihon Seikeigeka Gakkai zasshi. 57:1741–1753. 1983.(In Japanese). PubMed/NCBI

3 

Ibrahim S: Acetabular dysplasia after treatment for developmental dysplasia of the hip. J Bone Joint Surg Br. 87:10252005. View Article : Google Scholar : PubMed/NCBI

4 

Kim HT, Kim JI and Yoo CI: Acetabular development after closed reduction of developmental dislocation of the hip. J Pediatr Orthop. 20:701–708. 2000. View Article : Google Scholar : PubMed/NCBI

5 

Ma R, Ji S, Zhou Y, Liu W and Zhang L: Evolutionary regularity of acetabular dysplasia after reduction of developmental dislocation of the hip. Chin Med J (Engl). 110:346–348. 1997.PubMed/NCBI

6 

Nishii T, Sugano N, Sato Y, Tanaka H, Miki H and Yoshikawa H: Three-dimensional distribution of acetabular cartilage thickness in patients with hip dysplasia: A fully automated computational analysis of MR imaging. Osteoarthritis Cartilage. 12:650–657. 2004. View Article : Google Scholar : PubMed/NCBI

7 

Nishii T, Shiomi T, Tanaka H, Yamazaki Y, Murase K and Sugano N: Loaded cartilage T2 mapping in patients with hip dysplasia. Radiology. 256:955–965. 2010. View Article : Google Scholar : PubMed/NCBI

8 

Sijbrandij S: Dislocation of the hip in young rats produced experimentally by prolonged extension. J Bone Joint Surg Br. 47:792–795. 1965. View Article : Google Scholar : PubMed/NCBI

9 

Greenhill BJ, Hainau B, Ellis RD and el-Sayed RM: Acetabular changes in an experimental model of developmental dysplasia of the hip (DDH). J Pediatr Orthop. 15:789–793. 1995. View Article : Google Scholar : PubMed/NCBI

10 

Bo N, Peng W, Xinghong P and Ma R: Early cartilage degeneration in a rat experimental model of developmental dysplasia of the hip. Connect Tissue Res. 53:513–520. 2012. View Article : Google Scholar : PubMed/NCBI

11 

Casali PG and Blay JY; ESMO/CONTICANET/EUROBONET Consensus Panel of Expert, : Gastrointestinal stromal tumours: ESMO clinical practice guidelines for diagnosis, treatment and follow-up. Ann Oncol. 21 Suppl 5:v98–v102. 2010. View Article : Google Scholar : PubMed/NCBI

12 

Ning B, Sun J, Yuan Y, Yao J, Wang P and Ma R: Early articular cartilage degeneration in a developmental dislocation of the hip model results from activation of β-catenin. Int J Clin Exp Pathol. 7:1369–1378. 2014.PubMed/NCBI

13 

da Silva MA, Yamada N, Clarke NM and Roach HI: Cellular and epigenetic features of a young healthy and a young osteoarthritic cartilage compared with aged control and OA cartilage. J Orthop Res. 27:593–601. 2009. View Article : Google Scholar : PubMed/NCBI

14 

Kremli MK, Alshahid AH, Khoshhal KI and Zamzam MM: The pattern of developmental dysplasia of the hip. Saudi Med J. 24:1118–1120. 2003.PubMed/NCBI

15 

Manning WK and Bonner WM Jr: Isolation and culture of chondrocytes from human adult articular cartilage. Arthritis Rheum. 10:235–239. 1967. View Article : Google Scholar : PubMed/NCBI

16 

Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods. 25:402–408. 2001. View Article : Google Scholar : PubMed/NCBI

17 

Raab P, Lohr J and Krauspe R: Remodeling of the acetabulum after experimental hip joint dislocation-an animal experiment study of the rabbit. Z Orthop Ihre Grenzgeb. 136:519–524. 1998. View Article : Google Scholar : PubMed/NCBI

18 

Ning B, Yuan Y, Yao J, Zhang S and Sun J: Analyses of outcomes of one-stage operation for treatment of late-diagnosed developmental dislocation of the hip: 864 hips followed for 3.2 to 8.9 years. BMC Musculoskelet Disord. 15:4012014. View Article : Google Scholar : PubMed/NCBI

19 

Tsuji Y, Takeshita H, Kusuzaki K, Hirasawa Y, Ueda K and Ashihara T: Cell proliferation and differentiation of cultured chondrocytes isolated from growth plate cartilage of rat rib. Nihon Geka Hokan. 64:50–63. 1995.PubMed/NCBI

20 

Hunter CJ, Imler SM, Malaviya P, Nerem RM and Levenston ME: Mechanical compression alters gene expression and extracellular matrix synthesis by chondrocytes cultured in collagen I gels. Biomaterials. 23:1249–1259. 2002. View Article : Google Scholar : PubMed/NCBI

21 

Garcia M and Knight MM: Cyclic loading opens hemichannels to release ATP as part of a chondrocyte mechanotransduction pathway. J Orthop Res. 28:510–515. 2010.PubMed/NCBI

22 

Bougault C, Paumier A, Aubert-Foucher E and Mallein-Gerin F: Molecular analysis of chondrocytes cultured in agarose in response to dynamic compression. BMC Biotechnol. 8:712008. View Article : Google Scholar : PubMed/NCBI

23 

De Croos JN, Dhaliwal SS, Grynpas MD, Pilliar RM and Kandel RA: Cyclic compressive mechanical stimulation induces sequential catabolic and anabolic gene changes in chondrocytes resulting in increased extracellular matrix accumulation. Matrix Biology. 25:323–331. 2006. View Article : Google Scholar : PubMed/NCBI

24 

Villanueva I, Gladem SK, Kessler J and Bryant SJ: Dynamic loading stimulates chondrocyte biosynthesis when encapsulated in charged hydrogels prepared from poly (ethylene glycol) and chondroitin sulfate. Matrix Biol. 29:51–62. 2010. View Article : Google Scholar : PubMed/NCBI

25 

Ando K, Imai S, Isoya E, Kubo M, Mimura T, Shioji S, Ueyama H and Matsusue Y: Effect of dynamic compressive loading and its combination with a growth factor on the chondrocytic phenotype of 3-dimensional scaffold-embedded chondrocytes. Acta Orthop. 80:724–733. 2009. View Article : Google Scholar : PubMed/NCBI

26 

Abusara Z, Seerattan R, Leumann A, Thompson R and Herzog W: A novel method for determining articular cartilage chondrocyte mechanics in vivo. J Biomech. 44:930–934. 2011. View Article : Google Scholar : PubMed/NCBI

27 

Rolauffs B, Williams JM, Aurich M, Grodzinsky AJ, Kuettner KE and Cole AA: Proliferative remodeling of the spatial organization of human superficial chondrocytes distant from focal early osteoarthritis. Arthritis Rheum. 62:489–498. 2010.PubMed/NCBI

28 

Shields KJ, Beckman MJ, Bowlin GL and Wayne JS: Mechanical properties and cellular proliferation of electrospun collagen type II. Tissue Eng. 10:1510–1517. 2004. View Article : Google Scholar : PubMed/NCBI

29 

Sivan SS, Wachtel E and Roughley P: Structure, function, aging and turnover of aggrecan in the intervertebral disc. Biochim Biophys Acta. 1840:3181–3189. 2014. View Article : Google Scholar : PubMed/NCBI

30 

Kiani C, Chen L, Wu YJ, Yee AJ and Yang BB: Structure and function of aggrecan. Cell Res. 12:19–32. 2002. View Article : Google Scholar : PubMed/NCBI

31 

Nagase H and Kashiwagi M: Aggrecanases and cartilage matrix degradation. Arthritis Res Ther. 5:94–103. 2003. View Article : Google Scholar : PubMed/NCBI

32 

van Meurs JB, van Lent PL, Holthuysen AE, Singer II, Bayne EK and van den Berg WB: Kinetics of aggrecanase- and metalloproteinase-induced neoepitopes in various stages of cartilage destruction in murine arthritis. Arthritis Rheum. 42:1128–1139. 1999. View Article : Google Scholar : PubMed/NCBI

33 

van Lent PL, Grevers LC, Blom AB, Arntz OJ, van de Loo FA, Van der Kraan P, Abdollahi-Roodsaz S, Srikrishna G, Freeze H, Sloetjes A, et al: Stimulation of chondrocyte-mediated cartilage destruction by S100A8 in experimental murine arthritis. Arthritis Rheum. 58:3776–3787. 2008. View Article : Google Scholar : PubMed/NCBI

34 

Narmoneva DA, Cheung HS, Wang JY, Howell DS and Setton LA: Altered swelling behavior of femoral cartilage following joint immobilization in a canine model. J Orthop Res. 20:83–91. 2002. View Article : Google Scholar : PubMed/NCBI

35 

Hagiwara Y, Ando A, Chimoto E, Saijo Y, Ohmori-Matsuda K and Itoi E: Changes of articular cartilage after immobilization in a rat knee contracture model. J Orthop Res. 27:236–242. 2009. View Article : Google Scholar : PubMed/NCBI

36 

Tchetina EV, Squires G and Poole AR: Increased type II collagen degradation and very early focal cartilage degeneration is associated with upregulation of chondrocyte differentiation related genes in early human articular cartilage lesions. J Rheumatol. 32:876–886. 2005.PubMed/NCBI

37 

Haapala J, Arokoski JP, Hyttinen MM, Lammi M, Tammi M, Kovanen V, Helminen HJ and Kiviranta I: Remobilization does not fully restore immobilization induced articular cartilage atrophy. Clin Orthop Relat Res. 1–229. 1999.PubMed/NCBI

38 

Borzi RM, Olivotto E, Pagani S, Vitellozzi R, Neri S, Battistelli M, Falcieri E, Facchini A, Flamigni F, Penzo M, et al: Matrix metalloproteinase 13 loss associated with impaired extracellular matrix remodeling disrupts chondrocyte differentiation by concerted effects on multiple regulatory factors. Arthritis Rheum. 62:2370–2381. 2010. View Article : Google Scholar : PubMed/NCBI

39 

Karsdal MA, Madsen SH, Christiansen C, Henriksen K, Fosang AJ and Sondergaard BC: Cartilage degradation is fully reversible in the presence of aggrecanase but not matrix metalloproteinase activity. Arthritis Res Ther. 10:R632008. View Article : Google Scholar : PubMed/NCBI

40 

Breckon JJ, Hembry RM, Reynolds JJ and Meikle MC: Regional and temporal changes in the synthesis of matrix metalloproteinases and TIMP-1 during development of the rabbit mandibular condyle. J Anat. 184:99–110. 1994.PubMed/NCBI

41 

Selvamurugan N, Jefcoat SC, Kwok S, Kowalewski R, Tamasi JA and Partridge NC: Overexpression of Runx2 directed by the matrix metalloproteinase-13 promoter containing the AP-1 and Runx/RD/Cbfa sites alters bone remodeling in vivo. J Cell Biochem. 99:545–557. 2006. View Article : Google Scholar : PubMed/NCBI

42 

Tetsunaga T, Nishida K, Furumatsu T, Naruse K, Hirohata S, Yoshida A, Saito T and Ozaki T: Regulation of mechanical stress-induced MMP-13 and ADAMTS-5 expression by RUNX-2 transcriptional factor in SW1353 chondrocyte-like cells. Osteoarthritis Cartilage. 19:222–232. 2011. View Article : Google Scholar : PubMed/NCBI

43 

Aigner T, Stoss H, Weseloh G, Zeiler G and von der Mark K: Activation of collagen type II expression in osteoarthritic and rheumatoid cartilage. Virchows Arch B Cell Pathol Incl Mol Pathol. 62:337–345. 1992. View Article : Google Scholar : PubMed/NCBI

44 

Aigner T, Bertling W, Stöss H, Weseloh G and von der Mark K: Independent expression of fibril-forming collagens I, II, and III in chondrocytes of human osteoarthritic cartilage. J Clin Invest. 91:829–837. 1993. View Article : Google Scholar : PubMed/NCBI

45 

Aigner T, Vornehm SI, Zeiler G, Dudhia J, von der Mark K and Bayliss MT: Suppression of cartilage matrix gene expression in upper zone chondrocytes of osteoarthritic cartilage. Arthritis Rheum. 40:562–569. 1997. View Article : Google Scholar : PubMed/NCBI

46 

Hotta H, Yamada H, Takaishi H, Abe T, Morioka H, Kikuchi T, Fujikawa K and Toyama Y: Type II collagen synthesis in the articular cartilage of a rabbit model of osteoarthritis: Expression of type II collagen C-propeptide and mRNA especially during early-stage osteoarthritis. J Orthop Sci. 10:595–607. 2005. View Article : Google Scholar : PubMed/NCBI

47 

Park K, Min BH, Han DK and Hasty K: Quantitative analysis of temporal and spatial variations of chondrocyte behavior in engineered cartilage during long-term culture. Ann Biomed Eng. 35:419–428. 2007. View Article : Google Scholar : PubMed/NCBI

Related Articles

Journal Cover

October-2018
Volume 18 Issue 4

Print ISSN: 1791-2997
Online ISSN:1791-3004

Sign up for eToc alerts

Recommend to Library

Copy and paste a formatted citation
x
Spandidos Publications style
Ning B, Jin R, Wan L and Wang D: Cellular and molecular changes to chondrocytes in an in vitro model of developmental dysplasia of the hip‑an experimental model of DDH with swaddling position. Mol Med Rep 18: 3873-3881, 2018
APA
Ning, B., Jin, R., Wan, L., & Wang, D. (2018). Cellular and molecular changes to chondrocytes in an in vitro model of developmental dysplasia of the hip‑an experimental model of DDH with swaddling position. Molecular Medicine Reports, 18, 3873-3881. https://doi.org/10.3892/mmr.2018.9384
MLA
Ning, B., Jin, R., Wan, L., Wang, D."Cellular and molecular changes to chondrocytes in an in vitro model of developmental dysplasia of the hip‑an experimental model of DDH with swaddling position". Molecular Medicine Reports 18.4 (2018): 3873-3881.
Chicago
Ning, B., Jin, R., Wan, L., Wang, D."Cellular and molecular changes to chondrocytes in an in vitro model of developmental dysplasia of the hip‑an experimental model of DDH with swaddling position". Molecular Medicine Reports 18, no. 4 (2018): 3873-3881. https://doi.org/10.3892/mmr.2018.9384