Open Access

Expression pattern of placenta specific 8 and keratin 20 in different types of gastrointestinal cancer

  • Authors:
    • Chih‑Sheng Hung
    • Yen‑Chieh Wang
    • Jiun‑Wen Guo
    • Ruey‑Neng Yang
    • Chia‑Long Lee
    • Ming‑Hung Shen
    • Chi‑Cheng Huang
    • Chi‑Jung Huang
    • Jhih‑Yun Yang
    • Chih‑Yi Liu
  • View Affiliations

  • Published online on: December 6, 2019     https://doi.org/10.3892/mmr.2019.10871
  • Pages: 659-666
  • Copyright: © Hung et al. This is an open access article distributed under the terms of Creative Commons Attribution License.

Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )


Abstract

The aim of the present study was to investigate the expression of keratin 20 (KRT20) and placenta specific 8 (PLAC8) in gastrointestinal (GI) cancer with various differentiation phenotypes. The present study retrospectively investigated archived formalin‑fixed paraffin‑embedded tissue samples from 12 patients at different stages of GI cancer [four with gastric cancer, four with pancreatic cancer and four with colorectal cancer (CRC)]. The stages were pre‑determined, according to differentiation phenotypes, by a pathologist of the Department of Pathology at Sijhih Cathay General Hospital. KRT20 and PLAC8 expression levels were assessed using immunohistochemistry. The CRC cell lines SW620 and Caco‑2 were used to assess interactions between KRT20 and PLAC8 via reverse transcription‑quantitative PCR. PLAC8 and KRT20 expression was observed consistently only in the well‑differentiated CRC tissue samples. Low KRT20 expression levels were observed in the PLAC8 knockdown SW620 cells. In addition, there was a positive association between PLAC8 and KRT20 expression in the differentiated Caco‑2 cells. According to the results of the present study, the differentiation status of GI cancer influenced KRT20 expression, particularly in CRC, which may explain why patients with well‑differentiated CRC display better clinical outcomes. Therefore, the prognostic significance of KRT20 and PLAC8 may be particularly crucial for patients with CRC displaying a well‑differentiated phenotype.

Introduction

Gastrointestinal (GI) cancer develops in the organs of the alimentary canal, including the esophagus, liver and bile ducts, gallbladder, pancreas, stomach and small and large intestines (1). Although some distinct mutations have been reported in different GI organs, GI tumors display several key molecular alterations (2,3).

Keratins (KRTs) are a family of fibrous structural proteins that are present in normal epithelia, however, some are upregulated in neoplasms (4). The differential expression of KRTs facilitates the diagnosis of several tumors, including GI tumors, using molecular techniques and allows KRTs to be used as biomarkers to discriminate primary from metastatic adenocarcinoma (58). In addition, KRTs have long been considered epithelial differentiation markers (9) and the differentiation of cells within the GI tract is associated with an increased susceptibility to GI cancer (10,11).

In addition to being involved in conventional tumorigenesis, epithelial-mesenchymal transition (EMT) plays key roles in cellular differentiation and cancer progression (12,13). KRTs have been reported to be aberrant in cells undergoing EMT (14,15). For example, the detection of KRT20-positive circulating tumor cells is associated with worse prognosis in patients with colorectal cancer (CRC) (16). In addition to structural KRTs, other genes often exhibit dysregulated expression during EMT. Previously, placenta specific 8 (PLAC8), a gene expressed under physiological conditions, was reported to play a key role in the tumorigenic and EMT pathways in a number of types of human cancer, such as CRC or pancreatic cancer (CaP) (17,18). PLAC8 was expressed at high levels in the GI tract and KRT20 expression patterns were highly specific (1921). In addition, elevated PLAC8 levels are positively associated with tumor metastasis and recurrence in CRC (18,22). Understanding the interaction between KRT20 and PLAC8 could have clinical implications for the treatment of GI cancer. In the present study, immunostaining was employed to detect the expression of KRT20 and PLAC8 in the tissues of patients with GI cancer [gastric cancer (GC), CaP and CRC]. Furthermore, the mRNA levels of KRT20 in CRC cells displaying differential PLAC8 expression were quantified.

Materials and methods

Tissues and cell lines

Archived 4 µm formalin-fixed paraffin-embedded (FFPE) tissue sections from four GC, four CaP and four CRC patients who had undergone surgery at the Department of Surgery of Cathay General Hospital before December, 2000 were obtained and used in the present study. All procedures were approved by the Cathay General Hospital Institutional Ethics Committee and a waiver of consent was approved by the same committee. Patient information was anonymized.

For each cancer (GC, CaP and CRC), two patients had well-differentiated cancer [one at American Joint Committee on Cancer (AJCC) stage II and one at stage III] and two had poorly differentiated cancer (one at AJCC stage II and one at stage III) (23). Cancer diagnoses were performed by a pathologist. The human CRC cell lines SW620 [cat. no. CRL-1831; AJCC stage III) and Caco-2 (cat. no. HTB-37) were obtained from the American Type Culture Collection (ATCC) and the medium suggested by the ATCC for each cell line was used for culture; Leibovitz's L-15 medium for SW620 cells and the Eagle's Minimum Essential medium for Caco-2 cells. The two CRC cell lines were selected due to their high PLAC8 expression levels (SW620 cells) (24) and their differentiation capacity (Caco-2 cells) (25). SW620 cells were incubated at 37°C and 100% air (with very low CO2) in a humidified incubator and subcultured 2 to 3 times per week (25). To induce intestinal differentiation, Caco-2 cells were cultured to confluence in a humidified incubator at 37°C with 5% CO2 for 21 days, as described in a previous study (25).

PLAC8 knockdown and detection of PLAC8 mRNA level in CRC cells

PLAC8 mRNA levels were knocked down in SW620 cells using a lentivirus-mediated small hairpin (sh) RNA targeting PLAC8 to obtain shPLAC8-SW620 cells. Control (shLUC-SW620) cells were obtained using a lentivirus-mediated shRNA targeting luciferase (25). The lentiviruses and the protocol for lentivirus infection were acquired from the National RNAi Core Facility of Academia Sinica. Briefly, 1×106 SW620 cells were grown in a 10 cm plate for 24 h, and then infected with lentivirus at a multiplicity of infection of 3. Stable infected cells were selected and maintained in medium containing 2 µg/ml puromycin for 48 h (Thermo Fisher Scientific, Inc.). The total RNA of the transfected cells was then extracted using RNAzol® RT (Molecular Research Center) and reverse transcribed into cDNA using a high-capacity cDNA Reverse Transcription kit (Catalog No. 4368813; Thermo Fisher Scientific, Inc.) in the presence of oligo(dT) primers, according to the manufacturer's instructions. The level of mRNA was considered as the gene expression level and was measured by PCR in the presence of specific amplification primers (Table I), a TaqMan probe and TaqMan master mix (Roche Diagnostics GmbH), according to the manufacturer's instructions. Cycling conditions were: 2 min at 50°C and 10 min at 95°C, followed by 50 cycles each consisting of 15 sec at 95°C and 1 min at 60°C. mRNA levels were adjusted relative to the level of GAPDH to estimate the relative levels of gene expression with the method of the 2−ΔΔCq method (26). LightCycler (version 4.05; Roche Diagnostics GmbH) was used to analyze the PCR kinetics.

Table I.

Quantitative PCR primers.

Table I.

Quantitative PCR primers.

Primers (5′ → 3′)

GeneForwardReverse
PLAC8 CGTCGCAATGAGGACTCTCT CTCTTGATTTGGCAAAGAGTACAA
KRT20 CAGTCCCATCTCAGCATGAA ACAGCGACTGGAGGTTGG
GAPDH CTCTGCTCCTCCTGTTCGAC ACGACCAAATCCGTTGACTC

[i] PLAC8, placenta specific 8; KRT20, keratin 20.

Immunohistochemical staining of PLAC8 and KRT20 in the archived FFPE tissue sections

For the PLAC8 immunohistochemical staining, a VECTASTAIN® Elite ABC kit (Vector Laboratories, Inc.) was used according to the manufacturer's instructions. Briefly, cancer tissue sections were incubated in oven at 65°C for 30 min to deparaffinize, and then each tissue was rehydrated with 100, 90 and 70% ethanol, sequentially. The rehydrated slides were immersed in citrate buffer (10 mM; pH 6.0), boiled (95–99°C) for 20 min and then cooled to room temperature for 20 min. To inactivate endogenous peroxidases within the tissues, the slides were incubated for 30 min at room temperature in 3% methanolic hydrogen peroxide. The tissue sections were then blocked for 30 min at room temperature using a blocking solution with 5% rabbit serum (Vector Laboratories, Inc.) and incubated overnight at 4°C with anti-PLAC8 antibody (1:200; cat. no. ab122652; Abcam) or anti-KRT20 antibody (1:200; cat. no. ab76126; Abcam). After washing the tissues several times with Tris-buffered saline, the samples were incubated with a secondary biotinylated goat anti-rabbit IgG antibody (1:200; cat. no. BA-1000; Vector Laboratories) for 1 h at room temperature. Subsequently, the slides were stained with 3-amino-9-ethylcarbazole (DAKO; Agilent Technologies, Inc.) for 1 min at room temperature to visualize PLAC8 and KRT20. Tissues were stained with hematoxylin for 4 min and then with eosin for another 1.5 min at room temperature for identification of normal and tumor areas. The stained sections were subsequently diagnosed by a pathologist via a light microscope Olympus BX41 with magnification at ×200 (Olympus Corp.). Then, the GI cancer tissue sections were divided into two differentiation states (well or moderately differentiated, >50% glandular formation and poorly differentiated, 0–49% glandular formation) (27).

Statistical analysis

Data were presented as mean ± standard deviation. The relative expression levels of PLAC8 and KRT20 in cells were compared between samples using the Student's t-test. All statistical analyses were performed using SPSS (version 19; IBM Corp.). P<0.05 was considered to indicate a statistically significant difference.

Results

PLAC8 and KRT20 expression in well-differentiated GI stage II and III cancer cells

Cellular KRT20 and PLAC8 proteins were detected in each of the cancer tissues using immunohistochemistry. In the well-differentiated GC cancer tissues, PLAC8 levels were low and tissues were KRT20-positive regardless of tumor stage (Fig. 1). Conversely, tissues were positive for both PLAC8 and KRT20 in the well-differentiated CaP tissues at stages II and III, but PLAC8 displayed a luminal staining pattern (Fig. 2). In addition to the expression patterns in the well-differentiated GC and CaP cases, the expression patterns of PLAC8 and KRT20 were also immunodetected in well-differentiated CRC cases (Fig. 3). PLAC8 signals were consistently low in the well-differentiated CRC at stage II (the left panel of Fig. 3), but the small number of PLAC8-positive CRC cells appeared to also express KRT20. Furthermore, a co-expression of PLAC8 and KRT20 was observed in the well-differentiated CRC cells at stage III (the right panel of Fig. 3).

PLAC8 and KRT20 expression in the poorly differentiated GI cancer cells at stages II and III

Immunohistochemical staining revealed that although poorly differentiated GC tissues expressed similar levels of PLAC8 at stage II and III (the middle panel of Fig. 4), these tissues expressed higher levels of KRT20 at stage III compared to stage II (the bottom panel of Fig. 4). Conversely, the poorly differentiated CaP at stage II displayed higher levels of PLAC8 compared with the CaP tissues at stage III, and KRT20 levels were low in the poorly differentiated CaP at both stage II and III (Fig. 5). The PLAC8 and KRT20 expression patterns in poorly differentiated CRC were different from those in well-differentiated CRC (Fig. 6). PLAC8 expression was higher in the poorly differentiated CRC tissue at stage III than at stage II (the middle panel of Fig. 6). However, the late tumor stage (stage III) did not appear to increase the expression of KRT20 in the poorly differentiated CRC tissue.

PLAC8 and KRT20 expression levels in transfected and differentiated CRC cell lines

PLAC8 expression was knocked down in SW620 cells, displayed by an 80% decrease in PLAC8 mRNA levels (shPLAC8-SW620) compared with the levels in the control cells (shLUC-SW620; Fig. 7A). The KRT20 mRNA levels in the shPLAC8-SW620 cells also decreased by 76% compared with the levels in the control cells (Fig. 7A). The mRNA levels of both PLAC8 and KRT20 in the differentiated Caco-2 cells (day 21) decreased by 72 and 85%, respectively, compared with the levels in the day 1 Caco-2 cells (Fig. 7B).

Discussion

In clinical settings, patients with different types of GI cancer should be diagnosed using appropriate biomarkers, even though gut-derived adenocarcinomas display similar genetic alterations (2832). Lukyanchuk et al (33) reported that KRT20 had clinical significance in GI cancer, including GC, CaP and CRC. Thus, the present study focused on investigating KRT20 and PLAC8 expression in these types of GI cancer. In the present study, the aberrant co-expression of the cytoplasmic protein PLAC8 and the cytokeratin KRT20 were found in the well-differentiated CRC at stage III, but this expression pattern was not observed in poorly differentiated CRC. No such co-expression was observed in the GC and CaP tissue sections, regardless of tumor stage and differentiation state. CRC tissues at stages II and III have been frequently studied to improve prognosis and to avoid the incorrect use of chemotherapeutic agents (34,35).

Cytoskeletal rearrangement is required for cell migration and invasion, which are key steps in cancer metastasis (36,37). Highly dynamic biological processes of cytoskeletal organization in cancer have been extensively explored (3842). Among the different cytoskeletal molecules, KRTs might be the most examined based on clinical significance (43,44), and several KRTs have been previously studied from a tumor progression perspective (4547). For example, previous studies have reported that upregulation of KRT17 and KRT19 may be involved in tumor metastasis (5,48) and that KRT18 and KRT19 are associated with colorectal malignancy (4952). In addition, aberrant KRT20 expression has been observed in generalized GI cancer (16,19,53) and is recognized as a marker of circulating CRC cells (54). Therefore, KRT20 could be a suitable marker for the evaluation of the primary origin of GI cancer, including CRC (19,55).

PLAC8, a novel oncogenic marker that mediates tumor progression, has also been reported to play a key role in the EMT of CRC (18,22). In the present study, an association between KRT20 and PLAC8 expression was observed in CRC cells. The KRT20 mRNA levels decreased in the PLAC8-knockdown SW620 CRC cells, which were diagnosed as AJCC stage III. In addition, the intestinal differentiation of Caco-2 cells was used to evaluate the well-differentiated state of GI cancer (56,57). Such spontaneously differentiated Caco-2 cells displayed decreasing levels of KRT20 and PLAC8 expression upon differentiation. The Caco-2 cell line, which is applied extensively as an intestinal epithelial barrier model, displays favorable differentiation in a continuous culture (58,59). In addition, the positive association between KRT20 and PLAC8 expression levels in the well-differentiated CRC was confirmed by immunostaining of archived FFPE tissue sections. The FFPE tissue sections of other well-differentiated GI cancer (GC and CaP) at stages II and III did not display patterns similar to those of CRC and no association between PLAC8 and KRT20 expression levels were observed in the three poorly differentiated GI cancer tissues (GC, CaP and CRC). The results from the present study suggested that understanding the expression of PLAC8 and KRT20 could be critical for predicting the prognosis of patients with CRC.

Experiments exploring the molecular heterogeneity of CRC could facilitate the formulation of effective therapies (60,61). CRC development and progression is a complex process involving multiple genetic changes (6264). The genes involved in CRC tumorigenesis should therefore be identified for clinical applications (65). Chemotherapy, target molecule therapy (with vascular endothelial growth factor or epidermal growth factor receptor) and immunotherapy (anti-programmed death-1) lead to increased survival rates and decreased recurrence rates in CRC (6668). Imai et al (69) revealed that the KRT20 expression was closely associated with the invasive histological phenotype in poorly differentiated colorectal adenocarcinoma. However, in the present study, it was suggested that the differentiation status of GI cancer may influence KRT20 expression, particularly in CRC.

A recent animal study reported that PLAC8 expression might be associated with the gut microbiota (70) and others detected that aberrant KRT20 expression is induced by altering the gut microbiota (71). Taken together, these results implied that KRT20 and PLAC8 might work cooperatively in different types of GI cancer. The present study suggested that PLAC8 expression could influence KRT20 expression. Therefore, it could be hypothesized that a well-differentiated CRC may have poor prognosis if KRT20 is induced via the upregulation of PLAC8. Conversely, the downregulation of PLAC8 may reduce the expression levels of KRT20. These suggested molecular dynamics imply that RNA interference of PLAC8 expression could be used as a therapeutic technique for the treatment of GI cancer at stages II and III. A similar concept that uses small interfering RNA as a cancer therapeutic agent has been explored extensively (7274). In addition, PLAC8 promotes tumor growth, invasion and metastasis in other tumors, which could explain why patients with well-differentiated CRC display different clinical outcomes, in comparison with the patients with poorly-differentiated CRC (17,22,75,76). Therefore, the prognostic significance of KRT20 and PLAC8 could be particularly essential for patients with CRC displaying well-differentiated phenotypes.

Acknowledgements

Not applicable.

Funding

The present study was supported by the fund (grant no. 2018 to Chi-Jung Huang) from The Department of Medical Research of Cathay General Hospital.

Availability of data and materials

All data generated or analyzed during this study are included in this published article.

Authors' contributions

CSH, YCW and CYL designed the study. CSH and CYL wrote the initial version of the manuscript. JWG and CCH performed the cell studies. JWG, JYY and CYL performed the immunostaining and pathologic diagnosis. RNY, CLL, MHS and CCH interpreted the patient data regarding the well-differentiated and poorly-differentiated CRC. CCH and CJH performed the statistical analyses. CYL provided supervision throughout the study. All authors discussed, modified and approved of the final version.

Ethics approval and consent to participate

All procedures were approved by The Cathay General Hospital Institutional Ethics Committee and a waiver of consent was approved by the same committee.

Patient consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

References

1 

Keighley MR: Gastrointestinal cancers in europe. Aliment Pharmacol Ther. 18:7–30. 2003. View Article : Google Scholar : PubMed/NCBI

2 

Liu Y, Sethi NS, Hinoue T, Schneider BG, Cherniack AD, Sanchez-Vega F, Seoane JA, Farshidfar F, Bowlby R, Islam M, et al: Comparative molecular analysis of gastrointestinal adenocarcinomas. Cancer Cell. 33:721–735. 2018. View Article : Google Scholar : PubMed/NCBI

3 

Vedeld HM, Andresen K, Eilertsen IA, Nesbakken A, Seruca R, Gladhaug IP, Thiis-Evensen E, Rognum TO, Boberg KM and Lind GE: The novel colorectal cancer biomarkers CDO1, ZSCAN18 and ZNF331 are frequently methylated across gastrointestinal cancers. Int J Cancer. 136:844–853. 2015. View Article : Google Scholar : PubMed/NCBI

4 

Moll R, Levy R, Czernobilsky B, Hohlweg-Majert P, Dallenbach-Hellweg G and Franke WW: Cytokeratins of normal epithelia and some neoplasms of the female genital tract. Lab Invest. 49:599–610. 1983.PubMed/NCBI

5 

Kim HS, Lee JJ, Do SI, Kim K, Do IG, Kim DH, Chae SW and Sohn JH: Overexpression of cytokeratin 17 is associated with the development of papillary thyroid carcinoma and the presence of lymph node metastasis. Int J Clin Exp Pathol. 8:5695–5701. 2015.PubMed/NCBI

6 

Osborn M, van Lessen G, Weber K, Kloppel G and Altmannsberger M: Differential diagnosis of gastrointestinal carcinomas by using monoclonal antibodies specific for individual keratin polypeptides. Lab Invest. 55:497–504. 1986.PubMed/NCBI

7 

Tang KD, Kenny L, Perry C, Frazer I and Punyadeera C: The overexpression of salivary cytokeratins as potential diagnostic biomarkers in head and neck squamous cell carcinomas. Oncotarget. 8:72272–72280. 2017.PubMed/NCBI

8 

Tot T: Cytokeratins 20 and 7 as biomarkers: Usefulness in discriminating primary from metastatic adenocarcinoma. Eur J Cancer. 38:758–763. 2002. View Article : Google Scholar : PubMed/NCBI

9 

Fuchs E: Keratins as biochemical markers of epithelial differentiation. Trends Genet. 4:277–281. 1988. View Article : Google Scholar : PubMed/NCBI

10 

Lipkin M: Biomarkers of increased susceptibility to gastrointestinal cancer: New application to studies of cancer prevention in human subjects. Cancer Res. 48:235–245. 1988.PubMed/NCBI

11 

Mills JC and Sansom OJ: Reserve stem cells: Differentiated cells reprogram to fuel repair, metaplasia, and neoplasia in the adult gastrointestinal tract. Sci Signal. 8:re82015. View Article : Google Scholar : PubMed/NCBI

12 

Kalluri R and Weinberg RA: The basics of epithelial-mesenchymal transition. J Clin Invest. 119:1420–1428. 2009. View Article : Google Scholar : PubMed/NCBI

13 

Chen T, You Y, Jiang H and Wang ZZ: Epithelial-mesenchymal transition (EMT): A biological process in the development, stem cell differentiation, and tumorigenesis. J Cell Physiol. 232:3261–3272. 2017. View Article : Google Scholar : PubMed/NCBI

14 

Zou XZ, Liu T, Gong ZC, Hu CP and Zhang Z: MicroRNAs-Mediated epithelial-mesenchymal transition in fibrotic diseases. Eur J Pharmacol. 796:190–206. 2017. View Article : Google Scholar : PubMed/NCBI

15 

Serrano MJ, Ortega FG, Alvarez-Cubero MJ, Nadal R, Sanchez-Rovira P, Salido M, Rodriguez M, Garcia-Puche JL, Delgado-Rodriguez M, Sole F, et al: EMT and EGFR in CTCs cytokeratin negative non-metastatic breast cancer. Oncotarget. 5:7486–7497. 2014. View Article : Google Scholar : PubMed/NCBI

16 

Hinz S, Hendricks A, Wittig A, Schafmayer C, Tepel J, Kalthoff H, Becker T and Roder C: Detection of circulating tumor cells with CK20 RT-PCR is an independent negative prognostic marker in colon cancer patients-a prospective study. BMC Cancer. 17:532017. View Article : Google Scholar : PubMed/NCBI

17 

Chang WL, Liu YW, Dang YL, Jiang XX, Xu H, Huang X, Wang YL, Wang H, Zhu C, Xue LQ, et al: PLAC8, a new marker for human interstitial extravillous trophoblast cells, promotes their invasion and migration. Development. 145:dev1489322018. View Article : Google Scholar : PubMed/NCBI

18 

Li C, Ma H, Wang Y, Cao Z, Graves-Deal R, Powell AE, Starchenko A, Ayers GD, Washington MK, Kamath V, et al: Excess PLAC8 promotes an unconventional ERK2-dependent EMT in colon cancer. J Clin Invest. 124:2172–2187. 2014. View Article : Google Scholar : PubMed/NCBI

19 

Miettinen M: Keratin 20: Immunohistochemical marker for gastrointestinal, urothelial, and merkel cell carcinomas. Mod Pathol. 8:384–388. 1995.PubMed/NCBI

20 

Moll R, Divo M and Langbein L: The human keratins: Biology and pathology. Histochem Cell Biol. 129:705–733. 2008. View Article : Google Scholar : PubMed/NCBI

21 

Rogulski K, Li Y, Rothermund K, Pu L, Watkins S, Yi F and Prochownik EV: Onzin, a c-Myc-repressed target, promotes survival and transformation by modulating the Akt-Mdm2-p53 pathway. Oncogene. 24:7524–7541. 2005. View Article : Google Scholar : PubMed/NCBI

22 

Jia Y, Ying X, Zhou J, Chen Y, Luo X, Xie S, Wang QC, Hu W and Wang L: The novel KLF4/PLAC8 signaling pathway regulates lung cancer growth. Cell Death Dis. 9:6032018. View Article : Google Scholar : PubMed/NCBI

23 

Amin MB, Greene FL, Edge SB, Compton CC, Gershenwald JE, Brookland RK, Meyer L, Gress DM, Byrd DR and Winchester DP: The eighth edition AJCC cancer staging manual: Continuing to build a bridge from a population-based to a more ‘personalized’ approach to cancer staging. CA Cancer J Clin. 67:93–99. 2017. View Article : Google Scholar : PubMed/NCBI

24 

Lee CL, Huang CJ, Yang SH, Chang CC, Huang CC, Chien CC and Yang RN: Discovery of genes from feces correlated with colorectal cancer progression. Oncol Lett. 12:3378–3384. 2016. View Article : Google Scholar : PubMed/NCBI

25 

Huang CJ, Lee CL, Yang SH, Chien CC, Huang CC, Yang RN and Chang CC: Upregulation of the growth arrest-specific-2 in recurrent colorectal cancers, and its susceptibility to chemotherapy in a model cell system. Biochim Biophys Acta. 1862:1345–1353. 2016. View Article : Google Scholar : PubMed/NCBI

26 

Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods. 25:402–408. 2001. View Article : Google Scholar : PubMed/NCBI

27 

Washington MK, Berlin J, Branton P, Burgart LJ, Carter DK, Fitzgibbons PL, Halling K, Frankel W, Jessup J, Kakar S, et al: Protocol for the examination of specimens from patients with primary carcinoma of the colon and rectum. Arch Pathol Lab Med. 133:1539–1551. 2009.PubMed/NCBI

28 

Duffy MJ, Lamerz R, Haglund C, Nicolini A, Kalousova M, Holubec L and Sturgeon C: Tumor markers in colorectal cancer, gastric cancer and gastrointestinal stromal cancers: European group on tumor markers 2014 guidelines update. Int J Cancer. 134:2513–2522. 2014. View Article : Google Scholar : PubMed/NCBI

29 

Dolscheid-Pommerich RC, Manekeller S, Walgenbach- Brunagel G, Kalff JC, Hartmann G, Wagner BS and Holdenrieder S: Clinical performance of CEA, CA19-9, CA15-3, CA125 and AFP in gastrointestinal cancer using LOCI-based assays. Anticancer Res. 37:353–359. 2017. View Article : Google Scholar : PubMed/NCBI

30 

Kumar Y, Tapuria N, Kirmani N and Davidson BR: Tumour M2-pyruvate kinase: A gastrointestinal cancer marker. Eur J Gastroenterol Hepatol. 19:265–276. 2007. View Article : Google Scholar : PubMed/NCBI

31 

Myllykangas S, Bohling T and Knuutila S: Specificity, selection and significance of gene amplifications in cancer. Semin Cancer Biol. 17:42–55. 2007. View Article : Google Scholar : PubMed/NCBI

32 

Myllykangas S, Himberg J, Bohling T, Nagy B, Hollmen J and Knuutila S: DNA copy number amplification profiling of human neoplasms. Oncogene. 25:7324–7332. 2006. View Article : Google Scholar : PubMed/NCBI

33 

Lukyanchuk VV, Friess H, Kleeff J, Osinsky SP, Ayuni E, Candinas D and Roggo A: Detection of circulating tumor cells by cytokeratin 20 and prostate stem cell antigen RT-PCR in blood of patients with gastrointestinal cancers. Anticancer Res. 23:2711–2716. 2003.PubMed/NCBI

34 

Dalerba P, Sahoo D, Paik S, Guo X, Yothers G, Song N, Wilcox-Fogel N, Forgo E, Rajendran PS, Miranda SP, et al: CDX2 as a prognostic biomarker in stage II and stage III colon cancer. N Engl J Med. 374:211–222. 2016. View Article : Google Scholar : PubMed/NCBI

35 

Pilati C, Taieb J, Balogoun R, Marisa L, de Reynies A and Laurent-Puig P: CDX2 prognostic value in stage II/III resected colon cancer is related to CMS classification. Ann Oncol. 28:1032–1035. 2017. View Article : Google Scholar : PubMed/NCBI

36 

Singh R, Kapur N, Mir H, Singh N, Lillard JW Jr and Singh S: CXCR6-CXCL16 axis promotes prostate cancer by mediating cytoskeleton rearrangement via Ezrin activation and alphavbeta3 integrin clustering. Oncotarget. 7:7343–7353. 2016. View Article : Google Scholar : PubMed/NCBI

37 

Wu K, Zhang X, Li F, Xiao D, Hou Y, Zhu S, Liu D, Ye X, Ye M, Yang J, et al: Frequent alterations in cytoskeleton remodelling genes in primary and metastatic lung adenocarcinomas. Nat Commun. 6:101312015. View Article : Google Scholar : PubMed/NCBI

38 

Chen NP, Uddin B, Voit R and Schiebel E: Human phosphatase CDC14A is recruited to the cell leading edge to regulate cell migration and adhesion. Proc Natl Acad Sci USA. 113:990–995. 2016. View Article : Google Scholar : PubMed/NCBI

39 

Zhou H, Zhang Y, Chen Q and Lin Y: AKT and JNK signaling pathways increase the metastatic potential of colorectal cancer cells by altering transgelin expression. Dig Dis Sci. 61:1091–1097. 2016. View Article : Google Scholar : PubMed/NCBI

40 

Mills KM, Brocardo MG and Henderson BR: APC binds the Miro/Milton motor complex to stimulate transport of mitochondria to the plasma membrane. Mol Biol Cell. 27:466–482. 2016. View Article : Google Scholar : PubMed/NCBI

41 

Ivanovska J, Zlobec I, Forster S, Karamitopoulou E, Dawson H, Koelzer VH, Agaimy A, Garreis F, Soder S, Laqua W, et al: DAPK loss in colon cancer tumor buds: Implications for migration capacity of disseminating tumor cells. Oncotarget. 6:36774–36788. 2015. View Article : Google Scholar : PubMed/NCBI

42 

Zeng Y, Xie H, Qiao Y, Wang J, Zhu X, He G, Li Y, Ren X, Wang F, Liang L and Ding Y: Formin-Like2 regulates Rho/ROCK pathway to promote actin assembly and cell invasion of colorectal cancer. Cancer Sci. 106:1385–1393. 2015. View Article : Google Scholar : PubMed/NCBI

43 

Asfaha S, Hayakawa Y, Muley A, Stokes S, Graham TA, Ericksen RE, Westphalen CB, von Burstin J, Mastracci TL, Worthley DL, et al: Krt19(+)/Lgr5(−) cells are radioresistant cancer-initiating stem cells in the colon and intestine. Cell Stem Cell. 16:627–638. 2015. View Article : Google Scholar : PubMed/NCBI

44 

Li WX, Xiao HW, Hong XQ and Niu WX: Predictive value of CK20 in evaluating the efficacy of treatment and prognosis after surgery for colorectal cancer. Genet Mol Res. 14:5823–5829. 2015. View Article : Google Scholar : PubMed/NCBI

45 

Saad RS, Ismiil N, Dube V, Nofech-Mozes S and Khalifa MA: CDX-2 expression is a common event in primary intestinal-type endocervical adenocarcinoma. Am J Clin Pathol. 132:531–538. 2009. View Article : Google Scholar : PubMed/NCBI

46 

Bluemke K, Bilkenroth U, Meye A, Fuessel S, Lautenschlaeger C, Goebel S, Melchior A, Heynemann H, Fornara P and Taubert H: Detection of circulating tumor cells in peripheral blood of patients with renal cell carcinoma correlates with prognosis. Cancer Epidemiol Biomarkers Prev. 18:2190–2194. 2009. View Article : Google Scholar : PubMed/NCBI

47 

Mizuuchi E, Semba S, Kodama Y and Yokozaki H: Down-modulation of keratin 8 phosphorylation levels by PRL-3 contributes to colorectal carcinoma progression. Int J Cancer. 124:1802–1810. 2009. View Article : Google Scholar : PubMed/NCBI

48 

Ding SJ, Li Y, Tan YX, Jiang MR, Tian B, Liu YK, Shao XX, Ye SL, Wu JR, Zeng R, et al: From proteomic analysis to clinical significance: Overexpression of cytokeratin 19 correlates with hepatocellular carcinoma metastasis. Mol Cell Proteomics. 3:73–81. 2004. View Article : Google Scholar : PubMed/NCBI

49 

Hammoudi A, Song F, Reed KR, Jenkins RE, Meniel VS, Watson AJ, Pritchard DM, Clarke AR and Jenkins JR: Proteomic profiling of a mouse model of acute intestinal apc deletion leads to identification of potential novel biomarkers of human colorectal cancer (CRC). Biochem Biophys Res Commun. 440:364–370. 2013. View Article : Google Scholar : PubMed/NCBI

50 

Yang SH, Huang CJ, Lee CL, Liu CC, Chien CC and Chen SH: Fecal RNA detection of cytokeratin 19 and ribosomal protein L19 for colorectal cancer. Hepatogastroenterology. 57:710–715. 2010.PubMed/NCBI

51 

Yang RN, Yang SH, Chang CC, Chien CC, Pan S and Huang CJ: Upregulation of fecal cytokeratin 19 is associated with prognosis in older colorectal cancer patients. Genet Test Mol Biomarkers. 14:703–708. 2010. View Article : Google Scholar : PubMed/NCBI

52 

Chang CC, Yang SH, Chien CC, Chen SH, Pan S, Lee CL, Lin CM, Sun HL, Huang CC, Wu YY, et al: Clinical meaning of age-related expression of fecal cytokeratin 19 in colorectal malignancy. BMC Cancer. 9:3762009. View Article : Google Scholar : PubMed/NCBI

53 

Kende AI, Carr NJ and Sobin LH: Expression of cytokeratins 7 and 20 in carcinomas of the gastrointestinal tract. Histopathology. 42:137–140. 2003. View Article : Google Scholar : PubMed/NCBI

54 

Samija I, Lukac J, Mubrin MK, Kirac I, Kovacevic D and Kusic Z: Detection of cytokeratin-20-positive cells in preoperative and postoperative blood samples from colorectal cancer patients by real-time RT-PCR. Int J Biol Markers. 28:174–181. 2013. View Article : Google Scholar : PubMed/NCBI

55 

Kojima S, Sakamoto T, Nagai Y, Honda M and Ogawa F: Metachronous rectal metastasis from primary transverse colon cancer: A case report. Surg Case Rep. 4:902018. View Article : Google Scholar : PubMed/NCBI

56 

Reisher SR, Hughes TE, Ordovas JM, Schaefer EJ and Feinstein SI: Increased expression of apolipoprotein genes accompanies differentiation in the intestinal cell line Caco-2. Proc Natl Acad Sci USA. 90:5757–5761. 1993. View Article : Google Scholar : PubMed/NCBI

57 

Ferruzza S, Rossi C, Scarino ML and Sambuy Y: A protocol for differentiation of human intestinal Caco-2 cells in asymmetric serum-containing medium. Toxicol In Vitro. 26:1252–1255. 2012. View Article : Google Scholar : PubMed/NCBI

58 

Meunier V, Bourrie M, Berger Y and Fabre G: The human intestinal epithelial cell line Caco-2; pharmacological and pharmacokinetic applications. Cell Biol Toxicol. 11:187–194. 1995. View Article : Google Scholar : PubMed/NCBI

59 

Buhrke T, Lengler I and Lampen A: Analysis of proteomic changes induced upon cellular differentiation of the human intestinal cell line Caco-2. Dev Growth Differ. 53:411–426. 2011. View Article : Google Scholar : PubMed/NCBI

60 

Allegra C and Sargent D: Molecular diagnostics: Assays, tissues, progress, and pitfalls. J Clin Oncol. 21:395–396. 2003. View Article : Google Scholar : PubMed/NCBI

61 

Bustin SA and Dorudi S: Gene expression profiling for molecular staging and prognosis prediction in colorectal cancer. Expert Rev Mol Diagn. 4:599–607. 2004. View Article : Google Scholar : PubMed/NCBI

62 

Bardelli A and Velculescu VE: Mutational analysis of gene families in human cancer. Curr Opin Genet Dev. 15:5–12. 2005. View Article : Google Scholar : PubMed/NCBI

63 

Rozen P: Cancer of the gastrointestinal tract: Early detection or early prevention? Eur J Cancer Prev. 13:71–75. 2004. View Article : Google Scholar : PubMed/NCBI

64 

Vogelstein B, Fearon ER, Hamilton SR, Kern SE, Preisinger AC, Leppert M, Nakamura Y, White R, Smits AM and Bos JL: Genetic alterations during colorectal-tumor development. N Engl J Med. 319:525–532. 1988. View Article : Google Scholar : PubMed/NCBI

65 

Center MM, Jemal A, Smith RA and Ward E: Worldwide variations in colorectal cancer. CA Cancer J Clin. 59:366–378. 2009. View Article : Google Scholar : PubMed/NCBI

66 

Le DT, Uram JN, Wang H, Bartlett BR, Kemberling H, Eyring AD, Skora AD, Luber BS, Azad NS, Laheru D, et al: PD-1 blockade in tumors with mismatch-repair deficiency. N Engl J Med. 372:2509–2520. 2015. View Article : Google Scholar : PubMed/NCBI

67 

Cunningham D, Humblet Y, Siena S, Khayat D, Bleiberg H, Santoro A, Bets D, Mueser M, Harstrick A, Verslype C, et al: Cetuximab monotherapy and cetuximab plus irinotecan in irinotecan-refractory metastatic colorectal cancer. N Engl J Med. 351:337–345. 2004. View Article : Google Scholar : PubMed/NCBI

68 

Hurwitz H, Fehrenbacher L, Novotny W, Cartwright T, Hainsworth J, Heim W, Berlin J, Baron A, Griffing S, Holmgren E, et al: Bevacizumab plus irinotecan, fluorouracil, and leucovorin for metastatic colorectal cancer. N Engl J Med. 350:2335–2342. 2004. View Article : Google Scholar : PubMed/NCBI

69 

Imai Y, Yamagishi H, Fukuda K, Okamura T, Ono Y, Ban S, Inoue T and Ueda Y: Expression of cytokeratin 20 indicates invasive histological phenotype in poorly differentiated colorectal adenocarcinoma. Anticancer Res. 34:159–167. 2014.PubMed/NCBI

70 

Barr T, Sureshchandra S, Ruegger P, Zhang J, Ma W, Borneman J, Grant K and Messaoudi I: Concurrent gut transcriptome and microbiota profiling following chronic ethanol consumption in nonhuman primates. Gut Microbes. 9:338–356. 2018.PubMed/NCBI

71 

Turroni S, Vitali B, Candela M, Gionchetti P, Rizzello F, Campieri M and Brigidi P: Antibiotics and probiotics in chronic pouchitis: A comparative proteomic approach. World J Gastroenterol. 16:30–41. 2010.PubMed/NCBI

72 

Singh A, Trivedi P and Jain NK: Advances in siRNA delivery in cancer therapy. Artif Cells Nanomed Biotechnol. 46:274–283. 2018. View Article : Google Scholar : PubMed/NCBI

73 

Das M, Musetti S and Huang L: RNA interference-based cancer drugs: The roadblocks, and the ‘Delivery’ of the promise. Nucleic Acid Ther. 29:61–66. 2019. View Article : Google Scholar : PubMed/NCBI

74 

Zheng M, Tao W, Zou Y, Farokhzad OC and Shi B: Nanotechnology-based strategies for siRNA brain delivery for disease therapy. Trends Biotechnol. 36:562–575. 2018. View Article : Google Scholar : PubMed/NCBI

75 

Bukholm IR, Bondi J, Wiik P, Nesland JM, Andersen SN, Bakka A and Bukholm G: Presence of isolated tumour cells in mesenteric lymph nodes predicts poor prognosis in patients with stage II colon cancer. Eur J Surg Oncol. 29:862–866. 2003. View Article : Google Scholar : PubMed/NCBI

76 

Zhang Y, Hu Q, Li G, Li L, Liang S, Zhang Y, Liu J, Fan Z, Li L, Zhou B, et al: ONZIN upregulation by mutant p53 contributes to osteosarcoma metastasis through the CXCL5-MAPK signaling pathway. Cell Physiol Biochem. 48:1099–1111. 2018. View Article : Google Scholar : PubMed/NCBI

Related Articles

Journal Cover

February-2020
Volume 21 Issue 2

Print ISSN: 1791-2997
Online ISSN:1791-3004

Sign up for eToc alerts

Recommend to Library

Copy and paste a formatted citation
x
Spandidos Publications style
Hung CS, Wang YC, Guo JW, Yang RN, Lee CL, Shen MH, Huang CC, Huang CJ, Yang JY, Liu CY, Liu CY, et al: Expression pattern of placenta specific 8 and keratin 20 in different types of gastrointestinal cancer. Mol Med Rep 21: 659-666, 2020
APA
Hung, C., Wang, Y., Guo, J., Yang, R., Lee, C., Shen, M. ... Liu, C. (2020). Expression pattern of placenta specific 8 and keratin 20 in different types of gastrointestinal cancer. Molecular Medicine Reports, 21, 659-666. https://doi.org/10.3892/mmr.2019.10871
MLA
Hung, C., Wang, Y., Guo, J., Yang, R., Lee, C., Shen, M., Huang, C., Huang, C., Yang, J., Liu, C."Expression pattern of placenta specific 8 and keratin 20 in different types of gastrointestinal cancer". Molecular Medicine Reports 21.2 (2020): 659-666.
Chicago
Hung, C., Wang, Y., Guo, J., Yang, R., Lee, C., Shen, M., Huang, C., Huang, C., Yang, J., Liu, C."Expression pattern of placenta specific 8 and keratin 20 in different types of gastrointestinal cancer". Molecular Medicine Reports 21, no. 2 (2020): 659-666. https://doi.org/10.3892/mmr.2019.10871