Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Experimental and Therapeutic Medicine
Join Editorial Board Propose a Special Issue
Print ISSN: 1792-0981 Online ISSN: 1792-1015
Journal Cover
December-2016 Volume 12 Issue 6

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
December-2016 Volume 12 Issue 6

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article Open Access

Cardioprotective effects of traditional Chinese medicine Guanmaitong on acute myocardial infarction

  • Authors:
    • Xing‑Hua Wang
    • Guang‑Ping Li
    • Wan‑Song Yang
    • Zhan‑Quan Jiao
    • Hong‑Mei Liu
    • Yan‑Ping Ni
  • View Affiliations / Copyright

    Affiliations: Department of Cardiology, Tianjin Key Laboratory of Ionic‑Molecular Function of Cardiovascular Disease, Tianjin Institute of Cardiology, The Second Hospital of Tianjin Medical University, Tianjin 300211, P.R. China
    Copyright: © Wang et al. This is an open access article distributed under the terms of Creative Commons Attribution License.
  • Pages: 3927-3933
    |
    Published online on: November 8, 2016
       https://doi.org/10.3892/etm.2016.3888
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

Guanmaitong (GMT) is a traditional Chinese herbal compound that has been used for the treatment of coronary heart disease (CHD) and other cardiovascular diseases. However, the efficacy of GMT in treating cardiovascular diseases remains unclear. The aim of the present study was to investigate the protective mechanisms and identify the targeted proteins and signaling networks associated with the physiological activity of GMT in a rat model of acute myocardial infarction (AMI). Sprague‑Dawley rats were randomly allocated into five groups: Control group (sham‑operated), the model group, and small, medium, and large dosage GMT groups. The rat model of AMI was established via ligation of the coronary artery. The results indicate that GMT was able to reduce myocardial infarction size and improve the activities of tumor necrosis factor‑α (TNF‑α), intercellular adhesion molecule 1 (ICAM‑1) and interleukin‑1. Furthermore, the reduced apoptotic index of the GMT‑treated cardiocytes (P<0.05 vs. model group) was in accordance with the downregulated expression of Bax and the upregulated expression of Bcl‑2. In conclusion, GMT may exert a protective potential against myocardial infarction injury by inhibiting apoptosis and inflammation of cardiomyocytes, and may offer a promising adjunct treatment for CHD.

Introduction

Coronary heart disease (CHD), synonymously known as coronary artery disease (CAD) is the most predominant type of cardiovascular disease in developing countries (1). Acute myocardial infarction (AMI) is one of the most prevalent types of CHD (2), and may lead to an irreversible loss of cardiomyocytes and scar formation in the infarct area, which are major factors in the progression of heart failure (3,4). Therefore, investigation of novel treatments to improve the prognosis of AMI is an area of intense activity.

Prior studies have reported the effects of various herb-derived compounds on clinical symptoms, biomarkers and mortality in AMI patients and animal models (5–7). However, the mechanisms underlying these effects require further investigation and systematic review.

The use of a combination of multiple herbs is designed to exploit the additive or synergistic activities of individual herbs, as well as to balance or neutralize the toxic effects of certain herbal components by others in the mixture (8). Guanmaitong (GMT) consists primarily of the herbs Salvia miltiorrhiza, Safflower (Carthamus tinctorius) and Polygonum multiflorum, has been applied to the treatment of CHDs such as angina pectoris and myocardial ischemia in China (9). The three medicinal herbs are commonly used in traditional Chinese medicine and have previously been shown to be physiologically active in human vascular endothelial cells (10). Tetrahydroxystilbene-glucoside, one of the active ingredients of F. multiflorum, has been reported to exert a protective effect on the cardiovascular system by influencing cellular antioxidant capacity and inhibiting doxorubicin-induced apoptosis in cardiomyocytes (11,12). The pharmacological effects of S. miltiorrhiza extracts include antioxidative, anti-apoptotic and vasodilatory activities, which may be affected by the inhibition of intercellular adhesion molecule 1 (ICAM-1) expression to protect endothelial function and inhibit atherogenesis, and promoting the role of S. miltiorrhiza in cardiovascular and cerebrovascular systems (13–15). In previous studies, Safflower has been demonstrated to reduce cardiovascular disease risk in rats (16,17).

The aim of the present study was investigate the cardioprotective effects of GMT and to elucidate possible mechanisms underlying its effect on myocardial apoptosis and inflammatory response in rats with AMI.

Materials and methods

Animals

A total of 60 healthy adult male Sprague-Dawley (SD) rats, aged 6–8 weeks and weighing 220–250 g, were provided by the Experimental Animal Center of PLA Academy of Military Medical Sciences (Beijing, China) and acclimated for at least three days [license no. SCXK (Army) 2007–004]. All animals were housed in separated cages with laboratory chow and tap water ad libitum. All animal experiments were performed in accordance with the National Institute of Health Guide for the Care and Use of Laboratory Animals, and experiments were approved by the University Laboratory Animal Research Committee of Tianjin Medical University (Tianjin, China).

Experimental design and protocol

SD rats were randomly allocated into five equal groups (n=12/group): Sham-operated control group (S), model group (M), and small (0.55 g/kg/day; GL), medium (1.1 g/kg/day; GM), and large (2.2 g/kg/day; GH) dosage GMT groups. GMT was provided by Tianjin Tongrentang Group Co., Ltd. (Tianjin, China). Control and model groups received an equal quantity of vehicle. After 14 days of treatment, animals underwent AMI surgery.

Animal model establishment

An AMI model was established in rats by ligation of the left anterior descending coronary artery for 24 h. The surgical procedure was performed according to a previous study (18), with minor modifications. Briefly, SD rats were anesthetized with 10% chloral hydrate (0.3 ml/100 g, intraperitoneally; Sigma-Aldrich, St. Louis, MO, USA), then a left thoracotomy was performed. The incised area was extended using forceps and the pericardium was opened. Following tracheal intubation, the rats were ventilated using a respirator (ALC-V8; Alcott Biotech Co., Ltd., Shanghai, China) with room air at a tidal volume of 25 ml/min and a respiratory rate of 70 breaths/min. The heart was exteriorized and ligated at the proximal left anterior descending coronary artery 2–3 mm from its origin between the pulmonary artery conus and the left atrium using a 5-0 Prolene suture (WEGO Inc., Shandong, China). The heart was returned to its normal position and the thorax was closed. Sham-operated rats underwent an identical surgical procedure as described above except that the suture was not tightened around the coronary artery.

Measurement of myocardial infarct size and histological analysis

A 2,3,5-triphenyltetrazolium chloride (TTC) assay was used to determine myocardial infarct size. TTC was provided by Amresco (Amresco LLC, Solon, OH, USA). In brief, the heart was transversely cut across the left ventricle, and sections 2–3 mm thick were incubated in 0.5% TTC solution prepared in phosphate buffer (pH 7.4; Sangon Biotech Co., Ltd., Shanghai, China) for 30 min at 37°C, following which they were fixed with 10% formalin (Sangon Biotech Co., Ltd.). Non-ischemic and viable ischemic myocardium were stained red, while the infarcted myocardium appeared pale grey or white. For histological analysis, 5-µm sections from the left ventricle were stained with hematoxylin and eosin (HE; Beijing Zhongshan Golden Bridge Biotechnology Co., Ltd., Beijing, China). The pathological features were observed using a microscope (BX53; Olympus Corporation, Tokyo, Japan) at a magnification of ×400.

Measurement of cardiac marker enzyme activity

Abdominal aortic blood samples (4 ml) was separated by centrifugation at 840 × g for 10 min at 4°C. The activities of serum creatine kinase (CK; 812060103), creatine kinase-MB (CK-MB; 812060202), and lactate dehydrogenase (LDH; 812060403) were measured spectrophotometrically according to the specifications of commercial diagnostic kits (Shanghai Kehua Medical Instruments Co., Ltd., Shanghai, China).

Reverse transcription-quantitative polymerase chain reaction (RT-qPCR) analysis

Rats were sacrificed with 10% chloral hydrate (2 ml/100 g) and total RNA was extracted from the rat heart tissues using TRIzol (Invitrogen; Thermo Fisher Scientific, Inc., Waltham, MA, USA) according to the manufacturer's instructions. RNA yields and purity were assessed by spectrophotometric analysis (BioPhotometer Plus; Eppendorf, Shanghai, China) at 260 and 280 nm. Total RNA (1 µg) from each well was subjected to reverse transcription with oligo dT (19) primers, dNTPs (both Takara Bio, Inc., Otsu, Japan) and M-MLV reverse transcriptase (Promega Corporation, Madison, WI, USA) in a total reaction volume of 20 µl. Following DNase treatment (Sigma-Aldrich), the 20-µl RT-qPCR reaction system consisted of 10 µl SYBR Green Mix (Takara Bio, Inc.,), 0.5 µl of each primer (Table I) (Invitrogen), 1 µl cDNA and 8 µl double-distilled water. RT-qPCR was performed using an ABI 7300 Real-Time PCR System (Applied Biosystems; Thermo Fisher Scientific, Inc.) and data were analyzed using the accompanying ABI 7300 software. Thermal cycling conditions were as follows: Initial denaturation at 95°C for 5 min; 40 cycles at 95°C for 30 sec and 58°C for 30 sec; elongation at 72°C for 30 sec; a final cycle at 95°C for 15 sec and 60°C for 15 sec; followed by dissociation at 95°C for 15 sec. All values obtained with the tumor necrosis factor-α (TNF-α), interleukin (IL-1) or ICAM-1 primers were normalized against the values obtained with the GAPDH primers, according to the 2−∆∆Cq method (20). The results are expressed as the relative integrated intensity. Negative controls (no cDNA) and RT controls (no reverse transcriptase) were performed. All reactions were performed in triplicate.

Table I.

Polymerase chain reaction primer sequences.

Table I.

Polymerase chain reaction primer sequences.

GeneSequence (5′-3′)
IL-1F, AAGACAAGCCTGTGTTGCTGAAGG
R, TCCCAGAAGAAAATGAGGTCGGTC
TNF-αF, AAATGGGCTCCCTCTCATCAGTTC
R, TCTGCTTGGTGGTTTGGCTACGAC
ICAM-1F, GGGTTGGAGACTAACTGGA
R, GCACCGCAGGATGAGGTTCTT
GAPDHF, AACGACCCCTTCATTGACCT
R, CCCCATTTGATGTTAGCGGG

[i] F, forward; R, reverse; IL-1, interleukin-1; TNF-α, tumor necrosis factor-α; ICAM-1, intercellular adhesion molecule 1.

Enzyme-linked immunosorbent assay (ELISA) detection of IL-1

ELISA measurements of IL-1 expression were performed in duplicate using a specific, commercially available IL-1 ELISA kit (Cusabio Biotech Co., Ltd., Wuhan, China) in accordance with the manufacturer's instructions, and analyzed using an ELISA reader (Tecan Trading AG, Männedorf, Switzerland) at 450 nm.

Western blot analysis

Myocardial tissue (100 mg) was grinded in liquid nitrogen and incubated with radioimmunoprecipitation assay lysis buffer, containing 20 mM HEPES, 0.5% NP-40 (both Sigma-Aldrich), 1% protease inhibitor cocktail (Promega Corporation), 200 mM KCl, 20% glycerol and 0.5 mM EDTA (all Sangon Biotech Co., Ltd.), to extract total protein. Subsequently, 30 µg protein/lane was subjected to 10% SDS-PAGE and transferred onto nitrocellulose membranes (EMD Millipore, Billerica, MA, USA). Membranes were blocked with 5% bovine serum albumin and subsequently incubated with antibodies against B-cell lymphoma 2 (Bcl-2; 1:1,000; 2876), Bcl-2-associated X protein (Bax; 1:1,000; 2772), TNF-α (1:2,000; MAB510) ICAM-1 (1:1,000; ab124760) and GAPDH (1:2,000; AB-M-M001), as the internal control, at 4°C overnight. Following washing six times for 30 min with Tris-buffered saline with Tween 20 (TBST), the membranes were incubated with horseradish peroxidase (HRP)-conjugated goat anti-rabbit IgG (7074) or horse anti-mouse IgG (7076) secondary antibodies (both 1:3,000; Cell Signaling Technology, Inc., Danvers, MA, USA) for 1 h at room temperature to detect the primary antibody. Following further washing with TBST for 30 min, the intensity of immunoreactive bands was estimated using an imaging densitometer (Gene Tools 3.06; Gene Company Ltd., Hong Kong). Rabbit polyclonal anti-Bax and anti-Bcl-2 antibodies were purchased from Cell Signaling Technology, Inc., monoclonal anti-TNF-α antibody from R&D Systems (Minneapolis, MN, USA), rabbit polyclonal anti-ICAM-1 antibody from Abcam (Cambridge, MA, USA) and anti-GAPDH antibody (1:2,000; AB-M-M001) from Hangzhou Xianzhi Biotechnology (Hangzhou, China).

Immunohistochemical detection of Bcl-2 and Bax expression

Tissues were conventionally fixed with 10% formalin, then dehydrated with alcohol, embedded with paraffin wax and continuously sectioned at 5 µm. Sections were incubated overnight at 4°C with primary anti-Bcl-2 (BA0412) and anti-Bax (BA0315) antibodies (both 1:500; Wuhan Boster Biological Technology Ltd., Wuhan, China). Negative control were performed which involved the omission of primary antibody and use of phosphate-buffered saline (PBS). Sections were then rinsed with PBS and incubated for 1 h with HRP-conjugated secondary antibody (1:2,000; ZB2301; Beijing Zhongshan Golden Bridge Biotechnology Co., Ltd.). The reaction was visualized using a solution of 3,3′-diaminobenzidine (Beijing Zhongshan Golden Bridge Biotechnology Co., Ltd.). For quantification, the integral optical density of Bax and Bcl-2 staining were calculated using Image-Pro Plus 6.0 software (Media Cybernetics, Inc., Rockville, MD, USA).

Statistical analysis

Data are reported as the mean ± standard deviation. Statistical significance was determined using one-way analysis of variance tests followed by Dunnett's test. Statistical analyses were performed using the software package StatView 5.0J (SAS Institute, Cary, NC, USA). P<0.05 was considered to indicate a statistically significant difference.

Results

GMT reduces infarct area and pathological changes in cellular morphology

Representative illustrations of infarction tissue size (pale grey areas) as stained by TTC are shown in Fig. 1A. Sham-operated rats exhibited no evidence of infarcted tissue in the left ventricle. The model group presented with a large unstained area (30.02±4.32% vs. sham group; Table II). The infarction size significantly reduced in GMT groups compared with the model group, and the size was smallest in the high dosage group (15.71±3.32%) compared with the medium (17.83±2.37%) and small (23.16±4.01%) dosage groups. Regarding HE staining, the model group showed augmentation and loose arrangement of the myocardial fibers, staining asymmetry, deformity of the nucleus and marked edema and infiltration. By contrast, tissues from the SD rats treated with GMT exhibited markedly improved pathological changes compared with model group (Fig. 1B).

Figure 1.

Myocardial infarct size and hematoxylin and eosin (HE) staining. (A) Normal myocardium is stained red, while pale grey areas indicate infarct areas. (B) HE staining was conducted to detect the pathological alterations (magnification, ×400). S, sham group; M, model group; GL, low dosage group; GM, medium dosage group; GH, high dosage group.

Table II.

Effect of Guanmaitong on myocardial infarct tissue size.

Table II.

Effect of Guanmaitong on myocardial infarct tissue size.

GroupVentricle weight (g)Infarction weight (g)Infarction rate (%)
Model0.61±0.080.19±0.02 30.02±4.32a
Sham0.57±0.06––
Low dosage0.62±0.050.15±0.05 23.16±4.01b
Medium dosage0.65±0.090.11±0.03 17.83±2.37b
High dosage0.63±0.040.09±0.04 15.71±3.32b

{ label (or @symbol) needed for fn[@id='tfn2-etm-0-0-3888'] } Data presented as the mean ± standard deviation.

a P<0.05 vs. sham group

b P<0.05 vs. model group.

Effects of GMT on levels of cardiac marker enzyme activity

Fig. 2 shows that compared with the sham-operated group, the serum CK, CK-MB and LDH activities in the model group increased significantly (P<0.05). Treatment with GMT attenuated these elevations, and the various GMT dosages produced varying degrees of reduction (Fig. 2).

Figure 2.

Effect of Guanmaitong (GMT) on cardiac marker enzyme activity in rats. Treatment with GMT attenuated the elevation of cardiac marker enzyme activity, and different dose groups of GMT decline to different extent. #P<0.05 vs. sham group; *P<0.05 vs. model group, as determined by one-way analysis of variance followed by Dunnett's test. M, model group; S, sham group; GL, low dosage group; GM, medium dosage group; GH, high dosage group; CK, creatine kinase; LDH, lactate dehydrogenase.

Effect of GMT on cardiomyocyte apoptosis

Adult cardiomyocytes are post-mitotic cells, and thus have a limited response capability to damage (21). Prior studies have suggested that apoptosis is increased in acute and chronic heart pathologies, were the process appears to be crucially involved (21). To clarify the possible mechanism underlying anti-apoptotic effect exerted by GMT, two key factors of intrinsic pathway, Bcl-2 and Bax, in the infarct heart tissues. Using western blot and immunohistochemical assays (Fig. 3), a significant reduction in Bcl-2 expression and an increase in Bax expression was observed in the cardiocytes of the model group, as compared with the sham-operated group. Treatment with GMT resulted in enhanced Bcl-2 expression, reduced Bax expression and attenuated the ratio of Bcl-2/Bax (P<0.05) (Table III). Furthermore, the higher dosage groups (1.1 and 2.2 g/kg/day) exhibited more marked differences compared with the low dosage group (0.55 g/kg/day).

Figure 3.

Expression of Bcl-2 and Bax in GMT-treated Sprague-Dawley rats with acute myocardial infarction. (A and B) Western Blot was used to evaluate the protein expression of Bcl-2 and Bax. (C) Immunohistochemical analysis was used to detected the expression of Bcl-2 and Bax (magnification, ×400). #P<0.05 vs. sham group; *P<0.05 vs. model group, as determined by one-way analysis of variance followed by Dunnett's test. S, sham group; M, model group; GL, low dosage group; GM, medium dosage group; GH, high dosage group; Bcl-2, B-cell lymphoma 2; Bax, Bcl-2-associated X protein.

Table III.

Effect of Guanmaitong on cell apoptosis.

Table III.

Effect of Guanmaitong on cell apoptosis.

GroupApoptosis index (%)η (Bcl-2)%η (Bax)%
Model 31.8±1.9a   13.1±1.3a   52.7±2.0a
Sham   2.3±0.911.4±0.913.3±1.0
Low dosage 25.1±2.1b15.3±1.049.5±5.1
Medium dosage 23.2±1.6b   18.6±1.8a   45.1±2.7b
High dosage 18.5±5.1b   21.7±2.2a   34.4±3.3b

{ label (or @symbol) needed for fn[@id='tfn5-etm-0-0-3888'] } η% indicates the positive area/total area.

a P<0.05 vs. sham group

b P<0.05 vs. model group, as determined by one-way analysis of variance followed by Dunnett's test. Bcl-2, B-cell lymphoma 2; Bax, Bcl-2-associated X protein.

Expression of inflammation-related cytokine mRNAs in AMI via RT-qPCR assay

At 24 h after AMI induction the mRNA expression levels of IL-1, TNF-α and ICAM-1 in the model group significantly increased (P<0.05 vs. sham group; Fig. 4), and a reversed trend was observed in GMT groups. In particular, the mRNA expression levels of TNF-α and ICAM-1 were significantly reduced in all three GMT-treated groups (P<0.05 vs. model group), and were dosage-correlated. The expression levels of IL-1 mRNA were significantly reduced in the medium and high dosage groups (P<0.05 vs. model group), whereas no significant difference was detected in the low dosage group.

Figure 4.

Detection of inflammation-related cytokine expression using reverse transcription-quantitative polymerase chain reaction. #P<0.05 vs. sham group; *P<0.05 vs. model group, as determined by one-way analysis of variance followed by Dunnett's test. M, model group; S, sham group; GL, low dosage group; GM, medium dosage group; GH, high dosage group; IL-1, interleukin-1; TNF-α, tumor necrosis factor-α; ICAM-1, intercellular adhesion molecule 1.

Effect of GMT on protein expression levels of TNF-α, ICAM-1 and IL-1

The western blot analysis results indicated that ICAM-1 expression increased in the model group (vs. sham group) and decreased significantly in the medium and high dosage GMT groups (P<0.05 vs. model group; Fig. 5A). By contrast, a statistically significant elevation in TNF-α protein expression was detected in all three GMT groups (P<0.05 vs. model group; Fig. 5B). The results of the ELISA assay indicate that the protein expression levels of IL-1 increased significantly in the model group (P<0.05 vs. sham group), and that this elevation was significantly inhibited in all three GMT groups (P<0.05 vs. model group).

Figure 5.

Detection of inflammation-related cytokine proteins in Guanmaitong-treated Sprague-Dawley rats with acute myocardial infarction. (A and B) Western blot was used to analyze the protein expression levels of ICAM-1 and TNF-α. (C) IL-1 expression was analyzed using an ELISA assay. #P<0.05 vs. sham group; *P<0.05 vs. model group, as determined by one-way analysis of variance followed by Dunnett's test. M, model group; S, sham group; GL, low dosage group; GM, medium dosage group; GH, high dosage group; ICAM-1, intercellular adhesion molecule 1; TNF-α, tumor necrosis factor-α; IL-1, interleukin-1.

Discussion

Apoptosis, the physiological process of programmed cell death, may contribute to various cardiac disorders (22). Apoptosis has been reported to contribute to the loss of cardiomyocytes and is recognized as a predictor of adverse outcomes in patients with cardiac diseases or heart failure (23). Consequently, the interruption of apoptotic pathways may facilitate the development of novel strategies to reverse or attenuate heart failure (24,25). Certain active components of GMT have been reported to have anti-apoptotic effects, and are used as a classic prescription in traditional Chinese medicine for the treatment of cardiovascular diseases (12–15). Therefore, it was speculated for the purposes of the present study that GMT could salvage these cardiocytes and prevent ischemic cell loss induced by apoptosis. In the present study, GMT treatment upregulated the expression of the anti-apoptotic protein, Bcl-2, and downregulated the expression of the proapoptotic protein, Bax. Upregulation of Bcl-2 enhanced the formation of heterodimers with Bax, resulting in fewer available Bax proteins for the formation of homodimers. It is well known that if Bax homodimers predominate cell death will occur (26,27).

AMI is currently speculated to involve the process of inflammation, which is a hallmark throughout the distinct stages of atherosclerosis and plaque rupture (28). TNF-α is a key inflammatory cytokine which exerts pleiotropic biological effects and is crucially involved in cardiovascular diseases such as AMI (29). The inflammatory reaction caused by TNF-α is able to induce upregulation of IL-1 and ICAM-1; however, the increased expression of TNF-α may also regulate apoptosis by inhibiting the expression levels of the anti-apoptosis factor Bcl-2 (30). Another inflammatory cytokine, IL-1, has been proposed as a crucial mediator in the inflammatory response and AMI. In patients with ST-segment elevation AMI, IL-1 blockade with the IL-1 receptor antagonist anakinra is safe and ameliorates left ventricular remodeling, and can significantly increase and induce the expression of ICAM-1 in ischemic heart disease (31,32). ICAM-1 belongs to the super-family of immunoglobulin-like adhesion molecules and is critical for various physiological and pathological processes (33). It has previously been shown that ICAM-1 is able to induce and aggravate AMI, and its expression levels are closely associated with the extent of myocardial damage (34).

In the present study, the expression of a number of inflammatory cytokines increased rapidly in model group, while GMT treatment effectively reversed this change by influencing the expression of these factors and apoptosis regulators. Therefore, the present data support the cardioprotective capacity of GMT and suggest possible mechanisms underlying the observed anti-inflammatory and anti-apoptosis effects. Further mechanistic studies aimed at identifying the detailed signaling pathways upstream of TNF-α and Bcl-2 are required, in order to elucidate the molecular mechanisms underlying GMT and provide a theoretical basis for its clinical application.

Acknowledgements

This study was supported by grants from the Second Hospital of Tianjin Medical University (grant no. y1106) and Tianjin Tongrentang Group Co., Ltd. (Tianjin, China).

References

1 

Pranavchand R and Reddy B: Current status of understanding of the genetic etiology of coronary heart disease. J Postgrad Med. 59:30–41. 2013. View Article : Google Scholar : PubMed/NCBI

2 

Li C, Pei F, Zhu X, Duan DD and Zeng C: Circulating microRNAs as novel and sensitive biomarkers of acute myocardial infarction. Clin Biochem. 45:727–732. 2012. View Article : Google Scholar : PubMed/NCBI

3 

Frangogiannis NG: The immune system and the remodeling infarcted heart: Cell biological insights and therapeutic opportunities. J Cardiovasc Pharmacol. 63:185–195. 2014. View Article : Google Scholar : PubMed/NCBI

4 

Dauwe DF and Janssens SP: Stem cell therapy for the treatment of myocardial infarction. Curr Pharm Des. 17:3328–3340. 2011. View Article : Google Scholar : PubMed/NCBI

5 

Liang X, Chen X, Liang Q, Zhang H, Hu P, Wang Y and Luo G: Metabonomic study of Chinese medicine Shuanglong formula as an effective treatment for myocardial infarction in rats. J Proteome Res. 10:790–799. 2010. View Article : Google Scholar : PubMed/NCBI

6 

Wang Y, Qian P, Liu P, Wei L, Cao M, Zhou L, Zhou D and Lin ZX: Effects of Panax notoginseng flower extract on the TGF-β/Smad signal transduction pathway in heart remodeling of human chymase transgenic mice. Mol Med Rep. 5:1443–1448. 2012.PubMed/NCBI

7 

Chen KJ and Xu H: The integration of traditional Chinese medicine and Western medicine. European Review. 11:225–235. 2003.

8 

Zhu YP and Woerdenbag HJ: Traditional Chinese herbal medicine. Pharmacy World and Science. 17:103–112. 1995. View Article : Google Scholar : PubMed/NCBI

9 

Pan SY, Chen SB, Dong HG, Yu ZL, Dong JC, Long ZX, Fong WF, Han YF and Ko KM: New perspectives on Chinese herbal medicine (Zhong-Yao) research and development. Evid Based Complement Alternat Med. 2011:4037092011. View Article : Google Scholar : PubMed/NCBI

10 

Ling S, Nheu L, Dai A, Guo Z and Komesaroff P: Effects of four medicinal herbs on human vascular endothelial cells in culture. Int J Cardiol. 128:350–358. 2008. View Article : Google Scholar : PubMed/NCBI

11 

Hong CY, Lo YC, Tan FC, Wei YH and Chen CF: Astrafalus membranaceus and Polygonum multiflourm protect rat heart mitochondria against lipid peroxidation. Am J Chin Med. 22:63–70. 1994. View Article : Google Scholar : PubMed/NCBI

12 

Zhang SH, Wang WQ and Wang JL: Protective effect of tetrahydroxystilbene glucoside on cardiotoxicity induced by doxorubicin in vitro and in vivo. Acta Pharmacol Sin. 30:1479–1487. 2009. View Article : Google Scholar : PubMed/NCBI

13 

Zheng CS, Xu XJ, Ye HZ, Wu GW, Xu HF, Li XH, Huang SP and Liu XX: Computational pharmacological comparison of Salvia miltiorrhiza and Panax notoginseng used in the therapy of cardiovascular diseases. Exp Ther Med. 6:1163–1168. 2013.PubMed/NCBI

14 

Fong CC, Wei F, Chen Y, Yu WK, Koon CM, Leung PC, Fung KP, Lau CB and Yang M: Danshen-Gegen decoction exerts proliferative effect on rat cardiac myoblasts H9c2 via MAPK and insulin pathways. J Ethnopharmacol. 138:60–66. 2011. View Article : Google Scholar : PubMed/NCBI

15 

Wing-Shing Cheung D, Koon CM, Ng CF, Leung PC, Fung KP, Kar-Sing Poon S and Bik-San Lau C: The roots of Salvia miltiorrhiza (Danshen) and Pueraria lobata (Gegen) inhibit atherogenic events: A study of the combination effects of the 2-herb formula. J Ethnopharmacol. 143:859–866. 2012. View Article : Google Scholar : PubMed/NCBI

16 

Wan LH, Chen J, Li L, Xiong WB and Zhou LM: Protective effects of Carthamus tinctorius injection on isoprenaline-induced myocardial injury in rats. Pharm Biol. 49:1204–1209. 2011. View Article : Google Scholar : PubMed/NCBI

17 

Han SY, Li HX, Ma X, Zhang K, Ma ZZ, Jiang Y and Tu PF: Evaluation of the anti-myocardial ischemia effect of individual and combined extracts of Panax notoginseng and Carthamus tinctorius in rats. Ethnopharmacol. 145:722–727. 2013. View Article : Google Scholar

18 

Maclean D, Fishbein MC, Braunwald E and Maroko PR: Long-term preservation of ischemic myocardium after experimentalcoronary artery occlusion. J Clin Invest. 61:541–551. 1978. View Article : Google Scholar : PubMed/NCBI

19 

Whelan RS, Kaplinskiy V and Kitsis RN: Cell death in the pathogenesis of heart disease: mechanisms and significance. Annu Rev Physio. 72:19–44. 2010. View Article : Google Scholar

20 

Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCt method. Methods. 25:402–408. 2001. View Article : Google Scholar : PubMed/NCBI

21 

Favaloro B, Allocati N, Graziano V, Di Ilio C and De Laurenzi V: Role of apoptosis in disease. Aging (Albany NY). 4:330–349. 2012. View Article : Google Scholar : PubMed/NCBI

22 

Lee SD, Chu CH, Huang EJ, Lu MC, Liu JY, Liu CJ, Hsu HH, Lin JA, Kuo WW and Huang CY: Roles of insulin-like growth factor II in cardiomyoblast apoptosis and in hypertensive rat heart with abdominal aorta ligation. Am J Physiol Endocrinol Metab. 291:E306–E314. 2006. View Article : Google Scholar : PubMed/NCBI

23 

Liou CM, Tsai SC, Kuo CH, Ting H and Lee SD: Cardiac Fas-dependent and mitochondria-dependent apoptosis after chronic cocaine abuse. Int J Mol Sci. 15:5988–6001. 2014. View Article : Google Scholar : PubMed/NCBI

24 

Sinha-Hikim I, Shen R, Nzenwa I, Gelfand R, Mahata SK and Sinha-Hikim AP: Minocycline suppresses oxidative stress and attenuates fetal cardiac myocyte apoptosis triggered by in utero cocaine exposure. Apoptosis. 16:563–573. 2011. View Article : Google Scholar : PubMed/NCBI

25 

Gill C, Mestril R and Samali A: Losing heart: The role of apoptosis in heart disease-a novel therapeutic target? FASEB J. 16:135–146. 2002. View Article : Google Scholar : PubMed/NCBI

26 

Bansal N, Marchion DC, Bicaku E, Xiong Y, Chen N, Stickles XB, Sawah EA, Wenham RM, Apte SM, Gonzalez-Bosquet J, et al: BCL2 antagonist of cell death kinases, phosphatases and ovarian cancer sensitivity to cisplatin. J Gynecol Oncol. 23:35–42. 2012. View Article : Google Scholar : PubMed/NCBI

27 

Xu Z, Dong Y, Wu X, Zhang J, McAuliffe S, Pan C, Zhang Y, Ichinose F, Yue Y and Xie Z: The potential dual effects of anesthetic isoflurane on Aβ-induced apoptosis. Curr Alzheimer Res. 8:741–752. 2011. View Article : Google Scholar : PubMed/NCBI

28 

Lin XM, Zhang ZY, Wang LF and Zhang L, Liu Y, Liu XL, Yang XC, Cui L and Zhang L: Attenuation of tumor necrosis factor-alpha elevation and improved heart function by postconditioning for 60 seconds in patients with acute myocardial infarction. Chin Med J (Engl). 123:1833–1839. 2010.PubMed/NCBI

29 

Tuttolomondo A, Di Raimondo D, Pecoraro R, Arnao V, Pinto A and Licata G: Inflammation in ischemic stroke subtypes. Curr Pharm Des. 18:4289–4310. 2012. View Article : Google Scholar : PubMed/NCBI

30 

Chen M, Quintans J, Fuks Z, Thompson C, Kufe DW and Weichselbaum RR: Suppression of Bcl-2 messenger RNA production may mediate apoptosis after ionizing radiation, tumor necrosis factor and ceramide. Cancer Res. 55:991–994. 1995.PubMed/NCBI

31 

Arnson Y: Circulating levels of adhesion molecules ICAM-1, VCAM-1, E-Selectin, VEGF and their associations with age and troponin in patients with acute coronary syndrome. J Am Coll Cardiol. 63:A1772014. View Article : Google Scholar

32 

Abbate A, Kontos MC, Grizzard JD, Biondi-Zoccai GG, Van Tassell BW, Robati R, Roach LM, Arena RA, Roberts CS, Varma A, et al: VCU-ART Investigators: Interleukin-1 blockade with anakinra to prevent adverse cardiac remodeling after acute myocardial infarction(Virginia Commonwealth University Anakinra Remodeling Trial [VCU-ART] Pilot study). Am J Cardiol. 105:1371–1377. 2010. View Article : Google Scholar : PubMed/NCBI

33 

Projahn D and Koenen RR: Platelets: key players in vascular inflammation. J Leukoc Biol. 92:1167–1175. 2012. View Article : Google Scholar : PubMed/NCBI

34 

van den Akker F, Deddens JC, Doevendans PA and Sluijter JP: Cardiac stem cell therapy to modulate inflammation upon myocardial infarction. Biochim Biophys Acta. 1830:2449–2458. 2013. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Wang XH, Li GP, Yang WS, Jiao ZQ, Liu HM and Ni YP: Cardioprotective effects of traditional Chinese medicine Guanmaitong on acute myocardial infarction. Exp Ther Med 12: 3927-3933, 2016.
APA
Wang, X., Li, G., Yang, W., Jiao, Z., Liu, H., & Ni, Y. (2016). Cardioprotective effects of traditional Chinese medicine Guanmaitong on acute myocardial infarction. Experimental and Therapeutic Medicine, 12, 3927-3933. https://doi.org/10.3892/etm.2016.3888
MLA
Wang, X., Li, G., Yang, W., Jiao, Z., Liu, H., Ni, Y."Cardioprotective effects of traditional Chinese medicine Guanmaitong on acute myocardial infarction". Experimental and Therapeutic Medicine 12.6 (2016): 3927-3933.
Chicago
Wang, X., Li, G., Yang, W., Jiao, Z., Liu, H., Ni, Y."Cardioprotective effects of traditional Chinese medicine Guanmaitong on acute myocardial infarction". Experimental and Therapeutic Medicine 12, no. 6 (2016): 3927-3933. https://doi.org/10.3892/etm.2016.3888
Copy and paste a formatted citation
x
Spandidos Publications style
Wang XH, Li GP, Yang WS, Jiao ZQ, Liu HM and Ni YP: Cardioprotective effects of traditional Chinese medicine Guanmaitong on acute myocardial infarction. Exp Ther Med 12: 3927-3933, 2016.
APA
Wang, X., Li, G., Yang, W., Jiao, Z., Liu, H., & Ni, Y. (2016). Cardioprotective effects of traditional Chinese medicine Guanmaitong on acute myocardial infarction. Experimental and Therapeutic Medicine, 12, 3927-3933. https://doi.org/10.3892/etm.2016.3888
MLA
Wang, X., Li, G., Yang, W., Jiao, Z., Liu, H., Ni, Y."Cardioprotective effects of traditional Chinese medicine Guanmaitong on acute myocardial infarction". Experimental and Therapeutic Medicine 12.6 (2016): 3927-3933.
Chicago
Wang, X., Li, G., Yang, W., Jiao, Z., Liu, H., Ni, Y."Cardioprotective effects of traditional Chinese medicine Guanmaitong on acute myocardial infarction". Experimental and Therapeutic Medicine 12, no. 6 (2016): 3927-3933. https://doi.org/10.3892/etm.2016.3888
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team