International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.
International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.
Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.
Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.
Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.
Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.
Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.
International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.
Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.
Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.
Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.
An International Open Access Journal Devoted to General Medicine.
Lung cancer is a malignant carcinoma, and a leading cause of morbidity and mortality worldwide (1,2). The disease can be divided into two main types, according to clinicopathological features, namely, small-cell lung cancer and non-small-cell lung cancer (NSCLC) (3). NSCLC accounts for 80–90% of all cases of lung cancer (4,5). Although the diagnostic and clinical therapeutic targets of NSCLC have significantly improved in the last decade, the high recurrence rate and poor 5-year survival rate remain (6). Thus, the molecular mechanism underlying NSCLC tumorigenesis requires further investigation.
Previous studies have confirmed the involvement of microRNAs (miRNAs/miRs) in the development of NSCLC (4,7). miRNAs are a series of short (~22 nucleotides), single-stranded, non-coding RNAs, which are mainly transcribed from introns or exons of protein-coding genes (8). miRNAs are involved in the post-transcriptional regulation of gene expression in multicellular organisms; they regulate genes by binding to the 3′-untranslated regions (3′-UTRs) of target mRNAs, thus decreasing the level of oncoprotein translation (5,9). Previous studies have reported that miRNA dysregulation occurs in numerous types of human carcinoma, and that miRNAs are involved in tumor cell proliferation, apoptosis and metastasis (10,11). According to the functional roles of downstream genes, miRNAs can act as oncogenes or tumor suppressors in different types of human cancer, including NSCLC (12,13). For example, aberrant miR-28 expression has been detected in gastric cancer (14), ovarian cancer (15), B-cell lymphoma (16), colorectal cancer (17), hepatocellular carcinoma (18) and renal cell carcinoma (19). However, the detailed molecular mechanism of miR-28 in NSCLC has not been fully elucidated.
The present study aimed to identify the expression levels, functional roles and molecular mechanisms of miR-28, and to investigate the target genes associated with tumor cell proliferation, in NSCLC progression. The present study suggested that miR-28 acted as a promoter in the process of NSCLC cell proliferation by targeting PTEN. Furthermore, it was proposed that the miR-28/PTEN axis may serve as a novel clinical therapeutic target for NSCLC.
Tumor tissues and matched adjacent non-tumor tissues (<3 cm from the tumor margin) were harvested from 33 patients with NSCLC (21 men and 12 women; mean age, 48.9 years; age range, 35–72 years) at Jingzhou Central Hospital between October 2015 and December 2018. Regarding TNM staging (20), 15 (45.45%) patients were classified as TNM stage I or II, whereas 18 (54.55%) patients were classified as TNM stage III or IV. Total tissues were stored at −80°C for tissue repository establishment. The present study was approved by the Ethical Committee of the Jingzhou Central Hospital. Written informed consent was obtained from all patients.
The cell lines, including BEAS-2b, A549, H1650, H292, H1944 and H1299, were purchased from the Institute of Biochemistry and Cell Biology of the Chinese Academy of Sciences. All cell lines were cultured using RPMI-1640 medium supplemented with 10% fetal bovine serum (Gibco; Thermo Fisher Scientific, Inc.) and 1% penicillin-streptomycin at 37°C with 5% CO2.
TargetScan (version 3.1; www.targetscan.org/mamm_31) software was used to determine the candidate downstream target genes of miR-28.
The NSCLC tumor and matched adjacent normal tissues (100 mg) were ground in liquid nitrogen and the resulting cells underwent RNA extraction. The aforementioned cell lines were also used for RT-qPCR. Total RNA was extracted from the cells using TRIzol® reagent (Invitrogen; Thermo Fisher Scientific, Inc.), according to the manufacturer's protocol. Total RNA was reverse transcribed into cDNA using the iScript cDNA synthesis kit (cat. no. 1708890; Bio-Rad Laboratories, Inc.), according to the manufacturer's protocol. Subsequently, TaqMan® MicroRNA assays (Applied Biosystems; Thermo Fisher Scientific, Inc.) were used to detect the expression of miR-28 (miR-28-5p, forward, 5′-CGGATCCAGGCCCTTCAAGGACTTTCT-3′ and reverse, 5′-CGAATTCACAGAGCTCCTGCTGTGTCA-3′), according to the manufacturer's protocol. miR-28 expression levels were normalized to the internal reference gene U6 (forward, 5′-GCTTCGGCAGCACATATACTAAAAT-3′ and reverse, 5′-CGCTTCACGAATTTGCGTGTCAT-3′). SYBR Premix Ex Taq II (Takara Bio, Inc.) was used to determine PTEN mRNA expression levels. The following primer pairs were used for qPCR: PTEN forward, 5′-TGGATTCGACTTAGACTTGACCT-3′ and reverse, 5′-GGTGGGTTATGGTCTTCAAAAGG-3′; and GAPDH forward, 5′-GACTCATGACCACAGTCCATGC-3′ and reverse, 5′-AGAGGCAGGGATGATGTTCTG-3′. PTEN mRNA expression levels were normalized to the internal reference gene GADPH. PCR was performed using the 7500 Realtime PCR system (Applied Biosystems; Thermo Fisher Scientific, Inc.) with the following thermocycling conditions: 12 min at 96°C; followed by 35 cycles of 15 sec at 96°C and 1 min at 58°C; and a final extension at 72°C for 5 min. Relative expression levels were quantified using the 2−∆∆Cq method (21).
The miR-28 mimic (mimic-miR-28; GAGUUAUCUGACACUCGAGGAA) and its negative control (mimic-NC; UUCUCCGAACGUGUCACGU) were purchased from Shanghai GenePharma Co., Ltd. A549 cells (2×105 cells/well) were transfected with mimic-miR-28 or mimic-NC (50 nmol/l) to investigate the interaction between miR-28 and PTEN. Lentivirus (LV)-short hairpin RNA (sh)-PTEN (CCACAGCUAGAACUUAUCAAA), LV-anti-miR-28 (CUCAAUAGACUGUGAGCUCCUU), LV-anti-miR-28 + sh-PTEN or the LV-NC (UUCUCCGAACGUGUCACGU) were infected (MOI=3) into A549 and H292 cells (2×105 cells/well). The lentiviruses used in the present study were purchased from Shanghai GenePharma Co., Ltd. Mimic transfection was performed using Lipofectamine® 3000 (Invitrogen; Thermo Fisher Scientific, Inc.). Following incubation for 6 h at 37°C, the cell culture medium was replaced with fresh medium. At 24 h post-transfection, cells were used for subsequent experiments.
The luciferase reporter plasmid pGL3 (Shanghai GenePharma Co., Ltd.) was used to perform the luciferase activity assay. Renilla luciferase was used as the normalization control. A549 cells (5×105 cells/well) were seeded into a 6-well plate. The sequences of the wild-type (WT) PTEN 3′-UTR (UCCCAAGUCCUUUGUAGCUCCUC) and the mutant (MUT) PTEN 3′-UTR (UCCCAAGUCCUUUGUUCGAGGAC) were obtained from Shanghai GenePharma Co., Ltd. and were cloned into the pGL3 vector. Subsequently, A549 cells were transfected with pGL3-WT-PTEN-3′-UTR or pGL3-WUT-PTEN-3′-UTR (1 µg/ml) using Lipofectamine® 2000 (Invitrogen; Thermo Fisher Scientific, Inc.) and incubated for 6 h at 37°C. A549 cells were also transfected with mimic-miR-28 or mimic-NC (50 nmol/l) using Lipofectamine® 2000 (Invitrogen; Thermo Fisher Scientific, Inc.) and incubated for 6 h at 37°C. Subsequently, the cell culture medium was replaced with fresh medium. After 48 h, the Dual-Luciferase Reporter assay system (Promega Corporation) was used to measure the luciferase activity, according to the manufacturer's instructions.
Total protein was extracted from A549 and H292 cells using ~1 ml RIPA buffer (Beyotime Institute of Biotechnology). Total protein was quantified using a bicinchoninic acid protein assay kit (Beyotime Institute of Biotechnology). Protein (25 µg) was separated by SDS-PAGE using 10% gels and transferred onto PVDF membranes. The membranes were blocked with 5% non-fat milk at room temperature for 2 h. Subsequently, the membranes were incubated with primary antibodies against PTEN (cat. no. 60300-1-Ig; 1:1,000; Proteintech Group, Inc.) and GAPDH (cat. no. 60004-1-Ig; 1:20,000; Proteintech Group, Inc.) overnight at 4°C. The membranes were then washed with TBS-0.5% Tween 20 and incubated with a horseradish peroxidase-conjugated secondary antibody (cat. no. ab205719; 1:20,000; Abcam) for 2 h at room temperature. Protein bands were visualized using an ECL kit (EMD Millipore) and were imaged using a Bioshine ChemiQ 4600 Mini Chemiluminescence Imaging system (Ouxiang). Protein expression was quantified using Image J software (version 1.49; National Institutes of Health).
The CCK-8 assay was used to determine the proliferation of A549 and H292 cells (5×103 cells/well). The CCK-8 reagent (10 µl; APExBIO Technology) was added to each well and subsequently, the cells were counted every 24 h for 5 days using a Fluoroskan Ascent microplate fluorometer (Thermo Fisher Scientific, Inc.). The optical density at a wavelength of 450 nm was measured. After 5 days, the growth curve was generated.
All experiments were performed in triplicate and repeated three times. The data are presented as the mean ± SD. A paired Student's t-test was used for the comparison of miR-28 expression between NSCLC tumor and matched adjacent normal tissues. One-way ANOVA followed by Tukey's post hoc test was used to measure the differences between quantitative variables. P<0.05 was considered to indicate a statistically significant difference. GraphPad Prism (version 7.0; GraphPad Software, Inc.) and R studio (version 3.5.1; www.r-project.org) software were used to perform the statistical analyses.
To investigate whether miR-28 was associated with NSCLC development, RT-qPCR was performed to measure the expression levels of miR-28 in NSCLC tumor tissues and cell lines. miR-28 expression was significantly upregulated in NSCLC tissues compared with matched adjacent non-tumor tissues (Fig. 1A). There was no significant difference between the expression levels of miR-28 in early (1.497 in stage I/II) and late TNM stage tumors (1.553 in stage III/IV; P>0.05; Fig. 1B). The expression levels of miR-28 in A549, H1650, H292, H1944 and H1299 cell lines were significantly higher than in the BEAS-2b cell line (Fig. 1C), which is a normal lung bronchus epithelial cell line and acted as the control group. The results suggested that miR-28 was not only involved in the progression of NSCLC, but was also upregulated in NSCLC tumor tissues and cell lines.
To determine the biological functions of miR-28 in the development of NSCLC, A549 and H292 cells were infected with LV-anti-miR-28. miR-28 expression levels were significantly decreased in both cell lines following infection with LV-anti-miR-28 compared with those infected with LV-NC (Fig. 2A), indicating that the infection was successful. The cell proliferation curves generated by performing the CCK-8 assay suggested that miR-28 knockdown inhibited proliferation of A549 and H292 cells compared with the LV-NC group (Fig. 2B and C). The results indicated that miR-28 might act as a promoter in NSCLC progression.
PTEN was predicted as the downstream gene of miR-28 using TargetScan (www.targetscan.org). To verify whether miR-28 directly targeted PTEN in NSCLC, a dual-luciferase activity assay was performed in A549 cells. miR-28 expression levels were significantly increased in A549 cells transfected with mimic-miR-28 compared with those transfected with mimic-NC (Fig. 3A). The luciferase activity in A549 cells co-transfected with WT-PTEN-3′-UTR and mimic-miR-28 was significantly decreased compared with the mimic-NC group (Fig. 3B). The luciferase activity of A549 cells transfected with MUT-PTEN-3′-UTR was not significantly altered between cells co-transfected with mimic-miR-28 or mimic-NC (Fig. 3C).
To explore the direct effect of miR-28 on PTEN, RT-qPCR and western blotting were performed to measure the mRNA and protein expression levels of PTEN in A549 and H292 cells infected with LV-anti-miR-28. A549 and H292 cells infected with LV-anti-miR-28 displayed significantly higher PTEN mRNA and protein expression levels compared with A549 and H292 cells infected with LV-NC (Fig. 4A-D).
Collectively, these results suggested that PTEN may be the downstream gene of miR-28 in NSCLC; therefore, miR-28 knockdown promoted the expression of PTEN.
sh-PTEN was used to investigate whether PTEN affected the progression of NSCLC. PTEN expression levels were significantly decreased in A549 and H292 cells infected with LV-sh-PTEN compared with those infected with LV-NC (Fig. 5A and E). The mRNA and protein expression levels of PTEN in A549 and H292 cells co-infected with LV-anti-miR-28 + sh-PTEN were significantly lower compared with cells infected with LV-anti-miR-28 (Fig. 5B-D and F-H). The CCK-8 assay suggested that A549 and H292 cells co-infected with LV-anti-miR-28 + sh-PTEN displayed higher levels of cell proliferation compared with A549 and H292 cells infected with LV-anti-miR-28 (Fig. 6). The results indicated that PTEN knockdown reversed the inhibitory effect of LV-anti-miR-28 on cell proliferation. Furthermore, the results suggested that miR-28 might play a role as an oncogene in NSCLC by targeting PTEN.
In the present study, the underlying functional roles of miR-28 in NSCLC tumorigenesis were investigated. miR-28 expression levels were significantly upregulated in NSCLC tumor tissues and cell lines compared with the matched adjacent non-tumor tissues and the control cell line, respectively. Additionally, PTEN was identified as the downstream gene of miR-28 during NSCLC development. miR-28 knockdown increased PTEN expression levels and reduced tumor cell proliferation in vitro. PTEN knockdown reduced the effect of miR-28 on NSCLC tumor cell proliferation. Overall, it could be suggested that miR-28 acted as a promoter in NSCLC by targeting PTEN. Therefore, the miR-28/PTEN axis may serve as a potential clinical target for NSCLC diagnosis, treatment and prognosis.
miR-28, which is located at chromosome 3q28, has two main subtypes, miR-28-3p and miR-28-5p (22). In previous studies, miR-28 and its two subtypes have been reported to be aberrantly expressed by certain pathological mechanisms. Zhou et al (23) reported that miR-28-3p expression levels were increased in the plasma of patients with pulmonary embolism. With regards to lymphocytic leukemia, miR-28-5p expression was significantly increased in patients compared with healthy controls (24). Platelet miR-28 expression was also identified as being upregulated in patients with myeloproliferative neoplasm (25). The aforementioned results indicated that miR-28 upregulation commonly occurs in diseases, which is consistent with the findings of the present study.
miR-28 can act as an oncogene or a tumor suppressor in various types of malignant carcinoma. Schneider et al (16) reported that overexpression of miR-28 inhibited cell proliferation in B-cell lymphoma. Xu et al (15) demonstrated that miR-28-5p induced the proliferation of ovarian cancer cells, as well as their migration and invasion, by targeting NEDD4-binding protein 1. Wu et al (17) reported that miR-28-5p had a suppressive effect on colorectal cancer progression by interacting with the downstream gene structure specific recognition protein 1. However, another similar study suggested that miR-28-3p acted as a tumor promoter in colorectal cancer cell migration and invasion (22). Therefore, the aforementioned studies illustrate that the effects of miR-28 are not always identical in different types of cancer and that the different subtypes of miR-28 may have opposite functions in the same cancer. The present study suggested that miR-28 served as an oncogene in NSCLC cell proliferation, which is supported by Wang et al (26) who reported that miR-28 is one of the potential oncogenes in lung cancer.
PTEN, located at chromosome 10q23.31, has been identified as a tumor suppressor gene via the PI3K/AKT pathway in a number of different forms of cancer (27), including renal cancer (28), gastric cancer (29), endometrial cancer (30), breast cancer (31) and malignant melanoma (32). Previously, emerging miRNAs have been identified as promoters of tumor cell growth, metastasis or apoptosis by targeting PTEN, including miR-1297 (33), miR-200 (34), miR-130a (35), miR-26a (36) and miR-17 (37). In the present study, PTEN was also identified as the target gene of miR-28. Additionally, the oncogenic role of miR-28 in NSCLC proposed in the present study was the same as that of miRNAs reported previously (33–37). These results suggested that miR-28 directly targeted PTEN and may promote tumorigenesis in NSCLC.
A previous study investigated the interaction of the miR-28/PTEN axis in carcinoma. Li et al (14) reported that miR-28 acts as an oncogene in gastric cancer growth and invasion by targeting PTEN, via the PI3K/AKT signaling pathway, which strengthened the present findings. Moreover, the function of the miR-28/PTEN axis in other types of human cancer requires further investigation and could identify additional biomarkers for cancer research.
In conclusion, the present study suggested that miR-28 was upregulated in NSCLC tumor tissues and cell lines. Moreover, miR-28 promoted NSCLC cell proliferation by targeting PTEN, which serves as a suppressor of pathogenesis in numerous diseases (27). The present study identified a potential biomarker for the clinical diagnosis, treatment and prognosis of NSCLC. Further studies investigating whether there are other target genes of miR-28 in NSCLC and whether the miR-28/PTEN axis functions in other types of cancer are required.
Not applicable.
No funding was received.
The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.
HQ conceived and designed the present study. FC and QZ performed the experiments and analyzed the data. FC, QZ and KX helped to design the study and interpreted the data. All authors read and approved the final manuscript.
The present study was approved by the Ethical Committee of the Jingzhou Central Hospital. Written informed consent was obtained from all patients.
Not applicable.
The authors declare that they have no competing interests.
|
Castro D, Moreira M, Gouveia AM, Pozza DH and De Mello RA: MicroRNAs in lung cancer. Oncotarget. 8:81679–81685. 2017. View Article : Google Scholar : PubMed/NCBI | |
|
Wu KL, Tsai YM, Lien CT, Kuo PL and Hung AJ: The roles of MicroRNA in lung cancer. Int J Mol Sci. 20:E16112019. View Article : Google Scholar : PubMed/NCBI | |
|
Herbst RS, Heymach JV and Lippman SM: Lung cancer. N Engl J Med. 359:1367–1380. 2008. View Article : Google Scholar : PubMed/NCBI | |
|
Vannini I, Fanini F and Fabbri M: MicroRNAs as lung cancer biomarkers and key players in lung carcinogenesis. Clin Biochem. 46:918–925. 2013. View Article : Google Scholar : PubMed/NCBI | |
|
Zhang WC, Liu J, Xu X and Wang G: The role of microRNAs in lung cancer progression. Med Oncol. 30:6752013. View Article : Google Scholar : PubMed/NCBI | |
|
Angulo M, Lecuona E and Sznajder JI: Role of MicroRNAs in lung disease. Arch Bronconeumol (Spanish). 48:325–330. 2012. View Article : Google Scholar | |
|
Del Vescovo V, Grasso M, Barbareschi M and Denti MA: MicroRNAs as lung cancer biomarkers. World J Clin Oncol. 5:604–620. 2014. View Article : Google Scholar : PubMed/NCBI | |
|
Alipoor SD, Adcock IM, Garssen J, Mortaz E, Varahram M, Mirsaeidi M and Velayati A: The roles of miRNAs as potential biomarkers in lung diseases. Eur J Pharmacol. 791:395–404. 2016. View Article : Google Scholar : PubMed/NCBI | |
|
Guz M, Rivero-Muller A, Okon E, Stenzel-Bembenek A, Polberg K, Slomka M and Stepulak A: MicroRNAs-role in lung cancer. Dis Markers. 2014:2181692014. View Article : Google Scholar : PubMed/NCBI | |
|
Kang SM and Lee HJ: MicroRNAs in human lung cancer. Exp Biol Med (Maywood). 239:1505–1513. 2014. View Article : Google Scholar : PubMed/NCBI | |
|
Wu SG, Chang TH, Liu YN and Shih JY: MicroRNA in lung cancer metastasis. Cancers (Basl). 11:E2652019. View Article : Google Scholar | |
|
Markou A, Sourvinou I, Vorkas PA, Yousef GM and Lianidou E: Clinical evaluation of microRNA expression profiling in non small cell lung cancer. Lung Cancer. 81:388–396. 2013. View Article : Google Scholar : PubMed/NCBI | |
|
Shen J, Liu Z, Todd NW, Zhang H, Liao J, Yu L, Guarnera MA, Li R, Cai L, Zhan M and Jiang F: Diagnosis of lung cancer in individuals with solitary pulmonary nodules by plasma microRNA biomarkers. BMC Cancer. 11:3742011. View Article : Google Scholar : PubMed/NCBI | |
|
Li L, Zhu X, Shou T, Yang L, Cheng X, Wang J, Deng L and Zheng Y: MicroRNA-28 promotes cell proliferation and invasion in gastric cancer via the PTEN/PI3K/AKT signalling pathway. Mol Med Rep. 17:4003–4010. 2018.PubMed/NCBI | |
|
Xu J, Jiang N, Shi H, Zhao S, Yao S and Shen H: miR-28-5p promotes the development and progression of ovarian cancer through inhibition of N4BP1. Int J Oncol. Mar 16–2017.(Epub ahead of print). View Article : Google Scholar | |
|
Schneider C, Setty M, Holmes AB, Maute RL, Leslie CS, Mussolin L, Rosolen A, Dalla-Favera R and Basso K: MicroRNA 28 controls cell proliferation and is down-regulated in B-cell lymphomas. Proc Natl Acad Sci USA. 111:8185–8190. 2014. View Article : Google Scholar : PubMed/NCBI | |
|
Wu W, He K, Guo Q, Chen J, Zhang M, Huang K, Yang D, Wu L, Deng Y, Luo X, et al: SSRP1 promotes colorectal cancer progression and is negatively regulated by miR-28-5p. J Cell Mol Med. 23:3118–3129. 2019. View Article : Google Scholar : PubMed/NCBI | |
|
Zhou SL, Hu ZQ, Zhou ZJ, Dai Z, Wang Z, Cao Y, Fan J, Huang XW and Zhou J: miR-28-5p-IL-34-macrophage feedback loop modulates hepatocellular carcinoma metastasis. Hepatology. 63:1560–1575. 2016. View Article : Google Scholar : PubMed/NCBI | |
|
Wang C, Wu C, Yang Q, Ding M, Zhong J, Zhang CY, Ge J, Wang J and Zhang C: miR-28-5p acts as a tumor suppressor in renal cell carcinoma for multiple antitumor effects by targeting RAP1B. Oncotarget. 7:73888–73902. 2016.PubMed/NCBI | |
|
Nicholson AG, Chansky K, Crowley J, Beyruti R, Kubota K, Turrisi A, Eberhardt WE and van Meerbeeck J; Staging and Prognostic Factors Committee, Advisory Boards, and Participating Institutions; Staging and Prognostic Factors Committee Advisory Boards and Participating Institutions, . The international association for the study of lung cancer lung cancer staging project: Proposals for the revision of the clinical and pathologic staging of small cell lung cancer in the forthcoming eighth edition of the TNM classification for lung cancer. J Thoracic Oncol. 11:300–311. 2016. View Article : Google Scholar | |
|
Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods. 25:402–408. 2001. View Article : Google Scholar : PubMed/NCBI | |
|
Almeida MI, Nicoloso MS, Zeng L, Ivan C, Spizzo R, Gafà R, Xiao L, Zhang X, Vannini I, Fanini F, et al: Strand-specific miR-28-5p and miR-28-3p have distinct effects in colorectal cancer cells. Gastroenterology. 142:886–896.e9. 2012. View Article : Google Scholar : PubMed/NCBI | |
|
Zhou X, Wen W, Shan X, Qian J, Li H, Jiang T, Wang W, Cheng W, Wang F, Qi L, et al: MiR-28-3p as a potential plasma marker in diagnosis of pulmonary embolism. Thromb Res. 138:91–95. 2016. View Article : Google Scholar : PubMed/NCBI | |
|
Yang YQ, Tian T, Zhu HY, Liang JH, Wu W, Wu JZ, Xia Y, Wang L, Fan L, Li JY and Xu W: NDRG2 mRNA levels and miR-28-5p and miR-650 activity in chronic lymphocytic leukemia. BMC Cancer. 18:10092018. View Article : Google Scholar : PubMed/NCBI | |
|
Girardot M, Pecquet C, Boukour S, Knoops L, Ferrant A, Vainchenker W, Giraudier S and Constantinescu SN: miR-28 is a thrombopoietin receptor targeting microRNA detected in a fraction of myeloproliferative neoplasm patient platelets. Blood. 116:437–445. 2010. View Article : Google Scholar : PubMed/NCBI | |
|
Wang QZ, Xu W, Habib N and Xu R: Potential uses of microRNA in lung cancer diagnosis, prognosis, and therapy. Curr Cancer Drug Targets. 9:572–594. 2009. View Article : Google Scholar : PubMed/NCBI | |
|
Hopkins BD and Parsons RE: Molecular pathways: Intercellular PTEN and the potential of PTEN restoration therapy. Clin Cancer Res. 20:5379–5383. 2014. View Article : Google Scholar : PubMed/NCBI | |
|
Zaman MS, Thamminana S, Shahryari V, Chiyomaru T, Deng G, Saini S, Majid S, Fukuhara S, Chang I, Arora S, et al: Inhibition of PTEN gene expression by oncogenic miR-23b-3p in renal cancer. PLoS One. 7:e502032012. View Article : Google Scholar : PubMed/NCBI | |
|
Yang Z, Yuan XG, Chen J, Luo SW, Luo ZJ and Lu NH: Reduced expression of PTEN and increased PTEN phosphorylation at residue Ser380 in gastric cancer tissues: A novel mechanism of PTEN inactivation. Clin Res Hepatol Gastroenterol. 37:72–79. 2013. View Article : Google Scholar : PubMed/NCBI | |
|
Yoneyama K, Ishibashi O, Kawase R, Kurose K and Takeshita T: miR-200a, miR-200b and miR-429 are onco-miRs that target the PTEN gene in endometrioid endometrial carcinoma. Anticancer Res. 35:1401–1410. 2015.PubMed/NCBI | |
|
Zhang WL and Zhang JH: miR-181c promotes proliferation via suppressing PTEN expression in inflammatory breast cancer. Int J Oncol. 46:2011–2020. 2015. View Article : Google Scholar : PubMed/NCBI | |
|
Zhou XP, Gimm O, Hampel H, Niemann T, Walker MJ and Eng C: Epigenetic PTEN silencing in malignant melanomas without PTEN mutation. Am J Pathol. 157:1123–1128. 2000. View Article : Google Scholar : PubMed/NCBI | |
|
Li X, Wang HL, Peng X, Zhou HF and Wang X: miR-1297 mediates PTEN expression and contributes to cell progression in LSCC. Biochem Biophys Res Commun. 427:254–260. 2012. View Article : Google Scholar : PubMed/NCBI | |
|
Wu Q, Lu RL, Li JX and Rong LJ: MiR-200a and miR-200b target PTEN to regulate the endometrial cancer cell growth in vitro. Asian Pac J Trop Med. 10:498–502. 2017. View Article : Google Scholar : PubMed/NCBI | |
|
Wei H, Cui R, Bahr J, Zanesi N, Luo Z, Meng W, Liang G and Croce CM: miR-130a deregulates PTEN and stimulates tumor growth. Cancer Res. 77:6168–6178. 2017. View Article : Google Scholar : PubMed/NCBI | |
|
Li B and Sun H: MiR-26a promotes neurite outgrowth by repressing PTEN expression. Mol Med Rep. 8:676–680. 2013. View Article : Google Scholar : PubMed/NCBI | |
|
Gao Y, Luo LH, Li S and Yang C: miR-17 inhibitor suppressed osteosarcoma tumor growth and metastasis via increasing PTEN expression. Biochem Biophys Res Commun. 444:230–234. 2014. View Article : Google Scholar : PubMed/NCBI |