Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Molecular Medicine Reports
Join Editorial Board Propose a Special Issue
Print ISSN: 1791-2997 Online ISSN: 1791-3004
Journal Cover
September-2016 Volume 14 Issue 3

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
September-2016 Volume 14 Issue 3

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Identification of a PTPN11 hot spot mutation in a child with atypical LEOPARD syndrome

  • Authors:
    • Jia Zhang
    • Jinwen Shen
    • Ruhong Cheng
    • Cheng Ni
    • Jianying Liang
    • Ming Li
    • Zhirong Yao
  • View Affiliations / Copyright

    Affiliations: Department of Dermatology, Xinhua Hospital, Shanghai Jiaotong University, School of Medicine, Shanghai 200092, P.R. China
  • Pages: 2639-2643
    |
    Published online on: July 27, 2016
       https://doi.org/10.3892/mmr.2016.5547
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

LEOPARD syndrome (LS) is an autosomal dominant inherited disorder primarily caused by mutations in the PTPN11, RAF1 and BRAF genes. Characteristic features include lentigines, craniofacial dysmorphism, myocardium or valve abnormalities, eletrocardiographic conduction defects and deafness. LS, neurofibromatosis type 1, Noonan syndrome and Legius syndrome are a group of highly overlapped disorders termed ‘RASopathies’. Therefore, clinical discrimination between these syndromes represents a huge challenge. The present study reports a young child diagnosed with LS via identification of a common p.Thr468Met mutation in PTPN11. Taking into account two Taiwanese LS cases with an identical mutation, Thr468Met is likely to be the most prevalent mutation in the Chinese population. Furthermore, this study suggests that a clinical diagnosis of LS should be considered for individuals with congenital cardiac defects and atypical lentigines (i.e., light brown freckles) scattered particularly on the face.

Introduction

LEOPARD syndrome (LS, OMIM 151100), an autosomal dominant inherited disorder, presents with phenotypes that strongly overlap with Noonan syndrome (NS, OMIM 163950). These features include ocular hypertelorism, pulmonary stenosis, growth retardation, sensorineural deafness, genitourinary abnormalities and in particular multiple lentigines (1). The majority of the clinical features of LS appear to be age-dependent (2), similar to that observed in neurofibromatosis type 1 (NF1, OMIM 162200). The cutaneous appearance is also similar to Legius syndrome, formerly termed neurofibromatosis type 1-like syndrome (NFLS, OMIM 611431), characterized by multiple café-au-lait spots (CALS) and skin-fold freckling. Thus, NF1, NFLS, NS and LS, which belong to a new class of genetic disorders called the 'RASopathies', may be clinically indistinguishable at early stages.

LS harbors certain genetic heterogeneity. PTPN11 (proportion, ~85%), RAF1 and BRAF (~0%) are the major pathogenic genes known to cause LS. Two recurrent mutations, Tyr279Cys and Thr468Met in PTPN11, were found in ~65% of the cases examined in a previous large study (3). Moreover, recently, a novel heterozygous MAP2K1 mutation (c.305A>G) was reported to be associated with LS (4).

To date there have been few cases of LS described in the Chinese population, except for a recent study that demonstrated cardiovascular complications in a patient with sporadic LS caused by a Tyr279Cys mutation in the PTPN11 gene (5) and four previous Taiwanese cases with Thr468Met and Gly464Ala mutations (6). The current study presented another case of LS with atypical symptoms diagnosed via identification of a common Thr468Met mutation in the PTPN11 gene and reviewed the literature for cases of LS associated with this mutation.

Materials and methods

Case history

A 5 year-old male patient was admitted to the Department of Dermatology, Xinhua Hospital (Shanghai, China) in December 2013. His parents were concerned about several CALS and freckles presenting over the trunk and face of the child from birth. Physical examination revealed 4 CALS with a diameter >0.5 cm and several freckle-like lesions scattered over the body. The patient also presented with short stature (height, 102 cm) and ocular hypertelorism (Fig. 1). Results of neuropsychological examination and hearing tests were normal. No Lisch nodules were found through slit-lamp examination. Following examination seven months later, it was observed that the freckle-like lesions had increased. Moreover, the patient had a medical history of pulmonary stenosis at 5 months and a follow-up surgical history of percutaneous balloon pulmonary valvuloplasty. Therefore, RASopathies, such as NS and LS, were investigated as potential diagnoses using genetic testing. This study was approved by the Institutional Review Board of Xinhua Hospital, Shanghai JiaoTong University School of Medicine and written informed consent was obtained from the parents of the patient. Peripheral blood was collected for DNA extraction using a TIANamp Blood DNA kit (Beijing Tiangen Biochemical Co., Ltd., Tiangen, China).

Figure 1

Clinical appearance of the patient in this study. The patient presented with (A) ocular hypertelorism, (B) a few freckle-like lesions mostly on the face from birth, and (C) developed gradually at 4 years old, as well as scattered café-au-lait spots (Arrows indicate the position) over the trunk.

DNA sequencing

Primers flanking all coding exons and intron-exon boundaries of NF1, SPRED1 and PTPN11 were designed by software Primer Premier 5.0 (Premier Biosoft International, Palo Alto, CA, USA) (Table I). The extracted genomic DNA (gDNA) samples were amplified by polymerase chain reaction (PCR). Thermal cycling conditions were as follows: Denaturation at 94°C for 5 min; 31 cycles of denaturation at 94°C for 30 sec, annealing for 30 sec at a temperature determined by the primers of each fragments and extension at 72°C for 1 min; followed by extension at 72°C for 1 min and an extension of 4°C for 5 min. The experiment was repeated 10–20 times After PCR, products were purified with AxyPrep DNA Gel Extraction Kit (Axygen; Thermo Fisher Scientific, Inc., Waltham, MA, USA) according to the manufacturer's protocol. Sanger sequencing was conducted using an ABI PRISM 3730 automated sequencer (Applied Biosystems; Thermo Fisher Scientific Inc.) to identify the mutation in the proband and verify it in his unaffected family members. When no pathogenic mutations were found in NF1 by Sanger sequencing, gDNA samples of the patient were further analyzed using multiplex ligation-dependent probe amplification (MLPA) kits P122, P081 P082 and P295 (MRC-Holland, Amsterdam, The Netherlands) as previously described (7,8). These kits were able to detect deletions/duplications involving single or multiple exons or the entire NF1 and SPRED1 genes. Sequencing results were analyzed using Geneious (version 5.6.7; Biomatters Ltd., Auckland, New Zealand). Full details on the use of Geneious are available on the website (https://support.geneious.com/home). Identified mutations were determined by comparing with the reported cDNA reference sequences (NM_000267.3 for NF1, NM_152594.2 for SPRED1 and NM_002834.2 for PTPN11).

Table I

Primers of the PTPN11 gene.

Table I

Primers of the PTPN11 gene.

Primer nameForward primer sequenceReverse primer sequenceProduct size (bp)Annealing (°C)
PTPN11-E01 GCCAGCCCGATGTGACCGAG CTGGAGGGCGAGGGGACGAG24564.0
PTPN11-E02 ACTCTGCTCATAATGCGTCT ACTTCTATGACCTGCTCCAA45255.0
PTPN11-E03 TCCTTGGGTTTCTTTCAACA AGTCATACACAGACCGTCAT39253.0
PTPN11-E04 CCCTTGGAGGAATGTGTCTA GTGTTTGTCCTCTTCCAGCA55257.0
PTPN11-E05 TCCCAGGCTGAAGCACAGTTG GAAGCTGCAATGGGTACATGGAG67762.4
PTPN11-E06 CCTCTGTCCGTGCCTTTATG ACTCACTGCCAACTCCCTTC44159.0
PTPN11-E07 TTCTGTGACTCTTTGACACGT GATTATTTTGGAAACTGCTTG29153.0
PTPN11-E08 + 9 TGAATGAACAAAACTTGGAC CACCAAGGAATAACATAATCA62551.0
PTPN11-E10 AACCTAACAGATGCGAAACAG GATGAGGGCAGGAACACTAC47857.0
PTPN11-E11 GCCCAAAAGGAGACGAGTTC TGGGTAGGTAAAAGCAAGCC39757.0
PTPN11-E12 AATGGCTTGGTTTTGAGTCT TGTAAACAAGGTCAGGTGGC41455.0
PTPN11-E13 GAATCCTGACTTCTGCCACT CAAGAGAATGAGAATCCGCA40557.0
PTPN11-E14 TTGGTTCGGTACAGTAAGTT AGTCACAGATACACTAACAG52653.0
PTPN11-E15 GCGTTATTTCACTTCTGCCT TTAACCAATAGAGCACTTGCA33755.0

Moreover, the literature was reviewed for the reported LS cases with p.Thr468Met mutation to determine the phenotypes of different LS patients with the same mutation (6,9–15). The Pubmed database was searched using the term ̔PTPN11 mutation', and all studies investigating LS cases were downloaded prior to the selection of LS cases with a p.Thr468Met mutation.

Results

Sanger sequencing

Sanger sequencing and MLPA analyses for NF1 and SPRED1 did not identify any pathogenic mutations. However, a common heterozygous missense mutation c.1403C>T (p.Thr468Met) in PTPN11 was identified in the proband and was absent in his unaffected parents (Fig. 2).

Figure 2

Sequencing results of PTPN11 by Geneious, version 5.6.7. A heterozygous missense mutation c.1403C>T (p.Thr468Met) in PTPN11 was revealed in the proband and was absent in his unaffected father. Arrows indicate site of mutation. cDNA reference sequence: NM_002834.2.

Discussion

PTPN11 mutations can cause LS and NS. Currently, there are twelve missense mutations in PTPN11 that are known to be responsible for LS: Tyr279Cys/Ser, Ala461Thr/Ser, Gly464Ala, Thr468Met/Pro, Arg498Leu/Trp, Gln506Pro and Gln510Glu/Pro (3,5,16,17). Mutation loci are important in the pathogenic mechanisms of NS and LS. The genetic discrimination between these two syndromes is primarily dependent on LS-related mutants all located at a PTP domain (amino acid residues 221-524) (18), exerting a dominant negative effect on PTPN11 (19). Moreover, LS-associated loss-of-function mutations in PTPN11 result in sustained extracellular signal-regulated kinases 1/2 activation by enhanced specific substrate dephosphorylation and cause hypertrophic cardio-myopathy by dysregulating mechanistic target of rapamycin signaling (20–24). Conversely, NS was associated with excessive PTPN11 activity by gain-of-function changes predominantly located at the N-SH2 domain (amino acid residues 3-104) (25).

Typical lentigines were flat, black-brown hyperpigmented macules that appeared all over the body (primarily on the face, neck and upper part of the trunk) during late childhood (Table II), and increased in number and darkened in color with age (2,3). However, the present case presented with light-brown freckle-like lesions (probably atypical lentigines) predominantly on the face since birth, which developed gradually to the current state at 4 years old. In consideration of the presence of several CALS, the most common and relevant disorders NF1 and NF1-like syndrome (i.e., Legius syndrome) were initially suspected. Following exclusion by molecular genetic testing, although there was no diffuse pattern of lentigines, the DNA was sequenced for mutations in the second most common pathogenic gene of RASopathies, PTPN11. Finally, a mutation in PTPN11 that accounts for NS and LS was identified. While patients with NF1 usually have >6 CALS (>0.5 cm in childhood, >1.5 cm in puberty), this study indicated that children with light brown scattered freckling on the face, several CALS and congenital cardiac defects such as pulmonary stenosis or hypertrophic cardiomyopathy should be considered for a diagnosis of LS or NS. Moreover, PTPN11 should analyzed in these patients.

Table II

Review of patients with LEOPARD syndrome with Thr468Met mutation in literature.

Table II

Review of patients with LEOPARD syndrome with Thr468Met mutation in literature.

ReferenceGender/age (years)PopulationMajor clinical features
Ref no.
Cutaneous featuresDysmorphic faceSkeletal anomaliesHearing lossTumorsPulmonary stenosisHCMOther cardio vascular anomalies
Present studyM/5ChineseCLS AL+−−−+−−
Lin et al 2009M/8ChineseML++−−−+−6
M/8ChineseML++−−−+−
F/7ChineseML++−−+−−
Digilio et al 2002F/12.8 yItalianCLS ML+−−−−−−18
M/15ItalianCLS ML++−−−−+
F/15.1ItalianCLS ML++−−−−+
F/39ItalianCLS ML++−−−−−
F/8.9ItalianCLS ML+−−−−−+
F/3ItalianCLS++−−++−
M/4.9ItalianCLS++−−−++
Sarkozy et al 2004?/4Italian–+?−−−−−14
?/34ItalianML+?−−−+−
Limongelli et al 2008?/13ItalianCLS ML+??−+−+10
?/1ItalianML+??−−−+
?/9ItalianCLS ML+??−−−+
?/4ItalianML+??−−−+
Santoro et al 2014M/8ItalianCLS AL++−−−−+9
M/12CLS ML
M/50ItalianCLS ML+++−−++
Carcavilla et al 2011M/4SpanishCLS AL+−−−−++11
M/9SpanishCLS AL+−−−−+−
M/16SpanishCLS AL+−−−−++
Carcavilla et al 2013M/49SpanishML+−−−−+−13
F/3SpanishCLS ML++−−+−−
M/11SpanishCLS ML+−−−−+−
M/4SpanishML++−−−+−
M/1.11Spanish–+−−−+−−
F/0.8SpanishCLS+−−−+−−
F/2Spanish–+−−−−−−
M/14Spanish–++−−−+−
Rankin et al 2013M/23BritishCLS ML++−+−−−15
Keren et al 2004Mean: 19FrenchML (7/7)
CLS (3/7)
(4/7)(5/7)(0/6)?(2/7)(4/7)(4/7)12
Total (38)CLS (23/38)(35/38)(19/32)(1/34)(1/31)(9/38)(17/38)(16/38)

[i] +, positive result; −, negative result; ?, unclear result; M, male; F, female; CLS, café-au-lait spots; ML, multiple lentigines; AL, atypical lentigines; HCM, hypertrophic cardiomyopathy.

A previous genotype-phenotype study suggested that hypertrophic cardiomyopathy is characteristic of PTPN11 mutation-positive LS patients (13), and was particularly associated with mutations in exon 7 and exon 12 (26), and cardiovascular anomalies were also prevalent in previous cases (Table II). Therefore, a long-term cardiac evaluation regarding cardiomyopathy should be concerned in our case. Moreover, overactive RAS signals can result in cell growth and division, ultimately leading to tumors. Therefore, we still should pay attention to the tumor risk of 'RASopathies' (27), and the potential tumor spectrum of LS, such as hematologic malignancies (28), medulloblastoma (15), which have been demonstrated in numerous LS cases.

In conclusion, the present study presents a young Chinese patient with LS with CALS and atypical lentigines who was successfully diagnosed by a series of molecular genetic testing. Considering that two Taiwanese LS cases harbored an identical mutation, Thr468Met is likely to be a mutation hotspot in the Chinese population. Generally, children with NS or NF1 are prone to developing malignancies, while the prognosis of LS is relatively favorable only if no severe cardiac defects and adverse cardiac events, which underline the necessity of definite diagnosis by genetic methods along with subsequent early prevention of congenital cardiac defects. A more recent follow up of the patient showed nearly normal pulmonary artery pressure and no obvious electrocardiogram abnormalities; however, regular monitoring concerning potential complications are required.

Acknowledgments

This study was supported by a grant from the Ph.D. Programs Foundation of Ministry of Education of China (grant no. 20130073120014) and a grant from the Natural Science Foundation of Shanghai Jiaotong University School of Medicine (grant no. 13XJ10023).

References

1 

Voron DA, Hatfield HH and Kalkhoff RK: Multiple lentigines syndrome: Case report and review of the literature. Am J Med. 60:447–456. 1976. View Article : Google Scholar : PubMed/NCBI

2 

Digilio MC, Sarkozy A, de Zorzi A, Pacileo G, Limongelli G, Mingarelli R, Calabrò R, Marino B and Dallapiccola B: LEOPARD syndrome: Clinical diagnosis in the first year of life. Am J Med Genet A. 140:740–746. 2006. View Article : Google Scholar : PubMed/NCBI

3 

Martínez-Quintana E and Rodríguez-González F: LEOPARD syndrome: Clinical features and gene mutations. Mol Syndromol. 3:145–157. 2012.PubMed/NCBI

4 

Nishi E, Mizuno S, Nanjo Y, Niihori T, Fukushima Y, Matsubara Y, Aoki Y and Kosho T: A novel heterozygous MAP2K1 mutation in a patient with Noonan syndrome with multiple lentigines. Am J Med Genet A. 167A:407–411. 2015. View Article : Google Scholar

5 

Wang Y, Chen C and Wang DW: Leopard syndrome caused by heterozygous missense mutation of Tyr 279 Cys in the PTPN11 gene in a sporadic case of Chinese Han. Int J Cardiol. 174:e101–e104. 2014. View Article : Google Scholar : PubMed/NCBI

6 

Lin IS, Wang JN, Chao SC, Wu JM and Lin SJ: PTPN11 mutations in LEOPARD syndrome: Report of four cases in Taiwan. J Formos Med Assoc. 108:803–807. 2009. View Article : Google Scholar : PubMed/NCBI

7 

Valero MC, Martín Y, Hernández-Imaz E, Marina Hernández A, Meleán G, Valero AM, Javier Rodríguez-Álvarez F, Tellería D and Hernández-Chico C: A highly sensitive genetic protocol to detect NF1 mutations. J Mol Diagn. 13:113–122. 2011. View Article : Google Scholar : PubMed/NCBI

8 

Zhang J, Tong H, Fu X, Zhang Y, Liu J, Cheng R, Liang J, Peng J, Sun Z, Liu H, et al: Molecular Characterization of NF1 and Neurofibromatosis type 1 genotype-phenotype correlations in a Chinese population. Sci Rep. 5:112912015. View Article : Google Scholar : PubMed/NCBI

9 

Santoro C, Pacileo G, Limongelli G, Scianguetta S, Giugliano T, Piluso G, Ragione FD, Cirillo M, Mirone G and Perrotta S: LEOPARD syndrome: Clinical dilemmas in differential diagnosis of RASopathies. BMC Med Genet. 15:442014. View Article : Google Scholar : PubMed/NCBI

10 

Limongelli G, Sarkozy A, Pacileo G, Calabrò P, Digilio MC, Maddaloni V, Gagliardi G, Di Salvo G, Iacomino M, Marino B, et al: Genotype-phenotype analysis and natural history of left ventricular hypertrophy in LEOPARD syndrome. Am J Med Genet A. 146A:620–628. 2008. View Article : Google Scholar : PubMed/NCBI

11 

Carcavilla A, Pinto I, Muñoz-Pacheco R, Barrio R, Martin-Frías M and Ezquieta B: LEOPARD syndrome (PTPN11, T468M) in three boys fulfilling neurofibromatosis type 1 clinical criteria. Eur J Pediatr. 170:1069–1074. 2011. View Article : Google Scholar : PubMed/NCBI

12 

Keren B, Hadchouel A, Saba S, Sznajer Y, Bonneau D, Leheup B, Boute O, Gaillard D, Lacombe D, Layet V, et al: PTPN11 mutations in patients with LEOPARD syndrome: A French multicentric experience. J Med Genet. 41:e1172004. View Article : Google Scholar : PubMed/NCBI

13 

Carcavilla A, Santomé JL, Pinto I, Sánchez-Pozo J, Guillén-Navarro E, Martín-Frías M, Lapunzina P and Ezquieta B: LEOPARD syndrome: A variant of Noonan syndrome strongly associated with hypertrophic cardiomyopathy. Rev Esp Cardiol (Engl Ed). 66:350–356. 2013. View Article : Google Scholar

14 

Sarkozy A, Conti E, Digilio MC, Marino B, Morini E, Pacileo G, Wilson M, Calabrò R, Pizzuti A and Dallapiccola B: Clinical and molecular analysis of 30 patients with multiple lentigines LEOPARD syndrome. J Med Genet. 41:e682004. View Article : Google Scholar : PubMed/NCBI

15 

Rankin J, Short J, Turnpenny P, Castle B and Hanemann CO: Medulloblastoma in a patient with the PTPN11 p.Thr468Met mutation. Am J Med Genet A. 161A:2027–2029. 2013. View Article : Google Scholar : PubMed/NCBI

16 

Conti E, Dottorini T, Sarkozy A, Tiller GE, Esposito G, Pizzuti A and Dallapiccola B: A novel PTPN11 mutation in LEOPARD syndrome. Hum Mutat. 21:6542003. View Article : Google Scholar

17 

Osawa R, Akiyama M, Yamanaka Y, Ujiie H, Nemoto-Hasebe I, Takeda A, Yanagi T and Shimizu H: A novel PTPN11 missense mutation in a patient with LEOPARD syndrome. Br J Dermatol. 161:1202–1204. 2009. View Article : Google Scholar : PubMed/NCBI

18 

Digilio MC, Conti E, Sarkozy A, Mingarelli R, Dottorini T, Marino B, Pizzuti A and Dallapiccola B: Grouping of multiple-lentigines/LEOPARD and Noonan syndromes on the PTPN11 gene. Am J Hum Genet. 71:389–394. 2002. View Article : Google Scholar : PubMed/NCBI

19 

Kontaridis MI, Swanson KD, David FS, Barford D and Neel BG: PTPN11 (Shp2) mutations in LEOPARD syndrome have dominant negative, not activating, effects. J Biol Chem. 281:6785–6792. 2006. View Article : Google Scholar

20 

Schramm C, Fine DM, Edwards MA, Reeb AN and Krenz M: The PTPN11 loss-of-function mutation Q510E-Shp2 causes hypertrophic cardiomyopathy by dysregulating mTOR signaling. Am J Physiol Heart Circ Physiol. 302:H231–H243. 2012. View Article : Google Scholar

21 

Marin TM, Keith K, Davies B, Conner DA, Guha P, Kalaitzidis D, Wu X, Lauriol J, Wang B, Bauer M, et al: Rapamycin reverses hypertrophic cardiomyopathy in a mouse model of LEOPARD syndrome-associated PTPN11 mutation. J Clin Invest. 121:1026–1043. 2011. View Article : Google Scholar : PubMed/NCBI

22 

Motegi S, Yokoyama Y, Ogino S, Yamada K, Uchiyama A, Perera B, Takeuchi Y, Ohnishi H and Ishikawa O: Pathogenesis of multiple lentigines in LEOPARD syndrome with PTPN11 gene mutation. Acta Derm Venereol. 95:978–984. 2015. View Article : Google Scholar : PubMed/NCBI

23 

Yu ZH, Zhang RY, Walls CD, Chen L, Zhang S, Wu L, Liu S and Zhang ZY: Molecular basis of gain-of-function LEOPARD syndrome-associated SHP2 mutations. Biochemistry. 53:4136–4151. 2014. View Article : Google Scholar : PubMed/NCBI

24 

Yu ZH, Xu J, Walls CD, Chen L, Zhang S, Zhang R, Wu L, Wang L, Liu S and Zhang ZY: Structural and mechanistic insights into LEOPARD syndrome-associated SHP2 mutations. J Biol Chem. 288:10472–10482. 2013. View Article : Google Scholar : PubMed/NCBI

25 

Tartaglia M, Mehler EL, Goldberg R, Zampino G, Brunner HG, Kremer H, van der Burgt I, Crosby AH, Ion A, Jeffery S, et al: Mutations in PTPN11, encoding the protein tyrosine phosphatase SHP-2, cause Noonan syndrome. Nat Genet. 29:465–468. 2001. View Article : Google Scholar : PubMed/NCBI

26 

Sarkozy A, Digilio MC and Dallapiccola B: Leopard syndrome. Orphanet J Rare Dis. 3:132008. View Article : Google Scholar : PubMed/NCBI

27 

Kratz CP, Rapisuwon S, Reed H, Hasle H and Rosenberg PS: Cancer in Noonan, Costello, cardiofaciocutaneous and LEOPARD syndromes. Am J Med Genet C Semin Med Genet. 157C:83–89. 2011. View Article : Google Scholar : PubMed/NCBI

28 

Tartaglia M, Niemeyer CM, Fragale A, Song X, Buechner J, Jung A, Hählen K, Hasle H, Licht JD and Gelb BD: Somatic mutations in PTPN11 in juvenile myelomonocytic leukemia, myelodysplastic syndromes and acute myeloid leukemia. Nat Genet. 34:148–150. 2003. View Article : Google Scholar

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Zhang J, Shen J, Cheng R, Ni C, Liang J, Li M and Yao Z: Identification of a PTPN11 hot spot mutation in a child with atypical LEOPARD syndrome. Mol Med Rep 14: 2639-2643, 2016.
APA
Zhang, J., Shen, J., Cheng, R., Ni, C., Liang, J., Li, M., & Yao, Z. (2016). Identification of a PTPN11 hot spot mutation in a child with atypical LEOPARD syndrome. Molecular Medicine Reports, 14, 2639-2643. https://doi.org/10.3892/mmr.2016.5547
MLA
Zhang, J., Shen, J., Cheng, R., Ni, C., Liang, J., Li, M., Yao, Z."Identification of a PTPN11 hot spot mutation in a child with atypical LEOPARD syndrome". Molecular Medicine Reports 14.3 (2016): 2639-2643.
Chicago
Zhang, J., Shen, J., Cheng, R., Ni, C., Liang, J., Li, M., Yao, Z."Identification of a PTPN11 hot spot mutation in a child with atypical LEOPARD syndrome". Molecular Medicine Reports 14, no. 3 (2016): 2639-2643. https://doi.org/10.3892/mmr.2016.5547
Copy and paste a formatted citation
x
Spandidos Publications style
Zhang J, Shen J, Cheng R, Ni C, Liang J, Li M and Yao Z: Identification of a PTPN11 hot spot mutation in a child with atypical LEOPARD syndrome. Mol Med Rep 14: 2639-2643, 2016.
APA
Zhang, J., Shen, J., Cheng, R., Ni, C., Liang, J., Li, M., & Yao, Z. (2016). Identification of a PTPN11 hot spot mutation in a child with atypical LEOPARD syndrome. Molecular Medicine Reports, 14, 2639-2643. https://doi.org/10.3892/mmr.2016.5547
MLA
Zhang, J., Shen, J., Cheng, R., Ni, C., Liang, J., Li, M., Yao, Z."Identification of a PTPN11 hot spot mutation in a child with atypical LEOPARD syndrome". Molecular Medicine Reports 14.3 (2016): 2639-2643.
Chicago
Zhang, J., Shen, J., Cheng, R., Ni, C., Liang, J., Li, M., Yao, Z."Identification of a PTPN11 hot spot mutation in a child with atypical LEOPARD syndrome". Molecular Medicine Reports 14, no. 3 (2016): 2639-2643. https://doi.org/10.3892/mmr.2016.5547
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team