miR-204 regulates the biological behavior of breast cancer MCF-7 cells by directly targeting FOXA1
- Authors:
- Published online on: May 16, 2017 https://doi.org/10.3892/or.2017.5644
- Pages: 368-376
Abstract
Introduction
Breast cancer is the most common type of cancer in women worldwide, and it is also the leading cause of cancer-related deaths among women in both less developed countries and worldwide (1). Despite the advancements that have been made in multidisciplinary and diagnostic approaches, the incidence of breast cancer and the associated mortality rate remain as high as 25.1 and 14.7%, respectively (2). In the US, breast cancer was the most frequently diagnosed cancer in women in 2016, with the proportion of such cancers reaching 29% (3). In China, the situation is even more severe since women younger than 45 years of age who are diagnosed with breast cancer generally succumb to the disease and the age-standardized incidence rates have seen a significant upward trend (4). Currently, specific, standard and independent prognostic factors have been established for breast cancer, including tumor size, pathological grade, clinical stage and the presence of lymph node metastases, as well as hormone receptor status. Although these parameters can reflect the biological characteristics of a tumor, the underlying pathogenesis of breast cancer tumors remains unclear. Furthermore, both genetic and environmental factors contribute to the complex etiology of breast cancer. It is therefore essential and urgent that researchers investigate the mechanisms underlying breast cancer pathologies.
MicroRNAs (miRNAs) are short, non-protein-coding RNAs and transcripts that are 18–24 nt in length. miRNAs regulate gene expression at the post-transcriptional level by binding to complementary sites in the 3′-untranslated regions (3′-UTRs) of their target mRNAs (5,6). miRNAs play a vital role in breast cancer as they are reported to be involved in tumor progression, particularly in blocking apoptosis and promoting uncontrolled cell disruption (7). For example, miR-155, miR-373 and miR-520c have each been shown to be upregulated, and to act as oncogenic miRNAs in breast cancer (8–10), whereas miR-34, miR-200c and miR-205 have been shown to be downregulated and to act as tumor suppressors in breast cancer (11–14). Li et al (15) demonstrated that the expression of miR-204 was expressed at markedly lower levels in breast cancer tissues than in adjacent normal breast tissues. Wang et al (16) found that miR-204 targeted and suppressed JAK2 which prevented the activation of Bcl-2, STAT3 and survivin in breast cancer cells. As a single miRNA targets multiple genes, and other target genes of miR-204 have not yet been fully identified, there is a possibility that the role of miR-204 in breast cancer is achieved through its effects on other targets. The molecular mechanisms involved in the role of miR-204 therefore remain to be investigated.
Using predictive online databases, we determined that fork head box A1 (FOXA1) is a prospective target gene of miR-204. FOXA1 is a member of the FOX family of transcription factors and is also known as hepatocyte nuclear factor 3α (HNF3α). Initially, FOXA1 was identified in the liver and has been reported to be a transcriptional regulator of transthyretin (TTR) and α1-antitrypsin (α1-AT) (17). High levels of FOXA1 have been reported in lung cancer, thyroid carcinoma, esophageal squamous cell carcinoma and prostate cancer (18–21), in addition to breast cancer (22). Notably, the current literature shows that the expression of FOXA1 is inversely proportional to that of miR-204 in breast cancer; when FOXA1 is highly expressed, miR-204 is expressed at low levels. When the opposite expression pattern is observed, the effects of both factors on biological behavior are also opposing. For instance, miR-204 restrains cell growth and induces apoptosis (16), whereas FOXA1 promotes cell growth and inhibits apoptosis (18). We therefore hypothesized that there may be a relationship between FOXA1 expression and miR-204 levels.
In the present study, we investigated the biological function of miR-204 in breast cancer and explored the potential molecular mechanisms by which miR-204 targets FOXA1 in the breast cancer cell line MCF-7.
Materials and methods
Cell lines and cultures
The human breast cancer MCF-7 cell line and the human embryonic kidney HEK293T cell line were purchased from the Shanghai Institute of Cell Biology (Shanghai, China). The human breast epithelial cell line HBL-100 was purchased from Boster Biotech (Wuhan, China). The cells were cultured in Dulbecco's modified Eagle's medium (DMEM) with high glucose (Wisent, Nanjing, China) and supplemented with 15% fetal bovine serum (FBS; ExCell Bio, Shanghai, China), 1 mM penicillin-streptomycin solution and 1 mM L-glutamine in a humidified incubator at 37°C with 5% CO2.
miRNA transfection
The experiment was divided into three groups: control (normal MCF-7 cells), NC (MCF-7 cells infected with a negative control virus), and LV-hsa-mir-204 (MCF-7 cells infected with the miR-204-up virus). miR-204-up viruses (LV-hsa-mir-204) with the following sequences were obtained from GeneGeme (Shanghai, China): hsa-mir-204-P1, GAGGATCCCCGGGTACCGGTCCTGATCATGTACCCA TAGG and hsa-mir-204-P2, CACACATTCCACAGGCTAG CTTATGGGACAGTTATGGGC. MCF-7 cells were seeded into 6-well plates at a density of 1×105 cells/well (in a 1 ml volume of cell medium), and then cultured overnight before transfection. Lentiviruses were added to the MCF-7 cells to induce infection. Three days after infection, the levels of intracellular fluorescent markers were analyzed using a fluorescence microscope. The cells were then harvested to examine the changes in the expression of miR-204 and FOXA1 mRNA and protein.
Target prediction
The following online biological databases were used to predict the targets of miRNAs: microRNA.org (http://www.microrna.org/microrna/home.do), miRWalk (http://www.umm.uni-heidelberg.de/apps/zmf/mirwalk/), DIANA (http://diana.imis.athena-innovation.gr/DianaTools/), and TargetScan (http://www.targetscan.org/).
Data integration
The cBioPortal database (http://www.cbioportal.org/), which is a subsidiary database of The Cancer Genome Atlas (TCGA; http://cancergenome.nih.gov/), was used to select chips of invasive breast cancer and to analyze the relevant clinical parameters for miR-204 and FOXA1. The STRING database (http://string-db.org/) was used to analyze the interactions of FOXA1.
RNA isolation, quality control and RT-qPCR
Total RNA was extracted from cells in each of the three groups using an AxyPrep Multisource Total RNA Miniprep kit (Axygen, Suzhou, China). The concentration of total RNA in the samples was determined using a NanoDrop 2000 instrument (Thermo Fisher Scientific, Waltham, MA, USA). The samples were required to meet the following qualifications: 1.8<OD260/280<2.0. For reverse transcription, we used a Thermo Fisher Scientific RevertAid First Strand cDNA synthesis kit (Thermo Fisher Scientific) and a miRcute miRNA First-Strand cDNA synthesis kit (TianGen, Beijing, China), each according to the manufacturer's instructions, to obtain cDNA. qPCR analysis was performed to determine FOXA1 and miR-204 levels using SYBR-Green Premix Ex Taq (Roche Life Science) and miRcute miRNA qPCR detection kits (SYBR-Green) (TianGen), respectively, in a LightCycler 480 (Roche, Basel, Switzerland). β-actin and U6 were used as internal controls, respectively. The following primers were used: β-actin (23) forward, 5′-GCACCACACCTTCTACAATGAGC-3′ and reverse, 5′-GGATAGCACAGCCTGGATAGCAAC-3′; and FOXA1 (24) forward, 5′-AATCATTGCCATCGTGTG-3′ and reverse, 5′-CGCGGCTTAAAATCTGGTAT-3′. The primers for miR-204 and U6 were purchased from TianGen, and the sequences were determined.
Cell viability assay
Cell viability was assessed using 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT; Sigma-Aldrich, St. Louis, MO, USA). Cells in each of the three groups were seeded in 96-well plates in a volume of 0.2 ml of medium/well resulting in a density of 3,000 cells/well. The cells were incubated at 37°C with 5% CO2 for 24, 48, 72 and 96 h. MTT (20 µl) was added to each well, and the cells were incubated for 4 h at 37°C. The cell culture medium was then removed, and 150 µl of dimethyl sulfoxide (DMSO) (Sigma-Aldrich) was mixed into each well to stop the reaction. The solution was shaken for 10 min, and the optical densitiy (OD) value was detected at 490 nm using a microplate reader (Scientific Multiskan FC; Thermo Fisher Scientific).
Cell invasion and migration assays
A Transwell chamber with 8-µm pores (Corning Inc., Corning, New York, USA) was prepared for the invasion and migration assays. Samples of each of the three groups of cells were resuspended in 200 µl of DMEM, and seeded in the upper chambers at a density of 1×105 cells/well with (for the invasion tests) or without (for the migration tests) Matrigel (BD Biosciences, Franklin Lakes, NJ, USA). DMEM (500 µl) supplemented with 15% FBS was added to the bottom chambers. After 24 h (migration assays) or 48 h (invasion assay), the cells in the top chambers were removed using cotton swabs. The chambers and the penetrated cells were fixed with 4% paraformaldehyde and stained with 0.1% crystal violet for 30 min. The number of cells was observed under an inverted microscope at a magnification of ×200.
Flow cytometric analysis
A PE Annexin V apoptosis detection kit I (BD Biosciences) was used to detect the apoptotic effects of miR-204 according to the manufacturer's protocol. Samples of cells from each of the three groups were washed with cold phosphate-buffered saline (PBS) twice, and then, resuspended in 1X binding buffer. The solution was then transferred to a 5-ml culture tube. PE Annexin V (5 µl) and 5 µl of 7-AAD were added to the tubes, and the reagents were then mixed with the cells. The cells were incubated for 15 min in the dark. Then, 400 µl of 1X binding buffer was added to each tube and the rate of apoptosis was analyzed using flow cytometry after 1 h.
Protein extraction and western blot analysis
Total proteins were extracted from the cells, and western blot analyses were performed as previously described (25). The cells were treated with 99 mM radio immunoprecipitation assay (RIPA) buffer and 1 mM phenylmethanesulfonyl fluoride (PMSF). The lysates were centrifuged at 12,000 × g for 5 min and boiled for 7 min. The proteins were subjected to 8% SDS-PAGE for 2 h at 70 V, and the separated proteins were then transferred to polyvinylidene fluoride (PVDF) membranes (Millipore, Billerica, MA, USA) for 90 min at 100 mA. The membrane was then incubated with FOXA1 antibodies (1:1,000; Abcam, Cambridge, MA, USA) and GAPDH antibodies (1:10,000; KangChen, Shanghai, China) overnight at 4°C. Next, the membranes were incubated for 1.5 h with horseradish peroxidase-conjugated goat anti-rabbit IgG secondary antibodies (1:50,000; Santa Cruz Biotechnology, Santa Cruz, CA, USA). Finally, the membranes were analyzed using chemiluminescence detection methods with a Pierce ECL Western Blot Substrate (Thermo Fisher Scientific).
Luciferase assay
The interaction between the 3′-UTR of FOXA1 and miR-204 was analyzed using plasmids synthesized by Biosense Technologies (Guangzhou, China). HEK293T cells were seeded in 24-well plates at a density of 1.5×105 cells/well and cultured for 24 h. The plasmids were transfected into the HEK293T cells using Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA). Luciferase activity was tested by a Dual Luciferase Reporter Assay System (Promega, Madison, WI, USA) (10,23).
Statistical analyses
All experiments were performed in triplicate. The data were analyzed using SPSS 20.0 software (SPSS, Inc., Chicago, IL, USA) and are expressed as the means ± standard deviations (SD). One-way analysis of variance (ANOVA) tests were performed to analyzed the results across the three groups. Two-way ANOVA tests were used to analyzed the results of the growth curves. Student's t-test was used to determine differences between the control and LV-hsa-mir-204 group. The data related to clinicopathological parameters were analyzed using Chi-square or Fisher's exact test. A value of P<0.05 was considered to indicate statistical significance.
Results
miR-204 target gene predictions
FOXA1, a transcription factor, was one of the 8,312 predicted targets of miR-204. All four databases (microRNA.org, miRWalk, DIANA and TargetScan) predicted that its expression was correlated with levels of miR-204. FOXA1 has been reported to play an essential role in cell proliferation (26), the cell cycle (27), DNA methylation (28) and tumor development and progression (21). We therefore focused on the relationship between miR-204 and FOXA1.
miR-204 is expressed at low levels and FOXA1 is expressed at high levels in breast cancer tissues
We obtained and collated 1,105 breast cancer chips from the cBioPortal database. Among these, 898 and 1,095 cases expressed miR-204 and FOXA1, respectively. In addition, 100 normal chips were selected. miR-204 was expressed at lower levels in breast cancer tissues than these levels in normal tissues (P<0.001; Fig. 1A), and FOXA1 was expressed at higher levels in breast cancer tissues than these levels in normal tissues (P<0.001; Fig. 1B).
Association of miR-204 and FOXA1 with clinicopathological characteristics
Of the 1,105, 808 and 999 cases were screened to obtain complete clinical data related to the expression of miR-204 and FOXA1. The identified correlations between miR-204 and tumor characteristics are shown in Table I. The expression of miR-204 was strongly associated with lymph node stage (P=0.026), cancer metastasis stage (P<0.0001), progesterone receptor (PR) status (P=0.044) and Her2 status (P=0.014). As shown in Table II, FOXA1 expression was significantly correlated with age (P<0.0001), lymph node stage (P=0.022), estrogen receptor (ER) status (P<0.0001) and PR status (P<0.0001).
![]() | Table I.Associations between miR-204 expression and clinicopathological characteristics of the breast cancer cases (N=809). |
![]() | Table II.Relationships between FOXA1 and clinicopathological parameters in the breast cancer cases (N=999). |
miR-204 is downregulated and FOXA1 is upregulated in breast cancer MCF-7 cells
We detected the expression of miR-204 and FOXA1 in MCF-7 cells. As shown in Fig. 1C, miR-204 was expressed at significantly lower levels in the MCF-7 cells than that in the normal human breast epithelial cells (HBL-100) (P<0.001). Meanwhile, FOXA1 was highly expressed in the MCF-7 cells (P<0.001; Fig. 1D). To determine whether there is an interaction between miR-204 and FOXA1, we transfected the miR-204-up virus (LV-hsa-mir-204) into MCF-7 cells (P<0.001; Fig. 1E). The miR-204 mRNA level was markedly increased, while the FOXA1 mRNA level was strikingly decreased (P<0.001; Fig. 1F).
miR-204 inhibits proliferation and induces apoptosis in MCF-7 cells
To determine the effect of upregulated levels of miR-204 on the proliferation of MCF-7 cells, we performed MTT assays. As shown in Fig. 2A, we confirmed that the cells in the LV-hsa-mir-204 group showed significantly inhibited growth in a time-dependent manner, with a particularly strong inhibitory effect being observed in the LV-hsa-mir-204 group at 96 h (0.63±0.01) when their growth was similar to that of the control (0.88±0.03) and NC group (0.86±0.04). Meanwhile, we also assessed apoptosis rates using flow cytometry. The LV-hsa-mir-204 group showed a much higher rate of apoptosis (34.7±1.9%) than the control and NC groups (Fig. 2B).
miR-204 suppresses cell invasion and migration
We performed Transwell assays to explore whether miR-204 affects cell invasion and migration. Transwell invasion assays performed in Matrigel showed that the ability of MCF-7 cells to invade was inhibited in the LV-hsa-mir-204 group, and the number of cells that were transfected with the miR-204-containing vector (75±9) penetrated the membrane at a strikingly lower rate than the control (254±17) and NC (242±22) cells (Fig. 3A, B and E). Transwell migration assays performed without Matrigel revealed that the number of cells that penetrated the membrane (102±8) was clearly lower in the LV-hsa-mir-204 group than that in the control (298±18) and NC (277±15) groups (Fig. 3C, D and F).
miR-204 directly targets the 3′-UTR of FOXA1
To confirm that miR-204 directly targets FOXA1, potential binding sites were predicted using microRNA.org (Fig. 4A), and a luciferase report was subsequently performed (Fig. 4B). Luciferase activity was clearly lower in the cells that were co-transfected with FOXA1-WT 3′-UTR and miR-204 mimics (0.48±0.05) than in the control cells, implying that miR-204 specifically binds to FOXA1 mRNA. Furthermore, the impact of miR-204 on the protein level of FOXA1 was assessed using western blot analysis. The results showed that miR-204-up clearly suppressed the protein level of FOXA1 (Fig. 4C and D). This change in the expression of the FOXA1 protein supports our hypothesis.
The FOXA1 network
Using the STRING database, we preliminarily characterized the FOXA1 network and identified 10 predicted functional partners, including androgen receptor (AR), estrogen receptor 1 (ESR1), NK2 homeobox-1 (NKX2-1), insulin (INS), secretoglobin, family 1A, member 1 (SCGB1A1), sonic Hedgehog (SHH), Forkhead box A2 (FOXA2), trefoil factor 1 (TFF1), NK3 homeobox-1 (NKX3-1) and transthyretin (TTR). Among these, the correlation scores for AR and ESR1 were the highest. All of the genes were tested using different experiments (Fig. 5).
Discussion
Breast cancer is a leading cause of cancer-related mortality in women. While methods for the diagnosis and systematical treatment of breast cancer have advanced, the prognosis for patients with this condition remains poor (29). In recent years, a large number of studies have reported that miRNAs are dysregulated in carcinomas via a series of biological processes. This influences the development of tumors by affecting processes including cell proliferation, apoptosis, the cell cycle and invasion and migration. Iorio et al (7) showed that miRNAs play a vital role in breast cancer by analyzing the structural characteristics and their functions in vivo. miR-204 was first identified as an anti-oncogene, and it was reported to downregulate non-small cell lung cancer (30), glioma (31), gastric (32) and thyroid cancer (33). Li et al (15) used RT-qPCR to show that the level of miR-204 was lower in breast cancer tissues than in adjacent normal breast tissues in 39 patients. In addition, lower levels of expression of miR-204 were associated with late TNM stage, distant metastasis and poor outcomes in a cohort of 129 breast cancer tissues (15). Wang et al (16) demonstrated that miR-204 targets JAK2 to regulate the STAT3/Bcl-2/survivin pathway in breast cancer. However, the potential molecular mechanism of miR-204 underlying its regulation of breast cancer progression is still ambiguous. Hence, we investigated the role of miR-204 by a series of in vitro experiments in the breast cancer cell line MCF-7.
As the number of samples used in previous studies was low, we consolidated relevant chips that were available in the TCGA database, and obtained relatively reliable results in the summary analysis. A low level of expression of miR-204 was associated with tumor stage and metastasis, and our preliminary results suggested that miR-204 may be involved in the process of metastasis in breast cancer. To further examine the effects of miR-204 on the biological function of breast cancer cells, a lentivirus that overexpressed miR-204 was transfected into MCF-7 cells. The results of MTT assays revealed that proliferation was markedly inhibited in the LV-hsa-mir-204 group of MCF-7 cells. Flow cytometry showed that the apoptosis rate was increased in the LV-hsa-mir-204 group. These results demonstrated that miR-204 restrained cell growth and induced apoptosis, which is in line with the results described by Wang et al (16). However, the difference was that we transfected a lentivirus rather than use chemical mimics, and we observed a higher transfection efficiency. The effect of transfection was therefore clearer, and the results were more reliable. A few studies have examined the role of miR-204 in invasion and metastasis in breast cancer, and we verified that cells markedly overexpressing miR-204 presented a reduced capacity to migrate into and invade the outer chamber in cell invasion and migration assays, similar to the results observed in glioma (31). miR-204 was reported to be downregulated in glioma tissues and to suppress glioma cell growth, invasion and metastasis by directly targeting RAB22A. In summary, these results indicate that miR-204 acts as a potential tumor-suppressor. The level of miR-204 was directly related to the progression of cancers, and its levels predicted the growth of the tumor, the prognosis, and even quality of life. In contrast, as miRNAs do not encode proteins, it is necessary for them to combine with hundreds of mRNAs to achieve their post transcriptional regulatory functions. We therefore attempted to identify potential target genes of miR-204 using online web tools, and 8,312 target genes were predicted. Some of these target genes have been studied. A functional analysis affirmed that miR-204 targets Bcl-2 and thereby acts as a tumor suppressor in gastric cancer (32). miR-204 also regulates HMGA2 to inhibit cell growth in human thyroid cancer (33). Among the nearly 8,500 genes that were identified, FOXA1 attracted our attention.
FOXA1 has been identified to participate in the formation and development of tumors, such as gastric (26), prostate (27), breast (28) and endometrial cancer (34). Knockdown of FOXA1 was found to inhibit proliferation and induce apoptosis in breast cancer MCF-7 cells (28). Importantly, FOXA1 is closely related to the estrogen receptor (ER), which plays a crucial role in breast cancer and the expression of which is correlated with ER-positive breast cancer (35). Mehta et al (36) reported that FOXA1 was upregulated in breast cancer. The expression of FOXA1 was positively correlated with ER-positivity and a good prognosis and was negatively correlated with tumor grade, tumor size, nodal status and HER2 levels (36,37). In GOBO (http://co.bmc.lu.se/gobo/), samples from a total of 1,881 patients were statistically correlated across 11 types of data. The statistically analyzed results of 1,620 cases showed that FOXA1 was highly expressed in ER-positive breast cancer and that high levels of expression of FOXA1 were inversely proportional to their grade, where a higher grade was associated with lower FOXA1 expression. Therefore, patients with a high level of FOXA1 were found to have a better prognosis. We also obtained data related to cell lines from GOBO, which indicated that FOXA1 was strongly expressed in the MCF-7 cell line. Partial results related to FOXA1 for the tissues and chips were obtained from the GEO database (http://www.ncbi.nlm.nih.gov/geo/). The TCGA study identified FOXA1 as a key regulator of ER function in invasive lobular breast carcinoma, and the cBioPortal database showed that FOXA1 was altered in 25 (2%) of 1,100 breast cancer samples. In all 25 of these cases, its expression was upregulated and the patients experience a poor outcome. A high level of FOXA1 in breast cancer was also correlated with lymph node stage, which may explained its essential role in the development of breast cancer. The related function network in cBioPortal, which we used to identify important tumor markers, showed that p53 and AFP play important roles in the evolution of cancer. In the STRING database, FOXA1 expression was predicted to share the strongest relationship with AR and ESR1, and it has been previously shown that both of these hormones are associated with mortality in females. Changes in their levels could result in the occurrence of various hormone-dependent diseases. Advanced age could also influence changes in the expression of AR and ESR1. FOXA1 may also influence AR and ESR1 through an interaction network. High FOXA1 levels were associated with age and were also indirectly shown to play a role in regulating hormone levels in breast cancer.
In the present study, we found that increased levels of miR-204 were associated with lower levels of FOXA1 at the mRNA level. As expected, western blot analysis revealed a negative correlation between FOXA1 and miR-204 levels. Thus, the focus of the present study was to investigate the functional mechanisms involved in the association between miR-204 and FOXA1. In luciferase reporter assays, the expression of a FOXA1 3′-UTR-containing plasmid was repressed in the presence of miR-204, while mutated FOXA1 3′-UTR resisted this effect. FOXA1 was also identified as a direct target of miR-204 in breast cancer MCF-7 cells. It is noteworthy that miRNAs can bind to multiple target genes to affect tumors. As previously mentioned, miR-204 regulated downstream factors by combining with Bcl-2 (16), and notably, Song et al (38) showed that Bcl-2 can specifically bind to FOXA1. Hence, a circular cycle may exist between miR-204, FOXA1 and Bcl-2, and they may jointly regulate apoptosis via the STAT3/Bcl-2/survivin pathway. miR-204 also regulates the function of tumors by altering the functions of these genes, which is supported by the present study of FOXA1. Nevertheless, many aspects of this interaction remain unexplored, and many experiments are needed to verify the hypothesis proposed in the present study.
The present study has some limitations. Firstly, the data were from experiments involving cell lines in vitro and lacked findings involving tissues. Results of experiments involving tissues could be further required from all the databases we searched with confirmation by RT-qPCR, immunohistochemical method and western blotting. Secondly, the functions and mechanisms proposed by the present study were explored and tested using only one cell line. Thirdly, in vivo experimental data were lacking.
In summary, we confirmed that miR-204 is downregulated in the MCF-7 cell line and suppressed cell growth, invasion and metastasis while promoting and stimulating apoptosis. FOXA1, as a direct target of miR-204, was found to be involved in the transcriptional control of downstream factors and pathways when it binds with miR-204. Therefore, miR-204 may be a novel predictive marker and a potential therapeutic target for breast cancer.
Acknowledgements
The present study was supported by grants from the National Natural Scientific Research Fund (nos. 81560386 and 81560489), and the Guangxi Natural Science Foundation (no. 2015jjAA40315).
Glossary
Abbreviations
Abbreviations:
miRNAs |
microRNAs |
FOXA1 |
forkhead box A1 |
HNF3α |
hepatocyte nuclear factor 3α |
TTR |
transthyretin |
α1-AT |
α1-antitrypsin |
AR |
androgen receptor |
ESR1 |
estrogen receptor 1 |
NKX2-1 |
NK2 homeobox 1 |
INS |
insulin |
SCGB1A1 |
secretoglobin, family 1A, member 1 |
SHH |
sonic Hedgehog |
FOXA2 |
Forkhead box A2 |
TFF1 |
trefoil factor 1 |
NKX3-1 |
NK3 homeobox 1 |
ER |
estrogen receptor |
References
Torre LA, Bray F, Siegel RL, Ferlay J, Lortet-Tieulent J and Jemal A: Global cancer statistics, 2012. CA Cancer J Clin. 65:87–108. 2015. View Article : Google Scholar : PubMed/NCBI | |
World Health Organization. IAfRoC: GLOBOCAN. 2012 http://globocan.iarc.fr/Default.aspx08 18–2016. | |
Siegel RL, Miller KD and Jemal A: Cancer statistics, 2016. CA Cancer J Clin. 66:7–30. 2016. View Article : Google Scholar : PubMed/NCBI | |
Chen W, Zheng R, Baade PD, Zhang S, Zeng H, Bray F, Jemal A, Yu XQ and He J: Cancer statistics in China, 2015. CA Cancer J Clin. 66:115–132. 2016. View Article : Google Scholar : PubMed/NCBI | |
Di Leva G, Garofalo M and Croce CM: MicroRNAs in cancer. Annu Rev Pathol. 9:287–314. 2014. View Article : Google Scholar : PubMed/NCBI | |
Hausser J and Zavolan M: Identification and consequences of miRNA-target interactions - beyond repression of gene expression. Nat Rev Genet. 15:599–612. 2014. View Article : Google Scholar : PubMed/NCBI | |
Iorio MV, Casalini P, Piovan C, Braccioli L and Tagliabue E: Breast cancer and microRNAs: Therapeutic impact. Breast. 20 Suppl 3:S63–S70. 2011. View Article : Google Scholar : PubMed/NCBI | |
Huang Q, Gumireddy K, Schrier M, le Sage C, Nagel R, Nair S, Egan DA, Li A, Huang G, Klein-Szanto AJ, et al: The microRNAs miR-373 and miR-520c promote tumour invasion and metastasis. Nat Cell Biol. 10:202–210. 2008. View Article : Google Scholar : PubMed/NCBI | |
Chen J, Wang BC and Tang JH: Clinical significance of microRNA-155 expression in human breast cancer. J Surg Oncol. 106:260–266. 2012. View Article : Google Scholar : PubMed/NCBI | |
Dinami R, Ercolani C, Petti E, Piazza S, Ciani Y, Sestito R, Sacconi A, Biagioni F, le Sage C, Agami R, et al: miR-155 drives telomere fragility in human breast cancer by targeting TRF1. Cancer Res74. 4145–4156. 2014. View Article : Google Scholar | |
Mackiewicz M, Huppi K, Pitt JJ, Dorsey TH, Ambs S and Caplen NJ: Identification of the receptor tyrosine kinase AXL in breast cancer as a target for the human miR-34a microRNA. Breast Cancer Res Treat. 130:663–679. 2011. View Article : Google Scholar : PubMed/NCBI | |
Piovan C, Palmieri D, Di Leva G, Braccioli L, Casalini P, Nuovo G, Tortoreto M, Sasso M, Plantamura I, Triulzi T, et al: Oncosuppressive role of p53-induced miR-205 in triple negative breast cancer. Mol Oncol. 6:458–472. 2012. View Article : Google Scholar : PubMed/NCBI | |
Bai WD, Ye XM, Zhang MY, Zhu HY, Xi WJ, Huang X, Zhao J, Gu B, Zheng GX, Yang AG, et al: MiR-200c suppresses TGF-β signaling and counteracts trastuzumab resistance and metastasis by targeting ZNF217 and ZEB1 in breast cancer. Int J Cancer135. 1356–1368. 2014. View Article : Google Scholar | |
Fu J, Xu X, Kang L, Zhou L, Wang S, Lu J, Cheng L, Fan Z, Yuan B, Tian P, et al: miR-30a suppresses breast cancer cell proliferation and migration by targeting Eya2. Biochem Biophys Res Commun. 445:314–319. 2014. View Article : Google Scholar : PubMed/NCBI | |
Li W, Jin X, Zhang Q, Zhang G, Deng X and Ma L: Decreased expression of miR-204 is associated with poor prognosis in patients with breast cancer. Int J Clin Exp Pathol. 7:3287–3292. 2014.PubMed/NCBI | |
Wang X, Qiu W, Zhang G, Xu S and Gao Q: YangZ: MicroRNA-204 targets JAK2 in breast cancer and induces cell apoptosis through the STAT3/BCl-2/survivin pathway. Int J Clin Exp Pathol. 8:5017–5025. 2015.PubMed/NCBI | |
Costa RH, Grayson DR and Darnell JE Jr: Multiple hepatocyte-enriched nuclear factors function in the regulation of transthyretin and alpha 1-antitrypsin genes. Mol Cell Biol. 9:1415–1425. 1989. View Article : Google Scholar : PubMed/NCBI | |
Nucera C, Eeckhoute J, Finn S, Carroll JS, Ligon AH, Priolo C, Fadda G, Toner M, Sheils O, Attard M, et al: FOXA1 is a potential oncogene in anaplastic thyroid carcinoma. Clin Cancer Res. 15:3680–3689. 2009. View Article : Google Scholar : PubMed/NCBI | |
Sano M, Aoyagi K, Takahashi H, Kawamura T, Mabuchi T, Igaki H, Tachimori Y, Kato H, Ochiai A, Honda H, et al: Forkhead box A1 transcriptional pathway in KRT7-expressing esophageal squamous cell carcinomas with extensive lymph node metastasis. Int J Oncol. 36:321–330. 2010.PubMed/NCBI | |
Deutsch L, Wrage M, Koops S, Glatzel M, Uzunoglu FG, Kutup A, Hinsch A, Sauter G, Izbicki JR, Pantel K, et al: Opposite roles of FOXA1NKX2-1 in lung cancer progression. Genes Chromosomes Cancer. 51:618–629. 2012. View Article : Google Scholar : PubMed/NCBI | |
Gerhardt J, Montani M, Wild P, Beer M, Huber F, Hermanns T, Müntener M and Kristiansen G: FOXA1 promotes tumor progression in prostate cancer and represents a novel hallmark of castration-resistant prostate cancer. Am J Pathol. 180:848–861. 2012. View Article : Google Scholar : PubMed/NCBI | |
Xu C, Wei Q, Guo J, Zhou JC, Mei J, Jiang ZN, Shen JG and Wang LB: FOXA1 expression significantly predict response to chemotherapy in estrogen receptor-positive breast cancer patients. Ann Surg Oncol. 22:2034–2039. 2015. View Article : Google Scholar : PubMed/NCBI | |
Huang Z, Huang L, Shen S, Li J, Lu H, Mo W, Dang Y, Luo D, Chen G and Feng Z: Sp1 cooperates with Sp3 to upregulate MALAT1 expression in human hepatocellular carcinoma. Oncol Rep. 34:2403–2412. 2015.PubMed/NCBI | |
Tu H, Wei G, Cai Q, Chen X, Sun Z, Cheng C, Zhang L, Feng Y, Zhou H, Zhou B, et al: MicroRNA-212 inhibits hepatocellular carcinoma cell proliferation and induces apoptosis by targeting FOXA1. Onco Targets Ther. 8:2227–2235. 2015.PubMed/NCBI | |
Chen G, Kronenberger P, Teugels E, Umelo IA and De Grève J: Targeting the epidermal growth factor receptor in non-small cell lung cancer cells: The effect of combining RNA interference with tyrosine kinase inhibitors or cetuximab. BMC Med. 10:282012. View Article : Google Scholar : PubMed/NCBI | |
Ren H, Zhang P, Tang Y, Wu M and Zhang W: Forkhead box protein A1 is a prognostic predictor and promotes tumor growth of gastric cancer. Onco Targets Ther. 8:3029–3039. 2015.PubMed/NCBI | |
Zhang C, Wang L, Wu D, Chen H, Chen Z, Thomas-Ahner JM, Zynger DL, Eeckhoute J, Yu J, Luo J, et al: Definition of a FoxA1 cistrome that is crucial for G1 to S-phase cell-cycle transit in castration-resistant prostate cancer. Cancer Res. 71:6738–6748. 2011. View Article : Google Scholar : PubMed/NCBI | |
Zheng L, Qian B, Tian D, Tang T, Wan S, Wang L, Zhu L and Geng X: FOXA1 positively regulates gene expression by changing gene methylation status in human breast cancer MCF-7 cells. Int J Clin Exp Pathol. 8:96–106. 2015.PubMed/NCBI | |
DeSantis C, Ma J, Bryan L and Jemal A: Breast cancer statistics, 2013. CA Cancer J Clin. 64:52–62. 2014. View Article : Google Scholar : PubMed/NCBI | |
Guo W, Zhang Y, Zhang Y, Shi Y, Xi J, Fan H and Xu S: Decreased expression of miR-204 in plasma is associated with a poor prognosis in patients with non-small cell lung cancer. Int J Mol Med. 36:1720–1726. 2015.PubMed/NCBI | |
Xia Z, Liu F, Zhang J and Liu L: Decreased expression of miRNA-204-5p contributes to glioma progression and promotes glioma cell growth, migration and invasion. PLoS One. 10:e01323992015. View Article : Google Scholar : PubMed/NCBI | |
Sacconi A, Biagioni F, Canu V, Mori F, Di Benedetto A, Lorenzon L, Ercolani C, Di Agostino S, Cambria AM, Germoni S, et al: miR-204 targets Bcl-2 expression and enhances responsiveness of gastric cancer. Cell Death Dis. 3:e4232012. View Article : Google Scholar : PubMed/NCBI | |
Wu ZY, Wang SM, Chen ZH, Huv SX, Huang K, Huang BJ, Du JL, Huang CM, Peng L, Jian ZX, et al: MiR-204 regulates HMGA2 expression and inhibits cell proliferation in human thyroid cancer. Cancer Biomark. 15:535–542. 2015. View Article : Google Scholar : PubMed/NCBI | |
Qiu M, Bao W, Wang J, Yang T, He X, Liao Y and Wan X: FOXA1 promotes tumor cell proliferation through AR involving the Notch pathway in endometrial cancer. BMC Cancer. 14:782014. View Article : Google Scholar : PubMed/NCBI | |
Hu Q, Luo Z, Xu T, Zhang JY, Zhu Y, Chen WX, Zhong SL, Zhao JH and Tang JH: FOXA1: A promising prognostic marker in breast cancer. Asian Pac J Cancer Prev. 15:11–16. 2014. View Article : Google Scholar : PubMed/NCBI | |
Mehta RJ, Jain RK, Leung S, Choo J, Nielsen T, Huntsman D, Nakshatri H and Badve S: FOXA1 is an independent prognostic marker for ER-positive breast cancer. Breast Cancer Res Treat. 131:881–890. 2012. View Article : Google Scholar : PubMed/NCBI | |
Hisamatsu Y, Tokunaga E, Yamashita N, Akiyoshi S, Okada S, Nakashima Y, Aishima S, Morita M, Kakeji Y and Maehara Y: Impact of FOXA1 expression on the prognosis of patients with hormone receptor-positive breast cancer. Ann Surg Oncol. 19:1145–1152. 2012. View Article : Google Scholar : PubMed/NCBI | |
Song L, Wei X, Zhang B, Luo X, Liu J, Feng Y and Xiao X: Role of Foxa1 in regulation of bcl2 expression during oxidative-stress-induced apoptosis in A549 type II pneumocytes. Cell Stress Chaperones. 14:417–425. 2009. View Article : Google Scholar : PubMed/NCBI |