Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
International Journal of Molecular Medicine
Join Editorial Board Propose a Special Issue
Print ISSN: 1107-3756 Online ISSN: 1791-244X
Journal Cover
May-2015 Volume 35 Issue 5

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
May-2015 Volume 35 Issue 5

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article Open Access

Vitamin D/VDR signaling pathway ameliorates 2,4,6-trinitrobenzene sulfonic acid-induced colitis by inhibiting intestinal epithelial apoptosis

  • Authors:
    • Tong Zhu
    • Tian-Jing Liu
    • Yong-Yan Shi
    • Qun Zhao
  • View Affiliations / Copyright

    Affiliations: Department of Pediatric Orthopedics, Shengjing Hospital of China Medical University, Shenyang, Liaoning 110004, P.R. China, Department of Pediatrics, Shengjing Hospital of China Medical University, Shenyang, Liaoning 110004, P.R. China
    Copyright: © Zhu et al. This is an open access article distributed under the terms of Creative Commons Attribution License [CC BY_NC 3.0].
  • Pages: 1213-1218
    |
    Published online on: March 20, 2015
       https://doi.org/10.3892/ijmm.2015.2150
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

Increasing epidemiological data have suggested a link between vitamin D deficiency and the incidence of inflammatory bowel disease (IBD). In the present study, we confirmed that vitamin D deficiency, as well as the decreased local expression of vitamin D receptor (VDR), was prevalent in an IBD cohort. The excessive apoptosis of intestinal epithelial cells (IECs) partly accounts for the development of colonic inflammation and eventually results in IBD. Based on the established inhibitory effects of the vitamin D/VDR pathway on IEC apoptosis, we treated mice with 2,4,6-trinitrobenzene sulfonic acid (TNBS)-induced colitis with paricalcitol, a vitamin D analog, in order to investigate the mechanisms responsible for the inhibitory effects of the vitamin D/VDR pathway. We observed that following treatment with vitamin D, the mice presented with only minor bodyweight loss, and the mice also showed improved histological scores and decreased intestinal epithelial permeability compared with the vehicle-treated group. The colonic mRNA expression of inflammatory cytokines and chemokines was markedly suppressed, indicating less severe colitis in the vitamin D-treated mice. Subsequently, we investigated p53 upregulated modulator of apoptosis (PUMA) and p53, two major independent pathways of apoptosis, as well as caspase-3. We found that the vitamin D-treated mice had lower expression levels of caspase-3 than the vehicle-treated mice. PUMA expression showed the same tendency; however, the p53 protein level was not altered. The present study indicates that vitamin D attenuates the development of TNBS-induced colitis by inhibiting the apoptosis of IECs. The mechanisms involved include the downregulation of PUMA expression. Our data provide experimental support for the clinical trials of vitamin D intervention in patients with IBD.

Introduction

Crohn’s disease (CD) and ulcerative colitis (UC) are the two major forms of chronic inflammatory bowel disease (IBD). Increasing epidemiological data have suggested a link between vitamin D deficiency and the incidence of IBD, and vitamin D deficiency has been shown to be prevalent in patients with IBD (1–3). As the vitamin D receptor (VDR) is highly expressed in intestinal epithelial cells (IECs), the vitamin D/VDR signaling pathway may play a key role in the pathogenesis of IBD. Moreover, it has been reported that VDR gene polymorphisms are associated with the incidence of IBD (4,5) and VDR knockout mice have been shown to have a compromised mucosal barrier, leading to increased susceptibility to mucosal damage and an increased risk of developing IBD (6). These data suggest that vitamin D and/or VDR serve as an environmental and/or genetic factor in the pathogenesis of IBD.

The intestinal epithelial barrier plays an important role in the development of colitis, which consists of a monolayer of epithelial cells and intercellular junctions between adjacent cells that seal the paracellular gap (7). The barrier regulates intestinal permeability between the lumen and mucosal layer, protecting mucosal immune cells from coming into contact with gut microbiome, harmful solutes, toxins and luminal antigens (8–11). The compromise or disruption of the intestinal barrier function results in intestinal inflammation. The integrity of the intestinal epithelial barrier is preserved by thousands of IECs. The aberrant apoptosis of IECs has been proven to be a major pathophysiological mechanism of increased gut permeability and inflammation (12–15). Previous studies have reported increased IEC apoptosis in patients with UC and CD, as well as in murine models of colitis (12–15). The excessive apoptosis of IECs causes the disruption of the epithelial barrier, leading to increased intestinal permeability and the subsequent invasion of pro-inflammatory substances (13–15). Those substances can induce the production of inflammatory cytokines and chemokines in the colonic lamina propria. This vicious series of intestinal events promotes the development of colonic inflammation and eventually results in IBD.

1,25-Dihydroxyvitamin D3 (calcitriol) is the active form of vitamin D and binds with VDR. Apart from its classical calcium-regulating effect, vitamin D serves as a potent regulator of multiple biological activities, including antimicrobial activities, the inhibition of apoptosis and immunomodulatory functions (16). Recently, it was suggested that VDR transgenic mice exhibit less colitis than wild-type mice, indicating the protective role of VDR in the development of intestinal inflammation (13). Thus, we hypothesized that treatment with vitamin D may attenuate the severity of 2,4,6-trinitrobenzene sulfonic acid (TNBS)-induced colitis by inhibiting IEC apoptosis.

Materials and methods

Human biopsies

Human biopsies were collected through endoscopic examination from patients with UC and CD at the Shengjing Hospital of China Medical University between January 2012 and December 2012. Non-IBD control subjects were selected from subjects who underwent endoscopic examination for the elimination of other bowel diseases and were proven to be free of gut-related diseases. Written informed consent was obtained from each subject prior to enrollment in the study.

Induction of acute colitis

Male adult C57BL6/J mice, weighing 20–25 g, were supplied by the Center of Experimental Animals of China Medical University, Shenyang, China. All animal procedures were reviewed and approved by the Laboratory Animal Ethics Committee of China Medical University. The mice were anaesthetized by an intraperitoneal (i.p.) injection of cocktail anesthetics [ketamine (ketavest 100 mg/ml); Pfizer, New York, NY, USA) and [xylazine (Rompun 2%); Bayer HealthCare, Leverkusen, Germany). The mice were treated with 100 mg/kg TNBS (Sigma-Aldrich, St. Louis, MO, USA) dissolved in 50% ethanol by intrarectal injection with an 18-gauge stainless steel gavage needle. The control group was treated with 50% ethanol without TNBS, as previoulsy described (17).

Treatment with vitamin D or the vehicle

The TNBS and control groups were randomly divided into 2 groups, respectively. One group was treated with the vitamin D analog, paricalcitol (Sigma-Aldrich), dissolved in propylene glycol:ethanol, 90:10 at 0.5 μg/kg body weight, while the other group was administered the dissolvent only. Paricalcitol or the vehicle were administered through i.p. injection 30 min before, 1, 3 and 5 days after the TNBS injection.

Reverse transcription-quantitative PCR (RT-qPCR)

The mice were sacrificed 48 h after the TNBS injection. A 2-cm section of the colon was cut from each mouse and the colonic mucosa was harvested. Total RNA was isolated using TRIzol reagent (Invitrogen, Carlsbad, CA, USA). First-strand cDNA was synthesized from 3 μg of total RNA in a 20 μl reaction system using M-MLV reverse transcriptase (Invitrogen) and random primers. Quantitative (real-time) PCR (qPCR) was performed on a Roche 480 Real-Time PCR system using SYBR-Green PCR reagent kits (Clontech Laboratories Inc., Mountain View, CA, USA). The relative amounts of mRNA were calculated using the 2−ΔΔCt formula. β-2 microglobulin (B2M) was used as an internal control. The sequences of the primers used for PCR are provided in Table I.

Table I

Primers used in this study for PCR.

Table I

Primers used in this study for PCR.

Primer nameForward (5′→3′)Reverse (3′→5′)
Human VDR ACCTGGTCAGTTACAGCATC ACTGACGCGGTACTTGTAGT
Human B2M TGGGTTTCATCCATCCGACA ACGGCAGGCATACTCATCTT
Mouse IL-1β AATGAAAGACGGCACACCCA TGCTTGTGAGGTGCTGATGT
Mouse IL-6 CCTCTGGTCTTCTGGAGTACC ACTCCTTCTGTGACTCCAGC
Mouse TNF-α ATGAGCACAGAAAGCATGA AGTAGACAGAAGAGCGTGGT
Mouse IFN-γ TTCTTCAGCAACAGCAAGGC TCAGCAGCGACTCCTTTTCC
Mouse MCP-1 GCTCAGCCAGATGCAGTTAA TCTTGAGCTTGGTGACAAAAACT
Mouse IL-17 TCTCCACCGCAATGAAGACC CACACCCACCAGCATCTTCT
Mouse IL-23 p19 GCTGTGCCTAGGAGTAGCAG TGGCTGTTGTCCTTGAGTCC
Mouse B2M CGGCCTGTATGCTATCCAGA GGGTGAATTCAGTGTGAGCC

[i] VDR, vitamin D receptor; B2M, β2 microglobulin; IL, interleukin; TNF, tumor necrosis factor; MCP-1, monocyte chemoattractant protein-1.

Western blot analysis

The colonic mucosa lysates were separated by SDS-PAGE, and the proteins were transferred electrophoretically onto polyvinylidene difluoride membranes (Millipore, Billerica, MA, USA). We used ImageJ software (National Institutes of Health, Bethesda, MD, USA) to quantify the density of the bands normalized to that of β-actin. The antibodies used in the present study included: anti-VDR (C20; 1:2,000; Santa Cruz Biotechnology Inc., Santa Cruz, CA, USA), anti-β-actin (A5316; 1:10,000; Sigma-Aldrich), anti-p53 (9282; 1:3,000; Cell Signaling Technology, Beverly, MA, USA), anti-p53 upregulated modulator of apoptosis (PUMA; 7467; 1:3,000; Cell Signaling Technology) and anti-caspase 3 (9662; 1:1,000; Cell Signaling Technology) antibodies.

Hematoxylin and eosin staining

The whole colons were harvested on day 4 after the TNBS injection. The colon morphology was recorded and scored according to a macroscopic scoring system (18). The distal colon were fixed overnight with 4% formaldehyde in PBS (pH 7.4), dehydrated with graded alcohol, placed in xylene for 1 h and then embedded in paraffin at 60°C. Sections of the colon (4 μm) were stained with hematoxylin and eosin. Colon sections from all the groups were examined for any histological changes. From each section, 20 random spots were examined under a microscope (Leica DFC425; Leica Microsystems, Heerbrugg, Switzerland) at a magnification of x100. Microscopic scoring was performed for each spot according to a scoring system (18) independently by two pathologists who were blinded to the group design.

Measurement of serum 25-hydroxyvitamin D

The human serum 25-hydroxyvitamin D concentration (nmol/l) was measured using a commercial 25-hydroxyvitamin D EIA kit (Immunodiagnostic Systems PLC, Boldon, Tyne & Wear, UK) according to the manufacturer’s instructions.

FITC-dextran intestinal permeability

The mice were denied access to food, but were allowed to drink water for 4 h before gavage. FITC-4 kDa dextran (50 mg/ml) (Sigma-Aldrich) was administered by gavage at a dose of 4 μl/g body weight through an 18-guage stainless steel gavage needle. Blood serum was collected 3 h later. The blood serum was then placed at 150 μl/well into a 96-well plate and analyzed using a Synergy HT microplate reader (BioTek Instruments, Inc., Winooski, VT, USA).

Results

Low 25-hydroxyvitamin D levels and reduced VDR expression in patients with UC and CD compared to the normal controls

The average serum 25-hydroxyvitamin D levels in the patients with UC and CD were significantly lower than those of the normal controls (Fig. 1A). The 25-hydroxyvitamin D levels of the majority of patients with IBD were in the vitamin D deficiency range (<50 nmol/l; Fig. 1A). In addition, the mRNA expression of VDR was markedly decreased in the patients with UC and CD compared to the normal subjects (n>6; Fig. 1B). Western blot analyses with anti-VDR antibody revealed the decreased expression of the colonic VDR protein level in the patients with UC and CD (Fig. 1C and D). These data from human subjects indicate that a low vitamin D and VDR protein expression may be a pathological factor for the development of colitis.

Figure 1

Low vitamin Ds level and reduced VDR expression in patients with UC and CD compared to the normal controls. (A) Serum 25(OH)D concentrations in normal controls and patients with IBD. (B) Relative expression of VDR in normal controls and patients with IBD analyzed by RT-qPCR. (C) Representative western blots of colonic biopsies from normal controls and patients with IBD. (D) Densitometric quantification of VDR expression compared to β-actin. Values are presented as the means ± SD. UC, ulcerative colitis; CD, Crohn’s disease (n>10 in each group). VDR, vitamin D receptor; IBD, inflammatory bowel disease; 25(OH)D, 25-hydroxyvitamin D.

Administration of vitamin D ameliorates TNBS-induced colitis

We used a mouse model of TNBS-induced colitis to mimic the pathological process of IBD. Paricalcitol, a vitamin D analog, was administrated to investigate the protective role of the vitamin D/VDR signaling pathway. Paricalcitol has been proven to exert the same curative effect as calcitriol, but it produces less side-effects, including less hypercalcemia (19,20). After the TNBS injection, the body weight of the mice in both the vitamin D-treated group (VD) and the vehicle-treated group (VE) decreased over time, but the mice in the VD group only developed mild colitis with minor weight loss (Fig. 2A). In the gross observation, the colons of the mice in the VD group were much closer to normal than those of the mice in the VE group (Fig. 2B). Microscopic examination revealed severe hemorrhage, inflammatory cell infiltration and the breakdown of the normal intestinal tissue barrier in the mice in the VE group, while the mice in the VD group presented minimal histological damage (Fig. 2D). The mice in the VE group also had a higher macroscopic score (Fig. 2C) and histological score (Fig. 2E) than the mice in the VD group. These results provide evidence that TNBS-induced colitis may be substantially suppressed by the administration of vitamin D.

Figure 2

The vitamin D analog, paricalcitol, ameliorates TNBS-induced colitis. (A) Body weight changes over time in the vehicle-treated group and vitamin D-treated group after the TNBS injection. **P<0.01, ***P<0.001 vs. vehicle treatment (n=8 in each group). (B) Colon morphology. (C) Macroscopic scoring of colon morphology. (D) H&E staining of distal colon. (E) Microscopic scoring of H&E-stained slides (original magnification, x100) from the vehicle- and paricalcitol-treated groups on day 4 after the TNBS injection or from the control group (50% ethanol injection). TNBS, 2,4,6-trinitrobenzene sulfonic acid.

Administration of vitamin D downregulates the expression of pro-inflammatory cytokines and chemokines

We further examined the expression of pro-inflammatory cytokines and chemokines in the colonic mucosa. The mRNA expression of cytokines and chemokines was markedly increased by the TNBS injection, while paricalcitol markedly reversed this increase in the expression of the majority of cytokines. This tendency was most obvious with the expression of tumor necrosis factor (TNF)-α and interleukin (IL)-17, two important cytokines associated with the Th1 and Th17 response, respectively. However, monocyte chemotactic protein-1 (MCP-1) was the only chemokine which showed no statistically significant differences in its expression between the VD and VE group (Fig. 3). These result prove that the administration of vitamin D has a direct inhibitory effect on the inflammatory status during the development of colitis.

Figure 3

RT-qPCR quantification of pro-inflammatory cytokines and chemokines in the colon mucosa from the vehicle- and paricalcitol-treated mice on day 2 after the TNBS injection or in the control group (50% ethanol injection). #P>0.05, *P<0.05, **P<0.01, ***P<0.001 (n=6-8 in each group). TNBS, 2,4,6-trinitrobenzene sulfonic acid.

Administration of vitamin D protects against barrier disruption and inhibits the increase in intestinal pe rmeability

We evaluated intestinal permeability following the administration of vitamin D in our mouse model of TNBS-induced colitis. After the TNBS injection, the permeability of the intestinal barrier increased in both the VD and VE group, while the serum concentration of FITC-4-kDa dextran in the mice in the VD group was exclusively lower than that of the mice in the VE group. In other words, the administration of vitamin D protects the integrity of the intestinal barrier and, thus, inhibits the increase in intestinal permeability (Fig. 4).

Figure 4

Paricalcitol decreases colon mucosa permeability after the TNBS injection. #P>0.05, *P<0.05 (n=4–5 in each group). TNBS, 2,4,6-trinitrobenzene sulfonic acid; conc, concentration.

Administration of vitamin D inhibits intestinal epithelial apoptosis by suppressing the induction of the PUMA apoptotic pathway

In order to further disclose the mechanisms responsible for the protective effects of vitamin D, we analyzed the expression of p53 and PUMA, two upstream pro-apoptotic proteins of caspase-3. They independently mediate the apoptosis of IECs in patients and mice with colitis (15). Using western blot analysis, we found that the cleavage of caspase-3 was markedly attenuated by treatment with paricalcitol (Fig. 5A). PUMA expression was also decreased in the mice in the VD group; however, no differences were observed in the p53 protein level (Fig. 5). These findings suggest that enhanced vitamin D/VDR signaling inhibits IEC apoptosis by downregulating PUMA expression.

Figure 5

Vitamin D supplementation attenuates colon epithelial cell apoptosis. (A) Western blot analysis and (B) densitometric quantification of the colonic mucosal apoptotic proteins, p53, p53-upregulated modulator of apoptosis (PUMA) and caspase-3, in the vehicle- and paricalcitol-treated mice after the TNBS injection on day 2. #P>0.05, *P<0.05 (n=6 in each group). TNBS, 2,4,6-trinitrobenzene sulfonic acid.

Discussion

Epidemiological evidence suggests a link between vitamin D deficiency and an increased risk of developing IBD (1–3). The incidence of IBD is parallel to exposure to sunshine, with the highest incidence around the north pole and the lowest along the equator (21,22). Other studies have suggested a link between VDR gene polymorphisms and the risk of developing IBD (4,5). TaqI, BsmI, FokI and ApaI are the four VDR polymorphisms associated with the higher incidence of IBD, despite variability among different races and populations (4,5,23). Based on the population of northeast China in the present study, we obtained a similar finding, namely that patients with IBD had a worse vitamin D status and lower VDR expression than the normal controls. These data confirm the role of the vitamin D/VDR pathway in the development of gut inflammation, and provide valuable insight into the genetic therapy of IBD.

VDR is highly expressed in the intestine. The classical function of VDR in the small intestine is to regulate the transportation and absorption of calcium and maintain calcium homeostasis. However, the function of VDR in the colon remains to be illustrated. Kong et al (6) first reported that vitamin D deficiency compromises the mucosal barrier, leading to increased susceptibility to mucosal damage and an increased risk of developing IBD. Recently, another study suggested that epithelial VDR signaling plays an important role in the homeostasis of luminal microorganisms, antigens and the body (13). VDR is also expressed in immune cells (24). The endogenous serum metabolite of vitamin D, calcitriol, is considered a true steroid hormone, and similar to other glucocorticoids and gonadal hormones, may exert several immunomodulatory effects (24–26). Accumulating evidence indicates an important role of vitamin D in reducing the risk of developing several chronic inflammatory or autoimmune conditions, such as multiple sclerosis, type 1 diabetes and rheumatoid arthritis (24–26). Moreover, vitamin D/VDR pathway dysfunction has been shown to promote the development of inflammation in IL-10 knockout mice, a model of IBD (27). These laboratory data provide a therapeutic foundation for enhancing vitamin D/VDR signaling to inhibit intestinal inflammation.

Clinical studies have revealed that vitamin D supplementation can deter the pathological process of IBD and relieve the symptoms (reviewed in 28); however, the mechanisms responsible for this effect have not yet been fully elucidated. In this study, we found that the vitamin D analog, paricalcitol, substantially alleviated the severity of colitis induced by TNBS, a model of Th1-mediated colitis. The effects of paricalcitol were, at least in part, mediated through the inhibition of the apoptosis of IECs.

PUMA is a key mediator of IEC apoptosis in IBD (15). PUMA is a pro-apoptotic Bcl-2 family member that interacts with anti-apoptotic Bcl-2 family members to activate Bax and/or Bak. This activation induces mitochondrial apoptosis and eventually leads to cell death through the caspase cascade (29–31). Excess epithelial cell apoptosis causes the focal disruption of the intestinal mucosal barrier, leading to the invasion of luminal pathogens and increased intestinal permeability (6). This study demonstrated that the vitamin D analog, paricalcitol, inhibited the activation of PUMA in IECs after the TNBS injection, and therefore, maintained the integrity of the intestinal epithelial barrier. An enhanced epithelial barrier can prevent luminal microorganisms and antigens from invading. In this way, it attenuates the release of pro-inflammatory cytokines and chemokines and relieves inflammatory responses in the colon. This may be one of the pivotal mechanisms through which vitamin D inhibits the development of intestinal inflammation.

In conclusion, this study provides evidence that vitamin D attenuates the development of colitis by inhibiting the apoptosis of IECs. The mechanisms involved include the downregulation of PUMA expression. The present study may shed new light on the curative mechanisms of vitamin D in patients with IBD.

Acknowledgments

The present study was supported by the National Natural Science Foundation of China (81271938) and the Outstanding Scientific Fund of Shengjing Hospital.

References

1 

Tan B, Li P, Lv H, et al: Vitamin D Levels and bone metabolism in Chinese adult patients with inflammatory bowel disease. J Dig Dis. 15:116–123. 2014. View Article : Google Scholar

2 

Levin AD, Wadhera V, Leach ST, et al: Vitamin D deficiency in children with inflammatory bowel disease. Dig Dis Sci. 56:830–836. 2011. View Article : Google Scholar : PubMed/NCBI

3 

Loftus EV Jr: Clinical epidemiology of inflammatory bowel disease: incidence, prevalence, and environmental influences. Gastroenterology. 126:1504–1517. 2004. View Article : Google Scholar : PubMed/NCBI

4 

Wang L, Wang ZT, Hu JJ, Fan R, Zhou J and Zhong J: Polymorphisms of the vitamin D receptor gene and the risk of inflammatory bowel disease: a meta-analysis. Genet Mol Res. 13:2598–2610. 2014. View Article : Google Scholar : PubMed/NCBI

5 

Xue LN, Xu KQ, Zhang W, Wang Q, Wu J and Wang XY: Associations between vitamin D receptor polymorphisms and susceptibility to ulcerative colitis and Crohn’s disease: a meta-analysis. Inflamm Bowel Dis. 19:54–60. 2013. View Article : Google Scholar

6 

Kong J, Zhang ZY, Musch MW, et al: Novel role of the vitamin D receptor in maintaining the integrity of the intestinal mucosal barrier. Am J Physiol Gastrointest Liver Physiol. 294:208–216. 2008. View Article : Google Scholar

7 

Peterson LW and Artis D: Intestinal epithelial cells: regulators of barrier function and immune homeostasis. Nat Rev Immunol. 14:141–153. 2014. View Article : Google Scholar : PubMed/NCBI

8 

Fasano A and Shea-Donohue T: Mechanisms of disease: the role of intestinal barrier function in the pathogenesis of gastrointestinal autoimmune diseases. Nat Clin Pract Gastroenterol Hepatol. 2:416–422. 2005. View Article : Google Scholar : PubMed/NCBI

9 

Gibson PR: Increased gut permeability in Crohn’s disease: is TNF the link? Gut. 53:1724–1725. 2004. View Article : Google Scholar : PubMed/NCBI

10 

Watson AJ, Chu S, Sieck L, et al: Epithelial barrier function in vivo is sustained despite gaps in epithelial layers. Gastroenterology. 129:902–912. 2005. View Article : Google Scholar : PubMed/NCBI

11 

Abraham C and Cho JH: Inflammatory bowel disease. N Engl J Med. 361:2066–2078. 2009. View Article : Google Scholar : PubMed/NCBI

12 

Su L, Nalle SC, Shen L, et al: TNFR2 activates MLCK-dependent tight junction dysregulation to cause apoptosis-mediated barrier loss and experimental colitis. Gastroenterology. 145:407–415. 2013. View Article : Google Scholar : PubMed/NCBI

13 

Liu W, Chen Y, Golan MA, et al: Intestinal epithelial vitamin D receptor signaling inhibits experimental colitis. J Clin Invest. 123:3983–3996. 2013. View Article : Google Scholar : PubMed/NCBI

14 

Dirisina R, Katzman RB, Goretsky T, et al: p53 and PUMA independently regulate apoptosis of intestinal epithelial cells in patients and mice with colitis. Gastroenterology. 141:1036–1045. 2011. View Article : Google Scholar : PubMed/NCBI

15 

Qiu W, Wu B, Wang X, et al: PUMA-mediated intestinal epithelial apoptosis contributes to ulcerative colitis in humans and mice. J Clin Invest. 121:1722–1732. 2011. View Article : Google Scholar : PubMed/NCBI

16 

Bouillon R, Carmeliet G, Verlinden L, et al: Vitamin D and human health: lessons from vitamin D receptor null mice. Endocr Rev. 29:726–776. 2008. View Article : Google Scholar : PubMed/NCBI

17 

Wirtz S, Neufert C, Weigmann B and Neurath MF: Chemically induced mouse models of intestinal inflammation. Nat Protoc. 2:541–546. 2007. View Article : Google Scholar : PubMed/NCBI

18 

Appleyard CB and Wallace JL: Reactivation of hapten-induced colitis and its prevention by anti-inflammatory drugs. Am J Physiol. 269:G119–G125. 1995.PubMed/NCBI

19 

Cheng S and Coyne D: Paricalcitol capsules for the control of secondary hyperparathyroidism in chronic kidney disease. Expert Opin Pharmacother. 7:617–621. 2006. View Article : Google Scholar : PubMed/NCBI

20 

Greenbaum LA, Benador N, Goldstein SL, et al: Intravenous paricalcitol for treatment of secondary hyperparathyroidism in children on hemodialysis. Am J Kidney Dis. 49:814–823. 2007. View Article : Google Scholar : PubMed/NCBI

21 

Harries AD, Brown R, Heatley RV, Williams LA, Woodhead S and Rhodes J: Vitamin D status in Crohn’s disease: association with nutrition and disease activity. Gut. 26:1197–1203. 1985. View Article : Google Scholar : PubMed/NCBI

22 

Moum B, Aadland E, Ekbom A and Vatn MH: Seasonal variations in the onset of ulcerative colitis. Gut. 38:376–378. 1996. View Article : Google Scholar : PubMed/NCBI

23 

Naderi N, Farnood A, Habibi M, et al: Association of vitamin D receptor gene polymorphisms in Iranian patients with inflammatory bowel disease. J Gastroenterol Hepatol. 23:1816–1822. 2008. View Article : Google Scholar : PubMed/NCBI

24 

Cutolo M, Paolino S, Sulli A, Smith V, Pizzorni C and Seriolo B: Vitamin D, steroid hormones, and autoimmunity. Ann NY Acad Sci. 1317:39–46. 2014. View Article : Google Scholar : PubMed/NCBI

25 

Cantorna MT, McDaniel K, Bora S, Chen J and James J: Vitamin D, immune regulation, the microbiota, and inflammatory bowel disease. Exp Biol Med. 239:1524–1530. 2014. View Article : Google Scholar

26 

Cantorna MT and Mahon BD: Mounting evidence for vitamin D as an environmental factor affecting autoimmune disease prevalence. Exp Biol Med (Maywood). 229:1136–1142. 2004.

27 

Froicu M, Zhu Y and Cantorna MT: Vitamin D receptor is required to control gastrointestinal immunity in IL-10 knockout mice. Immunology. 117:310–318. 2006. View Article : Google Scholar : PubMed/NCBI

28 

Nicholson I, Dalzell AM and El-Matary W: Vitamin D as a therapy for colitis: a systematic review. J Crohns Colitis. 6:405–411. 2012. View Article : Google Scholar : PubMed/NCBI

29 

Han J, Flemington C, Houghton AB, et al: Expression of bbc3, a pro-apoptotic BH3-only gene, is regulated by diverse cell death and survival signals. Proc Natl Acad Sci USA. 98:11318–11323. 2001. View Article : Google Scholar : PubMed/NCBI

30 

Yu J and Zhang L: PUMA, a potent killer with or without p53. Oncogene. 27:S71–S83. 2008. View Article : Google Scholar

31 

Edelblum KL, Yan F, Yamaoka T and Polk DB: Regulation of apoptosis during homeostasis and disease in the intestinal epithelium. Inflamm Bowel Dis. 12:413–424. 2006. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Zhu T, Liu T, Shi Y and Zhao Q: Vitamin D/VDR signaling pathway ameliorates 2,4,6-trinitrobenzene sulfonic acid-induced colitis by inhibiting intestinal epithelial apoptosis. Int J Mol Med 35: 1213-1218, 2015.
APA
Zhu, T., Liu, T., Shi, Y., & Zhao, Q. (2015). Vitamin D/VDR signaling pathway ameliorates 2,4,6-trinitrobenzene sulfonic acid-induced colitis by inhibiting intestinal epithelial apoptosis. International Journal of Molecular Medicine, 35, 1213-1218. https://doi.org/10.3892/ijmm.2015.2150
MLA
Zhu, T., Liu, T., Shi, Y., Zhao, Q."Vitamin D/VDR signaling pathway ameliorates 2,4,6-trinitrobenzene sulfonic acid-induced colitis by inhibiting intestinal epithelial apoptosis". International Journal of Molecular Medicine 35.5 (2015): 1213-1218.
Chicago
Zhu, T., Liu, T., Shi, Y., Zhao, Q."Vitamin D/VDR signaling pathway ameliorates 2,4,6-trinitrobenzene sulfonic acid-induced colitis by inhibiting intestinal epithelial apoptosis". International Journal of Molecular Medicine 35, no. 5 (2015): 1213-1218. https://doi.org/10.3892/ijmm.2015.2150
Copy and paste a formatted citation
x
Spandidos Publications style
Zhu T, Liu T, Shi Y and Zhao Q: Vitamin D/VDR signaling pathway ameliorates 2,4,6-trinitrobenzene sulfonic acid-induced colitis by inhibiting intestinal epithelial apoptosis. Int J Mol Med 35: 1213-1218, 2015.
APA
Zhu, T., Liu, T., Shi, Y., & Zhao, Q. (2015). Vitamin D/VDR signaling pathway ameliorates 2,4,6-trinitrobenzene sulfonic acid-induced colitis by inhibiting intestinal epithelial apoptosis. International Journal of Molecular Medicine, 35, 1213-1218. https://doi.org/10.3892/ijmm.2015.2150
MLA
Zhu, T., Liu, T., Shi, Y., Zhao, Q."Vitamin D/VDR signaling pathway ameliorates 2,4,6-trinitrobenzene sulfonic acid-induced colitis by inhibiting intestinal epithelial apoptosis". International Journal of Molecular Medicine 35.5 (2015): 1213-1218.
Chicago
Zhu, T., Liu, T., Shi, Y., Zhao, Q."Vitamin D/VDR signaling pathway ameliorates 2,4,6-trinitrobenzene sulfonic acid-induced colitis by inhibiting intestinal epithelial apoptosis". International Journal of Molecular Medicine 35, no. 5 (2015): 1213-1218. https://doi.org/10.3892/ijmm.2015.2150
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team