Open Access

KCTD1 mutants in scalp‑ear‑nipple syndrome and AP‑2α P59A in Char syndrome reciprocally abrogate their interactions, but can regulate Wnt/β‑catenin signaling

  • Authors:
    • Lingyu Hu
    • Li Chen
    • Liu Yang
    • Zi Ye
    • Wenhuan Huang
    • Xinxin Li
    • Qing Liu
    • Junlu Qiu
    • Xiaofeng Ding
  • View Affiliations

  • Published online on: August 24, 2020     https://doi.org/10.3892/mmr.2020.11457
  • Pages: 3895-3903
  • Copyright: © Hu et al. This is an open access article distributed under the terms of Creative Commons Attribution License.

Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )


Abstract

Potassium‑channel tetramerization-domain-containing 1 (KCTD1) mutations are reported to result in scalp‑ear‑nipple syndrome. These mutations occur in the conserved broad‑complex, tramtrack and bric a brac domain, which is associated with inhibited transcriptional activity. However, the mechanisms of KCTD1 mutants have not previously been elucidated; thus, the present study aimed to investigate whether KCTD1 mutants affect their interaction with transcription factor AP‑2α and their regulation of the Wnt pathway. Results from the present study demonstrated that none of the ten KCTD1 mutants had an inhibitory effect on the transcriptional activity of AP‑2α. Co‑immunoprecipitation assays demonstrated that certain mutants exhibited changeable localization compared with the nuclear localization of wild‑type KCTD1, but no KCTD1 mutant interacted with AP‑2α. Almost all KCTD1 mutants, except KCTD1 A30E and H33Q, exhibited differential inhibitory effects on regulating TOPFLASH luciferase reporter activity. In addition, the interaction region of KCTD1 to the PY motif (amino acids 59‑62) in AP‑2α was identified. KCTD1 exhibited no suppressive effects on the transcriptional activity of the AP‑2α P59A mutant, resulting in Char syndrome, a genetic disorder characterized by a distinctive facial appearance, heart defect and hand abnormalities, by altered protein cellular localization that abolished protein interactions. However, the P59A, P60A, P61R and 4A AP‑2α mutants inhibited TOPFLASH reporter activity. Moreover, AP‑2α and KCTD1 inhibited β‑catenin expression levels and SW480 cell viability. The present study thus identified a putative mechanism of disease‑related KCTD1 mutants and AP‑2α mutants by disrupting their interaction with the wildtype proteins AP‑2α and KCTD1 and influencing the regulation of the Wnt/β‑catenin pathway.

Introduction

Scalp-ear-nipple (SEN) syndrome is a rare, autosomal-dominant disorder that commonly presents as cutis aplasia of the scalp, minor anomalies of the external ears, digits and nails, and malformation of the breast (1). In mice, homozygous deficiency of the lymphoid enhancer-binding factor 1 (Lef-1) gene results in the lack of whiskers and the arrest of hair-follicle development, lack of mammary glands and edentulism, indicating that Lef-1 may serve as a potential candidate gene for treating SEN syndrome (2). Ten mutations in the broad-complex, tramtrack and bric a brac (BTB) domain of potassium-channel tetramerization-domain-containing 1 (KCTD1) have been identified in ten families with SEN syndrome of European, Brazilian and North African background (3). This conserved domain regulates transcriptional activity, suggesting it may serve a key role in KCTD1 protein function during ectodermal development (3).

Transcription factor AP-2α-knockout mice exhibit a number of severe developmental phenotypes, including neural tube, body wall and craniofacial abnormality (4). Dominant AP-2α mutant Doarad results in a missense mutation that affects the Y58F59P60P61P62Y63 (PY) motif in the transactivation domain of AP-2α, causing a misshapen malleus, incus and stapes (5). This P59L mutation in AP-2α leads to increased transcriptional activation of AP-2α (5). Patients with Char syndrome have three mutations in the basic DNA-binding domain and a PY motif in the activation domain of the AP-2β gene, causing dominant-negative effects. In the USA, individuals with Char syndrome who have a PY motif P62R mutation in AP-2β have a higher incidence rate (10 of 14) of patent ductus arteriosus, but milder hand and facial abnormal phenotypes compared with individuals with DNA-binding domain mutations in AP-2α (6,7). Point mutations or insertions/deletions in the conserved DNA-binding domain in AP-2α, encoded by exons 4 and 5, cause the majority of branchio-oculo-facial syndrome (BOFS) cases (8). BOFS is associated with >25 different mutations in AP-2α (912). Therefore, AP-2α mutants have been associated with certain developmental abnormalities.

Our previous study (13) demonstrated that KCTD1 binds with AP-2α and decreases its transcriptional activity. KCTD15 is associated with the KCTD1 protein in the KCTD family. It is likely that KCTD15 functions during embryogenesis by interacting with the activation domain of AP-2α to inhibit neural crest induction (14). Individuals with KCTD15 mutations exhibit developmental defects in neural crest derivatives and the torus lateralis (TLa) in the central nervous system, resulting in a significant decrease in normal growth rates (15,16). Moreover, both AP-2α and KCTD1 regulate the Wnt/β-catenin pathway. AP-2α directly interacts with adenomatous polyposis coli (APC), stabilizing interactions between APC and β-catenin, attenuating interactions between β-catenin and transcription factor-4 in the nucleus and suppressing TOPFLASH luciferase reporter activity in human colorectal cancer cells (17). AP-2α-interacting protein KCTD1 directly binds to β-catenin, enhances β-catenin ubiquitination and degradation, which is dependent on casein kinase 1/glycogen synthase kinase-3β-mediated phosphorylation of β-catenin, and inhibits the canonical Wnt/β-catenin signaling pathway (18).

The present study aimed to investigate whether KCTD1 and AP-2α protein mutants reciprocally regulate their interactions and inhibit the Wnt/β-catenin signaling pathway. The results demonstrated that BTB domain mutations in KCTD1 were not associated with AP-2α. The P59A mutation in the PY motif of AP-2α prevented binding with KCTD1, but the majority of BTB domain mutations in KCTD1 and PY motif mutations in AP-2α resulted in inhibited Wnt pathway-responsive TOPFLASH reporter gene expression levels. Wild-type KCTD1 suppressed the transcriptional activity of AP-2α P60A and P61R to repress TOPFLASH reporter gene expression levels. Moreover, wild-type KCTD1 and AP-2α downregulated β-catenin expression levels and decreased the viability of SW480 cells. These findings highlighted the importance of AP-2α and KCTD1 regulation in maintaining a normal tissue phenotype.

Materials and methods

Plasmid generation

Recombinant overexpressing plasmids pCMV-Myc-AP-2α, pCMV-HA-KCTD1, pCMV-Myc-KCTD1 and pEGFP-C1-AP-2α were generated as previously described (13,18). The mutants AP-2α P61R and KCTD1 P20S, A30E, P31R, H33P and H33Q were also generated as previously described (13,18). The KCTD1 mutants P31L, P31H, G62D, D69E and H74P and AP-2α mutants P59A, P60A and 4A (P59AP60AP61AY62A) were modified by PCR-based site-directed mutagenesis and cloned into pCMV-Myc plasmids. Mutated primers are presented in Table I. Reporter vectors A2 and TOPFLASH were generated as previously described (18,19). Eight recombinant plasmids were sequenced using the Sanger method, in order to verify mutant site points (Sangon Biotech, Co., Ltd.) (Fig. S1).

Table I.

Mutants of KCTD1 and AP-2α and their PCR primers.

Table I.

Mutants of KCTD1 and AP-2α and their PCR primers.

GeneMutantPrimer sequence (5′→3′)
KCTD1P20SF: TCTACTCCAGCACAACTCACA
R: TGTGAGTTGTGCTGGAGTAGA
A30EF: ATCCAATGAGCCTGTCCACAT
R: ATGTGGACAGGCTCATTGGAT
P31RF: CAATGCGCGTGTCCACATTGA
R: TCAATGTGGACACGCGCATTG
P31LF: CAATGCGCTTGTCCACATTGA
R: TCAATGTGGACAAGCGCATTG
P31HF: CAATGCGCATGTCCACATTGA
R: TCAATGTGGACATGCGCATTG
H33PF: CCATTGATGTGGGCGGCCAC
R: GTGGCCGCCCACATCAATGG
H33QF: CGCCTGTCCAAATTGATGTGG
R: CCACATCAATTTGGACAGGCG
G62DF: TTTGATGATACAGAGCCCATTG
R: CAATGGGCTCTGTATCATCAAA
D69EF: AAGTCTCAAACAGCACTATTTC
R: GAAATAGTGCTGTTTGAGACTT
H74PF: CCTATTTCATTGACAGAGATGG
R: CCATCTCTGTCAATGAAATAGG
AP-2αP61RF: TTCCCCCCAAGATACCAGCCT
R: AGGCTGGTATCTTGGGGGGAA
P59AF: ATACTTCGCCCCACCCTACC
R: GGTAGGGTGGGGCGAAGTAT
P60AF: ACTTCCCCGCACCCTACCAG
R: CTGGTAGGGTGCGGGGAAGT
4AF: ATACTTCGCCGCAGCCGCCCAGCCT
R: AGGCTGGGCGGCTGCGGCGAAGTAT

[i] F, forward; KCTD1, potassium-channel tetramerization-domain-containing 1; R, reverse. The mutated base is underlined.

Cell culture and transfection

SW480, 293 and HeLa cells (American Type Culture Collection) were cultured in complete DMEM (Sigma-Aldrich; Merck KGaA). All cells were maintained with 10% fetal calf serum (HyClone; GE Healthcare Life Sciences), 2 mM glutamine, 10 U/ml penicillin and 100 µg/ml streptomycin at 37°C with 5% CO2. The cells were transiently transfected with different amounts of plasmid DNA (1 µg for luciferase reporter assays; 6 µg for immunofluorescence analysis; 20 µg for co-immunoprecipitation; Clontech Laboratories, Inc.) using Lipofectamine® 2000 reagent (Invitrogen; Thermo Fisher Scientific, Inc.) for 6 h. The cells were collected 24–30 h following transfection for subsequent experimentation.

Luciferase reporter assays

The 293 cells were cultured and transiently transfected with 0.3 µg reporter plasmids A2 (generous gift of Professor Trevor Williams) or pTOPFLASH (Clontech Laboratories, Inc.) (18) and the indicated plasmids (0.3 µg pCMV-Myc-KCTD1 and/or 0.3 µg of pCMV-Myc-AP-2α) in 12-well plates using Lipofectamine 2000 reagent as previously described (20). Briefly, 0.1 µg pCMV-LacZ plasmid (19) was co-transfected in each well to measure transfection efficiency as an internal β-galactosidase control. The total amount of 1 µg plasmid DNA in each well was maintained by adding empty vector pCMV-Myc (Clontech Laboratories, Inc.) to each transfection. β-galactosidase and luciferase activities were assessed 24 h after transfection using a Promega Luciferase Assay system (Promega Corporation) and a Turner TD20/20 luminometer (Turner Designs). The luciferase activity is normalized relative to the β-galactosidase control. A total of three experimental repeats were performed.

Immunofluorescence localization analysis

HeLa cells were grown to ~70% confluence on glass coverslips and transiently transfected with3 µg GFP-AP-2α and 3 µg Myc-KCTD1 mutants or 3 µg Myc-AP-2α mutants and 3 µg HA-KCTD1. At 30 h post-transfection, cells were collected for immunofluorescence staining, as previously described (19). Primary antibodies included Anti-Myc mouse monoclonal antibody (clone. no. 9E10; Santa Cruz Biotechnology, Inc.) and anti-HA rabbit polyclonal antibody (clone no. Y-11) (Santa Cruz Biotechnology, Inc.) at 1:200 dilution for 1 h at 4°C. Alexa Fluor 488 goat anti-rabbit IgG (cat. no. A27034) and Alexa Fluor 594 goat anti-mouse IgG (cat. no. A-11005) secondary antibodies were purchased from Molecular Probes; Thermo Fisher Scientific, Inc. and used at 1:500 dilution for 45 min at 4°C. Hoechst 33258 (1 µg/ml) was used to stain the nuclei (Sigma-Aldrich; Merck KGaA) for 5 min at 4°C. The fluorescence signals were observed with a fluorescence microscope (Carl Zeiss AG).

Co-immunoprecipitation

The 293 cells were grown to ~80% confluence and transiently transfected with 10 µg Myc-AP-2α and 10 µg Myc-KCTD1 in 10-cm dishes. At 30 h after transfection, cells were collected and lysed as previously described (13). The cells were lysed in RIPA buffer [50 mM Tris-HCl pH 7.2; 150 mM NaCl, 1% (v/v) Triton X-100; 1% (w/v) sodium deoxycholate; 0.1% (w/v) SDS] supplemented with protease inhibitors. The cellular lysates were precleared with protein A/G plus agarose (Santa Cruz Biotechnology, Inc.) at 4°C for 1 h, and then immunoprecipitated using rabbit anti-KCTD1 polyclonal antibodies (21) and protein A/G plus agarose. The immunoprecipitates were washed four times for 15 min each in 1 ml 1% Triton buffer by keeping gentle agitation and then centrifuged at 500 × g for 3 min at 4°C. The immunocomplexes were separated by SDS-PAGE on 13% gels and detected with mouse anti-Myc tag monoclonal antibody at 1:2,000 dilution overnight at 4°C as described in the following Western blot section. Pre-immune rabbit IgG (cat. no. sc-2027; Santa Cruz Biotechnology, Inc.) was used as a negative control. The quantification of immunoprecipitated bands was analyzed using ImageJ software (ImageJ 1.48v, http://imagej.nih.gov/ij/).

Western blotting

SW480 cells were transiently transfected with pCMV-Myc-AP-2α and/or pCMV-Myc-KCTD1 expression plasmids. At 24 h after post-transfection, cells were collected and lysed in RIPA buffer. The protein concentration of whole-cell extracts was measured using a BCA assay kit (Pierce; Thermo Fisher Scientific, Inc.). Total protein (10 µg/lane) was resolved by SDS-PAGE on 12% gels, then transferred to PVDF membranes (Bio-Rad Laboratories, Inc.) at 4°C for 2 h at 100 V. The membrane was blocked with TBS buffer [100 mM Tris-HCl pH7.5; 0.9% (w/v) NaCl] with 1% BSA (Sigma-Aldrich; Merck KGaA) for 1 h at 4°C. After blocking, the membrane was incubated with primary antibodies against Myc-tag (clone. no. 9E10; 1:2,000), β-catenin (E-5, 1:1,000), cyclin D1 (CCND1; clone. no. HD11; 1:1,000) and GAPDH (clone. no. 6C5; 1:5,000) (Santa Cruz Biotechnology, Inc.) overnight at 4°C and washed with TBS and 0.1% (v/v) Tween-20 for 1 h. After washing, the membrane was then incubated with goat anti-mouse IgG-horseradish peroxidase-conjugated secondary antibody (cat. no. sc-2005, 1:7,500; Santa Cruz Biotechnology, Inc.) at room temperature for 45 min followed by washing five times for 1 h. The signal was detected with SuperSignal West Pico chemiluminescent Substrate (Pierce; Thermo Fisher Scientific, Inc.) and visualized with tanon-5200 system (Tanon Science and Technology Co., Ltd.).

Cell viability assays

A total of 3×103 transfected SW480 cells were grown at 37°C in 96-well plates in octuplicate. Cell viability was analyzed 24 h after transfection by adding 1 mg/ml MTT to each well, followed by incubation for 4 h at 37°C. Subsequently, the formazan crystals were dissolved in 100 µl DMSO. The absorbance was measured at 490 nm using a spectrophotometer. To detect the effects of AP-2α and KCTD1 proteins on the sensitivity of SW480 cells to sorafenib, SW480 cells were transfected and subsequently treated with 20 µM cisplatin (DDP) for 24 h; viability was assessed by MTT, aforementioned.

Statistical analysis

All statistical analysis was performed using SPSS statistical software (version 16.0; SPSS, Inc.). Data are presented as the mean ± SD of three independent experiments. Significant differences were determined using Student's t-test to compare two groups, and two-way ANOVA to compare three or more groups. Multi-group comparisons were analyzed using Tukey's post hoc test. P<0.05 was considered to indicate a statistically significant difference.

Results

Known KCTD1 mutants have no inhibitory effect on the transcriptional activity of AP-2α, and KCTD1 does not repress the transcriptional activity of the AP-2αP59A mutation

All the known KCTD mutations in the BTB-domain lead to SEN syndrome, whereas mutations in AP-2α possibly cause Char syndrome. As the BTB domain of KCTD1 binds to the activation domain of AP-2α and suppresses its transcriptional activity (13), it was investigated whether these KCTD1 mutations affect AP-2α transcriptional activity (Fig. 1A). An A2 reporter plasmid with three AP-2 binding sites was transiently transfected in the presence or absence of pCMV-Myc-KCTD1 wild-type or KCTD1 mutants into 293 cells. Consistent with previous results (13) wild-type KCTD1 overexpression significantly decreased A2 luciferase activity, whereas 10 KCTD1 mutants had no effect on the transcriptional inhibition of AP-2α, compared with wild-type KCTD1 (Fig. 1B).

The present study also investigated the effect of KCTD1 on the transcriptional activity of AP-2α with mutations in the PY motif (Fig. 1C), which is required for a normal developmental phenotype (5). KCTD1 markedly repressed A2 luciferase activity of AP-2α P60A and P61R, but not of AP-2α P59A or 4A, indicating that the AP-2α mutation of amino acid 59 abrogated KCTD1 regulation (Fig. 1D). Taken together, these data revealed that pathogenic mutations in KCTD1 or AP-2α affect their regulatory mechanisms.

Altered cellular localization of KCTD1 and AP-2α mutants, compared with wild-type

Plasmids encoding mutant KCTD1 and AP-2α proteins were transfected into 293 cells to investigate the localization of both mutant proteins using immunofluorescence (Figs. 2 and 3, respectively). It was observed that wild-type KCTD1 localized with wild-type AP-2α, consistent with previously reported results (13). The KCTD1 mutants (A30E, P31R, P31L, H33Q, G62D, D69E and H74P) were distributed throughout the whole cell, predominantly exhibited strong fluorescence in the nucleus, and co-localized with AP-2α (Fig. 2). However, localization of KCTD1 P20S was detected in the nuclear membrane. KCTD1 P31H was localized in the nuclear membrane and the cytoplasm (Fig. 2A). KCTD1 H33P clustered in an aggregated pattern in a significant portion of the cells (Fig. 2B). These data suggested that wild-type KCTD1 and its mutant proteins primarily localized in the nucleus, but KCTD1 mutants with mutated amino acids 20 and 31 localized to the nuclear membrane. In addition, wild-type AP-2α and mutant P60A and P61R protein appeared to demonstrate strong fluorescence in the nucleus and co-localized with KCTD1 protein. However, the AP-2α P59A and 4A proteins were predominantly detected in the cytoplasm and showed no overlap with KCTD1 protein (Fig. 3). These observations were indicative of altered localization of KCTD1 and AP-2α.

Protein interactions are altered between KCTD1 mutants/wild-type AP-2α and wild-type KCTD1/AP-2α P59A mutant

Coimmunoprecipitation analysis was performed to investigate in vitro interactions between AP-2α and KCTD1 mutants. Anti-KCTD1 antibodies immunoprecipitated the wild-type KCTD1/AP-2α complex but did not precipitate the KCTD1 mutant/AP-2α protein complex (Fig. 4A-C). Moreover, consistent with luciferase assay results, KCTD1 formed a complex with AP-2α P60A and P61R, but not with AP-2α P59A or 4A (Fig. 4D). These results demonstrated that the KCTD1 mutants did not interact with AP-2α, although some nucleic co-localization was observed for the AP-2α and KCTD1 mutants, which indicated that KCTD1 mutations in the BTB domain reduce its suppressive effects on AP-2α. However, KCTD1 continued to inhibit the transcriptional activation of AP-2α P60A and P61R and formed a complex through protein-protein interaction.

Differential regulation of KCTD1 and AP-2α mutants on the Wnt/β-catenin signaling pathway

Wnt/β-catenin signaling serves a key role in embryonic development and various diseases including bone disease including osteoporosis-pseudoglioma syndrome, cardiometabolic disease and Parkinson's disease (2225). The present study investigated the effects of KCTD1 mutants on the canonical Wnt/β-catenin signaling pathway. The TOPFLASH reporter plasmid was transfected into 293 cells in the presence or absence of pCMV-Myc-KCTD1 wild-type or KCTD1 mutants. The results demonstrated that wild-type KCTD1 overexpression markedly suppressed the Wnt pathway-responsive TOPFLASH reporter gene activity (Fig. 5A). In addition, the majority of KCTD1 mutants strongly inhibited the transcriptional activity of the TOPFLASH reporter. KCTD1 A30E or H33Q mutants had no effect on the transcriptional activity of the TOPFLASH reporter, but eight other KCTD1 mutants significantly decreased the transcription activity of the TOPFLASH reporter gene to a similar extent as the wild-type KCTD1. In the H33Q KCTD1 mutant, the change from polar and charged His33 to a polar residue, Gln (Q), did not inhibit TOPFLASH reporter activity. By contrast, the change from His to Pro in the H33P mutant inhibited the TOPFLASH reporter activity. Collectively, these results suggested that Ala 30 and His 33 were important for KCTD1-mediated regulation of Wnt/β-catenin signaling (Fig. 5A). These data indicate that the pathogenic mechanisms underlying certain KCTD1 mutants are primarily due to suppressed Wnt/β-catenin signaling, resulting in specific abnormal phenotypes in SEN syndrome.

AP-2α has been reported to inhibit TOPFLASH reporter activity in a manner similar to KCTD1 (17,18). AP-2α P59A and AP-2α 4A suppressed TOPFLASH activity to a similar degree as wild-type AP-2α (Fig. 5B); AP-2α P60A and P61R also partially inhibited TOPFLASH reporter activity. Notably, inhibition of TOPFLASH reporter activity by AP-2α P60A and P61R was enhanced in cells co-transfected with wild-type KCTD1, but KCTD1 had no effect on the TOPFLASH reporter activity of AP-2α P59A or 4A (Fig. 5B). These results supported the hypothesis that the AP-2α P59A mutant downregulates the Wnt/β-catenin signaling pathway, which is unaffected by KCTD1.

Finally, western blotting was performed to measure the influence of AP-2α and KCTD1 proteins on the Wnt/β-catenin pathway. KCTD1 and AP-2α overexpression (individually and in combination) decreased β-catenin expression levels (Fig. 6A); downstream CCND1 expression levels were also downregulated. Moreover, KCTD1 and AP-2α decreased the survival of the SW480 cells, and 20 µM chemotherapeutic drug cisplatin (DDP) exhibited a stronger inhibitory effect on the viability of SW480 cells transfected with KCTD1 and/or AP-2α, compared with the normal saline (NS) group (Fig. 6B). These results demonstrated that KCTD1 and AP-2α downregulated β-catenin expression levels in the canonical Wnt pathway and inhibited SW480 cell viability, suggesting KCTD1 and AP-2α might regulate these syndromes through the Wnt/β-catenin pathway.

Discussion

The BTB domain is crucial for transcriptional regulation; proteins with a BTB domain primarily function as transcriptional repressors (2628). BTB proteins, such as Bcl-6 and promyelocytic leukemia zinc-finger (PLZF), are involved in a number of developmental processes, such as limb formation, gastrulation, ovary morphogenesis, eye development and hematopoietic stem cell fate determination (2933). The Bcl6 mutant does not interact with co-repressors through its BTB domain, which results in defective B cell proliferation and survival, disrupted formation of germinal centers and suppressed affinity maturation of immunoglobulin (34). Specifically, residues 33–35 form the floor of the pocket and residues 63, 64 and 66–68 form each wall in the secondary structure of PLZF BTB domain (35). All known KCTD mutants in SEN syndrome are caused by missense mutations, and the BTB pocket is formed by a number of residues (3). KCTD1 mutations associated with SEN syndrome abrogate KCTD1 transcriptional repression activity on transcription factor AP-2α (13). These missense mutations result in the loss of KCTD1 function in a dominant-negative manner. This is consistent with the present study results, which demonstrated that alterations in the KCTD1 BTB domain had no effect on the transcriptional repression of AP-2α owing to a lack of interaction, despite a degree of co-localization. Notably, the present study revealed that KCTD1 H33P was localized in a punctate pattern in the cells. These findings were consistent with a previous study in which amyloid precursor protein (APP) exhibited a punctate pattern of immunofluorescence indicative of internalization from the cell surface to an endosomal compartment (36), indicating that KCTD1 H33P may serve important roles in internalization by endocytosis. To investigate the function of KCTD1 mutants in maintaining a normal tissue phenotype, as well as the regulatory association between KCTD1 mutants and Wnt/β-catenin signaling, normal cell lines, such as 293 cells, were selected as previously described (18). The majority of KCTD1 BTB domain mutants suppressed the Wnt/β-catenin pathway, indicating that substitutions of amino acids in cases of SEN syndrome do not wholly disrupt transcriptional repression caused by BTB domain mutations in KCTD1, although only KCTD1 A30E and H33Q displayed unchanged TOPFLASH reporter activity. It was hypothesized that KCTD1 mutations that cause SEN syndrome may result in abnormal regulation of AP-2α and developmental defects.

Char syndrome is characterized by patent ductus arteriosis, facial dysmorphism and incurving fifth fingers (37). The PY motif in AP-2 protein family is associated with Char syndrome as autosomal dominant diseases (7). The PY motif is conserved in the transcription activation domain of AP-2 proteins and KCTD1 binds to this transactivation domain. KCTD1 inhibited the transcriptional activation of AP-2α by three-fold, whereas KCTD1 only suppressed the transcriptional activity of AP-2α P60A and P61R by one-half, and did not decrease the transcriptional activity of AP-2α P59A (Fig. 1D), indicating that regulatory the AP-2α mutation could been influenced by differential regulation of KCTD1.

The Wnt/β-catenin signaling pathway serves a key role in embryonic developmental processes (22,38,39) and carcinogenesis (4042). Truncations in APC are frequently found in familial adenomatous polyposis, a dominantly inherited disease characterized by polyps in the colon and rectum (43,44). Mutations in β-catenin and APC cause sporadic colon cancer and other types of tumor, such as liver cancer and intraductal papillary neoplasms of the bile duct (4547). KCTD1 directly binds to β-catenin, enhances its degradation and inhibits the canonical Wnt/β-catenin signaling pathway (18). In the present study, AP-2α and KCTD1 downregulated β-catenin expression levels in individual transfection experiments and decreased SW480 cell viability, although both of these proteins exhibited stronger inhibitory effects on β-catenin protein levels and cell viability in co-transfection experiments, potentially due to the negative regulatory association between AP-2α and KCTD1. The chemotherapy drug cisplatin enhanced the influence of both genes on SW480 cell viability.

In summary, the present data demonstrated that KCTD1 mutants causing SEN syndrome did not bind AP-2α and exhibited no inhibitory effects on AP-2α, and that KCTD1 was not associated with AP-2α P59A-induced Char syndrome. The interactions between KCTD1 mutants/wild-type AP-2α or wild-type KCTD1/AP-2α mutants were abrogated as a potential effect of altered localization, including KCTD1 mutants P20S, P31H, H33P and AP-2α mutants P59A and 4A. However, the majority of KCTD1 and AP-2α mutants inhibited TOPFLASH reporter activity to different extents, and wild-type KCTD1 and AP-2α downregulated β-catenin expression levels and decreased SW480 cell viability. Further investigation using an animal model is required to fully elucidate the regulatory mechanisms of these proteins in SEN and Char syndrome.

Supplementary Material

Supporting Data

Acknowledgements

The authors would like to thank Dr Limin Li (Hunan Normal University, Changsha, China) for critical editing of the manuscript.

Funding

The present study was supported by The National Natural Science Foundation of China (grant no. 81872256, 81770389 and 81272190), and The Cooperative Innovation Center of Engineering and New Products for Developmental Biology of Hunan Province (grant no. 20134486).

Availability of data and materials

The datasets used and analyzed during this study are available from the corresponding author on reasonable request.

Authors' contributions

XD designed the present study and wrote the manuscript. LH, LC, WH, ZY, LY, XL, QL and JQ performed the experiments and analyzed the data. All authors read and approved the final version of the manuscript.

Ethics approval and consent to participate

Not applicable.

Patient consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

References

1 

Finlay AY and Marks R: An hereditary syndrome of lumpy scalp, odd ears and rudimentary nipples. Br J Dermatol. 99:423–430. 1978. View Article : Google Scholar : PubMed/NCBI

2 

van Steensel MA, Celli J, van Bokhoven JH and Brunner HG: Probing the gene expression database for candidate genes. Eur J Hum Genet. 7:910–919. 1999. View Article : Google Scholar : PubMed/NCBI

3 

Marneros AG, Beck AE, Turner EH, McMillin MJ, Edwards MJ, Field M, de Macena Sobreira NL, Perez ABA, Fortes JAR, Lampe AK, et al: Mutations in KCTD1 cause scalp-ear-nipple syndrome. Am J Hum Genet. 92:621–626. 2013. View Article : Google Scholar : PubMed/NCBI

4 

Zhang J, Hagopian-Donaldson S, Serbedzija G, Elsemore J, Plehn-Dujowich D, McMahon AP, Flavell RA and Williams T: Neural tube, skeletal and body wall defects in mice lacking transcription factor AP-2. Nature. 381:238–241. 1996. View Article : Google Scholar : PubMed/NCBI

5 

Ahituv N, Erven A, Fuchs H, Guy K, Ashery-Padan R, Williams T, de Angelis MH, Avraham KB and Steel KP: An ENU-induced mutation in AP-2alpha leads to middle ear and ocular defects in doarad mice. Mamm Genome. 15:424–432. 2004. View Article : Google Scholar : PubMed/NCBI

6 

Sletten LJ and Pierpont ME: Familial occurrence of patent ductus arteriosus. Am J Med Genet. 57:27–30. 1995. View Article : Google Scholar : PubMed/NCBI

7 

Zhao F, Weismann CG, Satoda M, Pierpont ME, Sweeney E, Thompson EM and Gelb BD: Novel TFAP2B mutations that cause char syndrome provide a genotype-phenotype correlation. Am J Hum Genet. 69:695–703. 2001. View Article : Google Scholar : PubMed/NCBI

8 

Li H, Sheridan R and Williams T: Analysis of TFAP2A mutations in branchio-oculo-facial syndrome indicates functional complexity within the AP-2α DNA-binding domain. Hum Mol Genet. 22:3195–3206. 2013. View Article : Google Scholar : PubMed/NCBI

9 

Milunsky JM, Maher TA, Zhao G, Roberts AE, Stalker HJ, Zori RT, Burch MN, Clemens M, Mulliken JB, Smith R and Lin AE: TFAP2A mutations result in branchio-oculo-facial syndrome. Am J Hum Genet. 82:1171–1177. 2008. View Article : Google Scholar : PubMed/NCBI

10 

Milunsky JM, Maher TM, Zhao G, Wang Z, Mulliken JB, Chitayat D, Clemens M, Stalker HJ, Bauer M, Burch M, et al: Genotype-phenotype analysis of the branchio-oculo-facial syndrome. Am J Med Genet A 155A. 22–32. 2011. View Article : Google Scholar

11 

Dumitrescu AV, Milunsky JM, Longmuir SQ and Drack AV: A family with branchio-oculo-facial syndrome with primarily ocular involvement associated with mutation of the TFAP2A gene. Ophthalmic Genet. 33:100–106. 2012. View Article : Google Scholar : PubMed/NCBI

12 

Thomeer HG, Crins TT, Kamsteeg EJ, Buijsman W, Cruysberg JR, Knoers NV and Cremers CWRJ: Clinical presentation and the presence of hearing impairment in branchio-oculo-facial syndrome: A new mutation in the TFAP2A gene. Ann Otol Rhinol Laryngol. 119:806–814. 2010. View Article : Google Scholar : PubMed/NCBI

13 

Ding X, Luo C, Zhou J, Zhong Y, Hu X, Zhou F, Ren K, Gan L, He A, Zhu J, et al: The interaction of KCTD1 with transcription factor AP-2alpha inhibits its transactivation. J Cell Biochem. 106:285–295. 2009. View Article : Google Scholar : PubMed/NCBI

14 

Zarelli VE and Dawid IB: Inhibition of neural crest formation by Kctd15 involves regulation of transcription factor AP-2. Proc Natl Acad Sci USA. 110:2870–2875. 2013. View Article : Google Scholar : PubMed/NCBI

15 

Heffer A, Marquart GD, Aquilina-Beck A, Saleem N, Burgess HA and Dawid IB: Generation and characterization of Kctd15 mutations in zebrafish. PLoS One. 12:e01891622017. View Article : Google Scholar : PubMed/NCBI

16 

Dutta S and Dawid IB: Kctd15 inhibits neural crest formation by attenuating Wnt/beta-catenin signaling output. Development. 137:3013–3018. 2010. View Article : Google Scholar : PubMed/NCBI

17 

Li Q and Dashwood RH: Activator protein 2alpha associates with adenomatous polyposis coli/beta-catenin and inhibits beta-catenin/T-cell factor transcriptional activity in colorectal cancer cells. J Biol Chem. 279:45669–45675. 2004. View Article : Google Scholar : PubMed/NCBI

18 

Li X, Chen C, Wang F, Huang W, Liang Z, Xiao Y, Wei K, Wan Z, Hu X, Xiang S, et al: KCTD1 suppresses canonical Wnt signaling pathway by enhancing β-catenin degradation. PLoS One. 9:e943432014. View Article : Google Scholar : PubMed/NCBI

19 

Ding X, Fan C, Zhou J, Zhong Y, Liu R, Ren K, Hu X, Luo C, Xiao S, Wang Y, et al: GAS41 interacts with transcription factor AP-2beta and stimulates AP-2beta-mediated transactivation. Nucleic Acids Res. 34:2570–2578. 2006. View Article : Google Scholar : PubMed/NCBI

20 

Ding X, Yang Z, Zhou F, Wang F, Li X, Chen C, Li X, Hu X, Xiang S and Zhang J: Transcription factor AP-2α regulates acute myeloid leukemia cell proliferation by influencing hoxa gene expression. Int J Biochem Cell Biol. 45:1647–1656. 2013. View Article : Google Scholar : PubMed/NCBI

21 

Ding XF, Luo C, Ren KQ and Zhang J, Zhou JL, Hu X, Liu RS, Wang Y, Gao X and Zhang J: Characterization and expression of a human KCTD1 gene containing the BTB domain, which mediates transcriptional repression and homomeric interactions. DNA Cell Biol. 27:257–265. 2008. View Article : Google Scholar : PubMed/NCBI

22 

Clevers H: Wnt/beta-catenin signaling in development and disease. Cell. 127:469–480. 2006. View Article : Google Scholar : PubMed/NCBI

23 

Baron R and Kneissel M: WNT signaling in bone homeostasis and disease: From human mutations to treatments. Nat Med. 19:179–192. 2013. View Article : Google Scholar : PubMed/NCBI

24 

Gay A and Towler DA: Wnt signaling in cardiovascular disease: Opportunities and challenges. Curr Opin Lipidol. 28:387–396. 2017. View Article : Google Scholar : PubMed/NCBI

25 

Ng L, Kaur P, Bunnag N, Suresh J, Sung ICH, Tan QH, Gruber J and Tolwinski NS: WNT signaling in disease. Cells. 8:8262019. View Article : Google Scholar

26 

Li X, Peng H, Schultz DC, Lopez-Guisa JM, Rauscher FJ III and Marmorstein R: Structure-function studies of the BTB/POZ transcriptional repression domain from the promyelocytic leukemia zinc finger oncoprotein. Cancer Res. 59:5275–5282. 1999.PubMed/NCBI

27 

Fedele M, Benvenuto G, Pero R, Majello B, Battista S, Lembo F, Vollono E, Day PM, Santoro M, Lania L, et al: A novel member of the BTB/POZ family, PATZ, associates with the RNF4 RING finger protein and acts as a transcriptional repressor. J Biol Chem. 275:7894–7901. 2000. View Article : Google Scholar : PubMed/NCBI

28 

Hoatlin ME, Zhi Y, Ball H, Silvey K, Melnick A, Stone S, Arai S, Hawe N, Owen G, Zelent A and Licht JD: A novel BTB/POZ transcriptional repressor protein interacts with the fanconi anemia group C protein and PLZF. Blood. 94:3737–3747. 1999. View Article : Google Scholar : PubMed/NCBI

29 

Kelly KF and Daniel JM: POZ for effect--POZ-ZF transcription factors in cancer and development. Trends Cell Biol. 16:578–587. 2006. View Article : Google Scholar : PubMed/NCBI

30 

Kojima S, Hatano M, Okada S, Fukuda T, Toyama Y, Yuasa S, Ito H and Tokuhisa T: Testicular germ cell apoptosis in Bcl6-deficient mice. Development. 128:57–65. 2001.PubMed/NCBI

31 

Shaffer AL, Yu X, He Y, Boldrick J, Chan EP and Staudt LM: BCL-6 represses genes that function in lymphocyte differentiation, inflammation, and cell cycle control. Immunity. 13:199–212. 2000. View Article : Google Scholar : PubMed/NCBI

32 

Barna M, Hawe N, Niswander L and Pandolfi PP: Plzf regulates limb and axial skeletal patterning. Nat Genet. 25:166–172. 2000. View Article : Google Scholar : PubMed/NCBI

33 

Costoya JA, Hobbs RM, Barna M, Cattoretti G, Manova K, Sukhwani M, Orwig KE, Wolgemuth DJ and Pandolfi PP: Essential role of Plzf in maintenance of spermatogonial stem cells. Nat Genet. 36:653–659. 2004. View Article : Google Scholar : PubMed/NCBI

34 

Huang C, Hatzi K and Melnick A: Lineage-specific functions of Bcl-6 in immunity and inflammation are mediated by distinct biochemical mechanisms. Nat Immunol. 14:380–388. 2013. View Article : Google Scholar : PubMed/NCBI

35 

Ahmad KF, Engel CK and Prive GG: Crystal structure of the BTB domain from PLZF. Proc Natl Acad Sci USA. 95:12123–12128. 1998. View Article : Google Scholar : PubMed/NCBI

36 

Carey RM, Balcz BA, Lopez-Coviella I and Slack BE: Inhibition of dynamin-dependent endocytosis increases shedding of the amyloid precursor protein ectodomain and reduces generation of amyloid beta protein. BMC Cell Biol. 6:302005. View Article : Google Scholar : PubMed/NCBI

37 

Char F: Peculiar facies with short philtrum, duck-bill lips, ptosis and low-set ears-a new syndrome? Birth Defects Orig Artic Ser. 14:303–305. 1978.PubMed/NCBI

38 

Marston DJ, Roh M, Mikels AJ, Nusse R and Goldstein B: Wnt signaling during caenorhabditis elegans embryonic development. Methods Mol Biol. 469:103–111. 2008. View Article : Google Scholar : PubMed/NCBI

39 

Munoz-Descalzo S, Hadjantonakis AK and Arias AM: Wnt/ß-catenin signalling and the dynamics of fate decisions in early mouse embryos and embryonic stem (ES) cells. Semin Cell Dev Biol. 47-48:101–109. 2015. View Article : Google Scholar : PubMed/NCBI

40 

Wang B, Tian T, Kalland KH, Ke X and Qu Y: Targeting Wnt/β-catenin signaling for cancer immunotherapy. Trends Pharmacol Sci. 39:648–658. 2018. View Article : Google Scholar : PubMed/NCBI

41 

Wang W, Smits R, Hao H and He C: Wnt/β-catenin signaling in liver cancers. Cancers (Basel). 11:9262019. View Article : Google Scholar

42 

Jung YS and Park JI: Wnt signaling in cancer: Therapeutic targeting of Wnt signaling beyond β-catenin and the destruction complex. Exp Mol Med. 52:183–191. 2020. View Article : Google Scholar : PubMed/NCBI

43 

Nishisho I, Nakamura Y, Miyoshi Y, Miki Y, Ando H, Horii A, Koyama K, Utsunomiya J, Baba S and Hedge P: Mutations of chromosome 5q21 genes in FAP and colorectal cancer patients. Science. 253:665–669. 1991. View Article : Google Scholar : PubMed/NCBI

44 

Nakamura Y, Nishisho I, Kinzler KW, Vogelstein B, Miyoshi Y, Miki Y, Ando H, Horii A and Nagase H: Mutations of the adenomatous polyposis coli gene in familial polyposis coli patients and sporadic colorectal tumors. Princess Takamatsu Symp. 22:285–292. 1991.PubMed/NCBI

45 

Suraweera N, Robinson J, Volikos E, Guenther T, Talbot I, Tomlinson I and Silver A: Mutations within Wnt pathway genes in sporadic colorectal cancers and cell lines. Int J Cancer. 119:1837–1842. 2006. View Article : Google Scholar : PubMed/NCBI

46 

Colnot S: Focusing on beta-catenin activating mutations to refine liver tumor profiling. Hepatology. 64:1850–1852. 2016. View Article : Google Scholar : PubMed/NCBI

47 

Fujikura K, Akita M, Ajiki T, Fukumoto T, Itoh T and Zen Y: Recurrent mutations in APC and CTNNB1 and activated Wnt/β-catenin signaling in intraductal papillary neoplasms of the bile duct: A whole exome sequencing study. Am J Surg Pathol. 42:1674–1685. 2018. View Article : Google Scholar : PubMed/NCBI

Related Articles

Journal Cover

November-2020
Volume 22 Issue 5

Print ISSN: 1791-2997
Online ISSN:1791-3004

Sign up for eToc alerts

Recommend to Library

Copy and paste a formatted citation
x
Spandidos Publications style
Hu L, Chen L, Yang L, Ye Z, Huang W, Li X, Liu Q, Qiu J and Ding X: KCTD1 mutants in scalp‑ear‑nipple syndrome and AP‑2α P59A in Char syndrome reciprocally abrogate their interactions, but can regulate Wnt/β‑catenin signaling. Mol Med Rep 22: 3895-3903, 2020
APA
Hu, L., Chen, L., Yang, L., Ye, Z., Huang, W., Li, X. ... Ding, X. (2020). KCTD1 mutants in scalp‑ear‑nipple syndrome and AP‑2α P59A in Char syndrome reciprocally abrogate their interactions, but can regulate Wnt/β‑catenin signaling. Molecular Medicine Reports, 22, 3895-3903. https://doi.org/10.3892/mmr.2020.11457
MLA
Hu, L., Chen, L., Yang, L., Ye, Z., Huang, W., Li, X., Liu, Q., Qiu, J., Ding, X."KCTD1 mutants in scalp‑ear‑nipple syndrome and AP‑2α P59A in Char syndrome reciprocally abrogate their interactions, but can regulate Wnt/β‑catenin signaling". Molecular Medicine Reports 22.5 (2020): 3895-3903.
Chicago
Hu, L., Chen, L., Yang, L., Ye, Z., Huang, W., Li, X., Liu, Q., Qiu, J., Ding, X."KCTD1 mutants in scalp‑ear‑nipple syndrome and AP‑2α P59A in Char syndrome reciprocally abrogate their interactions, but can regulate Wnt/β‑catenin signaling". Molecular Medicine Reports 22, no. 5 (2020): 3895-3903. https://doi.org/10.3892/mmr.2020.11457