Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Molecular Medicine Reports
Join Editorial Board Propose a Special Issue
Print ISSN: 1791-2997 Online ISSN: 1791-3004
Journal Cover
October-2016 Volume 14 Issue 4

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
October-2016 Volume 14 Issue 4

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

p53, Bcl-2 and cox-2 are involved in berberine hydrochloride-induced apoptosis of HeLa229 cells

  • Authors:
    • Hai‑Yan Wang
    • Hai‑Zhong Yu
    • Sheng‑Mou Huang
    • Yu‑Lan Zheng
  • View Affiliations

    Affiliations: Department of Chemical Engineering and Food Science, Hubei University of Arts and Science, Xiangyang, Hubei 441053, P.R. China, Department of Respiratory Disease, Xiangyang Central Hospital, Affiliated Hospital of Hubei University of Arts and Science, Xiangyang, Hubei 441021, P.R. China
  • Published online on: August 31, 2016     https://doi.org/10.3892/mmr.2016.5696
  • Pages: 3855-3861
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

The present study aimed to investigate the effects of berberine hydrochloride on the proliferation and apoptosis of HeLa229 human cervical cancer cells. A 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide assay was performed to examine the cytotoxicity of berberine hydrochloride against HeLa229 cells. The effects of berberine hydrochloride on the apoptosis of HeLa229 cells was detected by immunofluorescence and flow cytometry, and the mRNA expression levels of p53, B‑cell lymphoma 2 (Bcl‑2) and cyclooxygenase‑2 (cox‑2) were analyzed by reverse transcription-quantitative polymerase chain reaction. Berberine hydrochloride inhibited the proliferation of HeLa229 cells in a dose‑dependent manner; minimum cell viability (3.61%) was detected following treatment with 215.164 µmol/l berberine hydrochloride and the half maximal inhibitory concentration value was 42.93 µmol/l following treatment for 72 h. In addition, berberine hydrochloride induced apoptosis in HeLa229 cells in a dose‑ and time‑dependent manner. Berberine hydrochloride upregulated the mRNA expression levels of p53, and downregulated mRNA expression levels of Bcl‑2 and cox‑2, in a dose‑dependent manner. In conclusion, berberine hydrochloride inhibited the proliferation and induced apoptosis of HeLa229 cells, potentially via the upregulation of p53 and the downregulation of Bcl‑2 and cox‑2 mRNA expression levels.

Introduction

Cervical cancer is one of the most prevalent female cancers (1), and is responsible for significant morbidity and mortality worldwide (2). A lack of effective treatment programs is a primary reason for this; therefore, novel therapeutic agents are required. Plants are being investigated for their use in chemotherapy, due to their availability, cost and lack of side-effects (3).

Berberine is an isoquinoline alkaloid derived from the Chinese herb Huang Lian (4), which is commonly used for the treatment of gastrointestinal complaints, diarrhea and other conditions. Previous studies have suggested that berberine exerts significant anticancer activities against various cancer cell types, including human breast cancer (1,5), lung cancer (6), colon cancer (7), uterine leiomyoma (8), multiple myeloma (9), osteosarcoma (10), prostate cancer (11,12), cervical cancer (13,14), nasopharyngeal carcinoma (15,16), hepatocellular carcinoma (17–19), gastric carcinoma (20) and murine melanoma (21).

Berberine has been reported to suppress human papilloma virus (HPV) transcription and downstream signaling to induce growth arrest and apoptosis in SiHa and HPV18-positive cervical cancer cells via the modulation of activator protein 1 activity (22). In addition, berberine may reverse epithelial-to-mesenchymal transition, and inhibit metastasis and tumor-induced angiogenesis in SiHa cells (13). In Ca Ski human cervical cancer cells, berberine has been reported to enhance apoptosis via an increase in the ratio of p53 and B-cell lymphoma 2 (Bcl-2)-associated X protein (Bax)/Bcl-2, increased reactive oxygen species and calcium levels, disrupted mitochondrial membrane potential and increased caspase-3 activity, as mediated by GADD153 (23). Although berberine has been demonstrated to possess anticancer activities, the underlying mechanisms by which it exerts these effects remain to be fully elucidated. In addition, the effects of berberine on HeLa229 cells have not been reported. Therefore, the present study aimed to investigate the effects of berberine hydrochloride on cell proliferation, apoptosis and associated gene expression in HeLa229 human cervical cancer cells.

Materials and methods

Materials

HeLa229 human cervical carcinoma cells were obtained from the China Center for Type Culture Collection (Wuhan, China). Berberine hydrochloride was purchased from Xi'an Guanyu Bio-Tech Co., Ltd. (Xi'an, China). Fetal calf serum (FCS) was purchased from Hangzhou Sijiqing Biological Engineering Materials Co., Ltd. (Hangzhou, China). Trypsin and 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) were purchased from Amresco, LLC (Cleveland, OH, USA). Penicillin, streptomycin and dimethyl sulfoxide (DMSO) were obtained from Sigma-Aldrich; Merck Millipore (Darmstadt, Germany). The Annexin V-Fluorescein Isothiocyanate (FITC)/Propidium Iodide (PI) Apoptosis Detection kit was from BioVision, Inc. (Milpitas, CA, USA). All other chemicals and solvents used were of the highest purity grade available.

Cell culture and treatment

Cells were cultured in RPMI-1640 medium, supplemented with 10% heat-inactivated FCS, 100 IU/ml penicillin and 100 μg/ml streptomycin at 37°C in a humidified atmosphere containing 5% CO2.

MTT assay

Cells in the exponential growth phase were harvested, adjusted to 2×104 cells/ml and seeded in 96-well plates (200 μl/well). Following a 24-h incubation at 37°C, the medium was removed and berberine hydrochloride was added to wells in a final concentration range of 3.362–215.168 μmol/l. The plate was incubated for a further 72 h, following which 20 μl 5 mg/ml MTT reagent was added to wells. Subsequent to a 4-h incubation at 37°C, formazan crystals formed by live cells were dissolved with 150 μl DMSO and absorbance was measured at 490 nm using a microplate reader (DG5033A; Nanjing Huadong Electronics Group Medical Equipment Co., Ltd., Nanjing, China). Viability was determined using the following formula: % of growth = (optical density of treated cells/optical density of untreated cells) × 100. The half maximal inhibitory concentration (IC50) values were calculated as the concentration of drug required to inhibit 50% proliferation compared with untreated cells.

Detection of apoptosis-microscopy

Experiments were conducted as described previously (24,25), using an Annexin V-FITC/PI Apoptosis Detection kit. Cells at a density of 1.5×105 cells/ml were incubated with 26.896 or 107.584 μmol/l berberine hydrochloride at 37°C for 48 h. Adherent and floating cells were harvested, washed twice with PBS and suspended in 500 μl of 1X Binding Buffer. Annexin V-FITC (5 μl) and 10 μl PI were added and cells were vortexed and incubated for 5 min in the dark. Cells were visualized immediately using an inverted fluorescence biological microscope XD-101 (Nanjing Jiangnan Photovoltaic Group Co., Ltd., Nanjing, China).

Detection of apoptosis-flow cytometry

Cells at a density of 1.5×105 cells/ml were incubated with 42.93 or 107.584 μmol/l berberine hydrochloride at 37°C for 24, 48 and 72 h. Apoptosis was detected using the Annexin V-FITC/PI Apoptosis Detection kit, as aforementioned. Cells were analyzed immediately by flow cytometry using an FC 500 (Beckman Coulter, Inc., Brea, CA, USA).

Reverse transcription-quantitative polymerase chain reaction (RT-qPCR)

Cells (1.5×105 cells/ml) were incubated with 21.465, 42.93 or 107.584 μmol/l berberine hydrochloride for 48 h. Total RNA was prepared using TRIzol® reagent (Invitrogen; Thermo Fisher Scientific, Inc., Waltham, MA, USA) according to the manufacturer's protocol and was reverse transcribed using RevertAid™ Moloney Murine Leukemia Virus Reverse Transcriptase and oligo (dT) primers (Fermentas; Thermo Fisher Scientific, Inc., Pittsburgh, PA, USA). qPCR was performed on the resulting cDNA using an ABI 7900HT Fast Real Time PCR system (Applied Biosystems; Thermo Fisher Scientific, Inc.) and SYBR® Green Real Time PCR Master mix (Toyobo Co., Ltd., Osaka, Japan). The reaction mixture volume was 25 μl, including 11.2 μl PCR water, 2.5 μl SYBR® Green Real Time PCR Master mix, 0.5 μl forward primer (10 μM), 0.5 μl reverse primer (10 μM) and 0.3 μl cDNA. Primers were synthesized by Shanghai Generay Biotech Co., Ltd. (Shanghai, China), and sequences are presented in Table I. The cycling conditions were as follows: An initial denaturation step at 94°C for 7 min, followed by 35 cycles of denaturation at 94°C for 30 sec, annealing at 63°C for 30 sec and extension at 72°C for 20 sec. Results were analyzed to determine the PCR cycle number that generated the first fluorescence signal over a threshold [quantification cycle (Cq), 10 standard deviations (SDs) over the mean fluorescence generated during the baseline cycles], following which the ΔΔCq method was used to measure relative gene expression (29). Expression of the analyzed genes were normalized to the endogenous reference gene, β-actin.

Table I

Primer sequences for reverse transcription-quantitative polymerase chain reaction.

Table I

Primer sequences for reverse transcription-quantitative polymerase chain reaction.

GeneSequence (5′-3′)
Product size (bp)Reference
ForwardReverse
β-actin GTACCCTGGCATTGCCGACA GGACTCGTCATACTCCTGCTTGCT18126
p53 GCCCACTTCACCGTACTAA TGGTTTCAAGGCCAGATGT15325
Bcl-2 GGGAGGATTGTGGCCTTCTT TCATCCACAGGGCGATGTT9927
Cox-2 CACCCATGTCAAAACCGAGG CCGGTGTTGAGCAGTTTTCTC10328

[i] Bcl-2, B-cell lymphoma 2; Cox-2, cyclooxygenase-2.

Statistical analysis

All experiments were performed in triplicate. Data are expressed as the mean ± SD. Data were analyzed in SPSS version 16.0 (SPSS, Inc., Chicago, IL, USA), using one-way analysis of variance followed by the least significant difference test to compare treatment and control groups. P<0.05 was considered to indicate a statistically significant difference.

Results

Berberine hydrochloride reduces cell viability

The effects of berberine hydrochloride on the viability of HeLa229 human cervical carcinoma cells were evaluated using an MTT assay (Fig. 1). The IC50 for HeLa229 cells at 72 h was 42.93 μmol/l. Berberine hydrochloride inhibited HeLa229 cells in a dose-dependent manner. Cell viability following treatment with 3.362, 6.724, 53.791 and 215.164 μmol/l berberine hydrochloride treatment was 99.56, 93.61, 42.85 and 3.61%, respectively. The results demonstrated that HeLa229 cell viability was reduced following a 72-h incubation with berberine hydrochloride.

Figure 1

Cell viability of HeLa229 cells following incubation with various concentrations of berberine hydrochloride for 72 h. Berberine hydrochloride decreased HeLa229 cell viability in a dose-dependent manner. Data are presented as the mean ± standard deviation of three individual experiments.

Berberine hydrochloride induces apoptosis of HeLa229 cells

Apoptosis of HeLa229 cells was detected using the Annexin V-FITC/Propidium Iodide Apoptosis Detection kit. As presented in Fig. 2, apoptotic cells could be observed clearly by fluorescence microscopy. The cell membranes of early and late apoptotic cells were FITC-positive (green), whereas late apoptotic cells additionally had PI-positive (red) nuclei accompanied by condensed chromatin and apoptotic bodies. Increased numbers of late apoptotic cells were observed following treatment with 107.584 μmol/l, compared with 26.896 μmol/l berberine hydrochloride.

Figure 2

Apoptosis was induced in HeLa229 cells following treatment with berberine hydrochloride for 48 h. (A) Untreated control, (B) 26.896 μmol/l berberine hydrochloride-treated and (C) 107.584 μmol/l berberine hydrochloride-treated cells were stained with Annexin V-fluorescein isothiocyanate (green) and propidium iodide (red) to detect early and late apoptotic cells. The cell membranes of early and late apoptotic cells were stained green; whereas late apoptotic cells had additionally red-stained nuclei accompanied by condensed chromatin and apoptotic bodies. Magnification, ×200. Arrows indicate late apoptotic cells or condensed chromatin or apoptotic bodies.

As presented in Fig. 3, no significant differences were observed in the proportions of early apoptotic cells following treatment with 42.93 or 107.584 μmol/l berberine hydrochloride for 24 or 48 h, compared with untreated control cells; or in the proportions of late apoptotic cells following treatment with 42.93 μmol/l berberine hydrochloride for 24 h, compared with control cells. Significant early apoptosis was observed following treatment with 42.93 or 107.584 μmol/l berberine hydrochloride for 72 h, at 2.37 and 8.37% of cells, respectively (all P<0.001). The percentage of late apoptotic cells treated with 42.93 μmol/l berberine hydrochloride for 48 h was greater than for cells treated with 107.584 μmol/l berberine hydrochloride; however, this was reversed at 72 h, at 16.43 and 37%, respectively. The percentage of total apoptotic cells increased markedly from 7.3% in the 42.93 μmol/l treatment group at 48 h to 45.37% in the 107.584 μmol/l treatment group for 72 h. Significant differences were observed in the proportions of intact cells (non-apoptotic live cells) at 24, 48 and 72 h between the three groups (all P<0.001). In addition, compared with control groups, significant differences were detected in the proportions of early and late apoptotic cells at 72 h [all P<0.001, except early apoptotic cells of the 42.93 μmol/l treatment group (P=0.007)], and in the percentage of total apoptotic cells at 24 (42.93 μmol/l, P=0.001; 107.584 μmol/l, P<0.001), 48 and 72 h (all P<0.001). Compared with the 42.93 μmol/l berberine hydrochloride treatment group, the 107.584 μmol/l berberine hydrochloride treatment group revealed significant differences (P<0.001) in the percentage of intact cells at all time points and early and late apoptotic cells at 72 h, and in the percentage of total apoptotic cells at 24 h (P=0.014) and 72 h (P<0.001). These results suggest that berberine hydrochloride induced apoptosis of HeLa229 cells in a dose- and time-dependent manner.

Figure 3

Apoptosis of HeLa229 cells treated with 42.93 or 107.584 μmol/l berberine hydrochloride for 24, 48 or 72 h. (A) Flow cytometry was performed on cells stained with Annexin V-FITC and PI. The intact (live) cells are negative for Annexin V-FITC and PI (lower left quadrant). Early apoptotic cells are defined as Annexin V-FITC-positive and PI-negative (lower right quadrant) and late apoptotic cells are defined as Annexin V-FITC-positive and PI-positive (upper right quadrant). The proportion of intact, and early, late, and total apoptotic cells was determined at (B) 24, (C) 48 and (D) 72 h. Berberine hydrochloride induced apoptosis of HeLa229 cells in a dose- and time-dependent manner. Data are presented as the mean ± standard deviation of three determinations. *P<0.05 vs. control; #P<0.05 vs. 42.93 μmol/l berberine hydrochloride. FITC, fluorescein isothiocyanate; PI, propidium iodide.

mRNA expression levels in berberine hydrochloride-treated cells

p53, Bcl-2 and cox-2 mRNA expression levels in HeLa229 cells were assessed by RT-qPCR, following treatment with 21.465, 42.93 or 107.584 μmol/l berberine hydrochloride for 48 h (Fig. 4). Berberine hydrochloride upregulated mRNA expression levels of p53, whereas mRNA expression levels of Bcl-2 and cox-2 were downregulated in a dose-dependent manner. mRNA expression levels of p53 increased from 1.287- to 2.57-fold relative to control, whereas mRNA expression levels of cox-2 decreased from 0.856-to 0.545-fold, and Bcl-2 decreased from 0.962- to 0.775-fold. Significant differences were observed in p53 mRNA expression levels between treated (21.465 μmol/l, P=0.025; 42.93 μmol/l, P<0.001; 107.584 μmol/l, P<0.001) and untreated control cells, and in cox-2 mRNA expression levels between cells treated with 42.93 (P=0.039) or 107.584 (P=0.002) μmol/l berberine hydrochloride and control cells.

Figure 4

Berberine hydrochloride alters mRNA expression levels in HeLa229 cells. Cells were stimulated with 21.465, 42.93 or 107.584 μmol/l berberine hydrochloride for 48 h, and RNA was extracted for reverse transcription-quantitative polymerase chain reaction analysis of p53, Bcl-2 and cox-2. Berberine hydrochloride upregulated mRNA expression levels of p53, whereas mRNA expression levels of Bcl-2 and cox-2 were downregulated in a dose-dependent manner. Each sample was run in triplicate, and the relative amount of mRNA was normalized to β-actin. Fold-changes compared with control are presented. Data are presented as the mean ± standard deviation of three determinations. *P<0.05 vs. control. Bcl-2, B-cell lymphoma 2; cox-2, cyclooxygenase-2.

Discussion

Berberine is a naturally-occurring isoquinoline alkaloid, which exerts antitumor effects on numerous cancer types (5,30–38) and is non-toxic to normal cells (22). However, the effects of berberine on the HeLa229 human cervical carcinoma cell line remain unclear.

The results of the present study suggested that treatment with berberine hydrochloride for 72 h significantly decreased the viability of HeLa229 cells. Annexin V and PI staining demonstrated that berberine hydrochloride treatment resulted in apoptosis of HeLa229 cells. Apoptosis is tightly regulated by anti- and proapoptotic effector molecules (39) and is caused by the activation of caspases. Two separate pathways (extrinsic and intrinsic) of caspase activation have been described (40). p53 is a critical regulator of apoptosis (41), initiating the intrinsic pathway via the transcriptional activation of Bcl-2 family members (42). The Bcl-2 family consists of three major groups, which differ in regions of Bcl-2 homology (BH domains) and function: Multidomain anti-apoptotic (including Bcl-2), multidomain proapoptotic and BH3-only proapoptotic (43). Berberine hydrochloride may upregulate the expression levels of p53, triggering the intrinsic pathway of apoptosis via downregulation of Bcl-2 expression levels. This would result in release of cytochrome c in the mitochondrial membrane and activation of caspase-9, resulting in apoptosis (44). Cox-2 is a target for anticancer therapy (45), which is involved in the extrinsic pathway. Its expression increases as cells become cancerous (46), and it is associated with the stimulation of angiogenesis, and tumor growth, invasion and metastasis (47–49). In the present study, treatment with berberine hydrochloride increased the expression of p53 and decreased the expression of Bcl-2 and cox-2, in a dose-dependent manner. These results are consistent with a previous study, which demonstrated that berberine induced apoptosis via a significant decrease in the Bcl-2/Bax ratio, and the upregulation of Fas, Fas ligand, tumor necrosis factor (TNF)-α, TNF receptor-associated factor 1 and p53 in HeLa cells (14).

In conclusion, the results of the present study suggested that berberine hydrochloride may exhibit significant cytotoxicity against HeLa229 cells. At the lowest concentration assessed (3.362 μmol/l), the inhibition of HeLa229 cells by berberine hydrochloride was <1% (0.44%); however, inhibition increased to >96% (96.39%) at the maximum concentration examined (215.168 μmol/l). Berberine hydrochloride induced typical characteristics of apoptosis in HeLa229 cells, including nuclear condensation, nuclear fragmentation and the formation of apoptotic bodies. In addition, 42.93 and 107.584 μmol/l berberine hydrochloride induced apoptosis in a time-dependent manner. Berberine hydrochloride induced apoptosis in HeLa229 cells via the activation of the extrinsic and intrinsic pathways, involving the upregulation of p53 mRNA expression levels and the downregulation of Bcl-2 and cox-2 mRNA expression levels. Therefore, berberine appears to be a potential therapeutic agent for the treatment of cervical cancer.

Acknowledgments

The present study was supported by a grant from the Science and Technology Research Project of Hubei Provincial Department of Education (grant no. Q20092504) and a grant from the Discipline Groups Construction of Food New-type Industrialization of Hubei University of Arts and Science (grant no. XKQ08321).

References

1 

Xie J, Xu Y, Huang X, Chen Y, Fu J, Xi M and Wang L: Berberine-induced apoptosis in human breast cancer cells is mediated by reactive oxygen species generation and mitochondrial-related apoptotic pathway. Tumour Biol. 36:1279–1288. 2015. View Article : Google Scholar

2 

Parkin DM: The global health burden of infection-associated cancers in the year 2002. Int J Cancer. 118:3030–3044. 2006. View Article : Google Scholar : PubMed/NCBI

3 

Engel N, Oppermann C, Falodun A and Kragl U: Proliferative effects of five traditional Nigerian medicinal plant extracts on human breast and bone cancer cell lines. J Ethnopharmacol. 137:1003–1010. 2011. View Article : Google Scholar : PubMed/NCBI

4 

Sun Y, Xun K, Wang Y and Chen X: A systematic review of the anticancer properties of berberine, a natural product from Chinese herbs. Anticancer Drugs. 20:757–769. 2009. View Article : Google Scholar : PubMed/NCBI

5 

Li X, Zhao SJ, Shi HL, Qiu SP, Xie JQ, Wu H, Zhang BB, Wang ZT, Yuan JY and Wu XJ: Berberine hydrochloride IL-8 dependently inhibits invasion and IL-8-independently promotes cell apoptosis in MDA-MB-231 cells. Oncol Rep. 32:2777–2788. 2014.PubMed/NCBI

6 

Xi S, Chuang K, Fang K, Lee Y, Chung J and Chuang Y: Effect of berberine on activity and mRNA expression of N-acetyltransferase in human lung cancer cell line A549. J Tradit Chin Med. 34:302–308. 2014. View Article : Google Scholar : PubMed/NCBI

7 

Guamán Ortiz LM, Tillhon M, Parks M, Dutto I, Prosperi E, Savio M, Arcamone AG, Buzzetti F, Lombardi P and Scovassi AI: Multiple effects of berberine derivatives on colon cancer cells. Biomed Res Int. 2014:9245852014. View Article : Google Scholar : PubMed/NCBI

8 

Wu HL, Chuang TY, Al-Hendy A, Diamond MP, Azziz R and Chen YH: Berberine inhibits the proliferation of human uterine leiomyoma cells. Fertil Steril. 103:1098–1106. 2015. View Article : Google Scholar : PubMed/NCBI

9 

Qing Y, Hu H, Liu Y, Feng T, Meng W, Jiang L, Sun Y and Yao Y: Berberine induces apoptosis in human multiple myeloma cell line U266 through hypomethylation of p53 promoter. Cell Biol Int. 38:563–570. 2014. View Article : Google Scholar : PubMed/NCBI

10 

Zhu Y, Ma N, Li HX, Tian L, Ba YF and Hao B: Berberine induces apoptosis and DNA damage in MG-63 human osteosarcoma cells. Mol Med Rep. 10:1734–1738. 2014.PubMed/NCBI

11 

Zhang Q, Zhang C, Yang X, Yang B, Wang J, Kang Y, Wang Z, Li D, Huang G, Ma Z, et al: Berberine inhibits the expression of hypoxia induction factor-1alpha and increases the radiosensitivity of prostate cancer. Diagn Pathol. 9:982014. View Article : Google Scholar : PubMed/NCBI

12 

Zhang LY, Wu YL, Gao XH and Guo F: Mitochondrial protein cyclophilin-D-mediated programmed necrosis attributes to berberine-induced cytotoxicity in cultured prostate cancer cells. Biochem Biophys Res Commun. 450:697–703. 2014. View Article : Google Scholar : PubMed/NCBI

13 

Chu SC, Yu CC, Hsu LS, Chen KS, Su MY and Chen PN: Berberine reverses epithelial-to-mesenchymal transition and inhibits metastasis and tumor-induced angiogenesis in human cervical cancer cells. Mol Pharmacol. 86:609–623. 2014. View Article : Google Scholar : PubMed/NCBI

14 

Lu B, Hu M, Liu K and Peng J: Cytotoxicity of berberine on human cervical carcinoma HeLa cells through mitochondria, death receptor and MAPK pathways, and in-silico drug-target prediction. Toxicol In Vitro. 24:1482–1490. 2010. View Article : Google Scholar : PubMed/NCBI

15 

Li CH, Wu DF, Ding H, Zhao Y, Zhou KY and Xu DF: Berberine hydrochloride impact on physiological processes and modulation of twist levels in nasopharyngeal carcinoma CNE-1 cells. Asian Pac J Cancer Prev. 15:1851–1857. 2014. View Article : Google Scholar : PubMed/NCBI

16 

Zhang C, Yang X, Zhang Q, Yang B, Xu L, Qin Q, Zhu H, Liu J, Cai J, Tao G, et al: Berberine radiosensitizes human nasopharyngeal carcinoma by suppressing hypoxia-inducible factor-1α expression. Acta Otolaryngol. 134:185–192. 2014. View Article : Google Scholar

17 

Wang N, Zhu M, Wang X, Tan HY, Tsao SW and Feng Y: Berberine-induced tumor suppressor p53 up-regulation gets involved in the regulatory network of MIR-23a in hepatocellular carcinoma. Biochim Biophys Acta. 1839:849–857. 2014. View Article : Google Scholar : PubMed/NCBI

18 

Wang L, Wei D, Han X, Zhang W, Fan C, Zhang J, Mo C, Yang M, Li J, Wang Z, et al: The combinational effect of vincristine and berberine on growth inhibition and apoptosis induction in hepatoma cells. J Cell Biochem. 115:721–730. 2014. View Article : Google Scholar

19 

Guo N, Yan A, Gao X, Chen Y, He X, Hu Z, Mi M, Tang X and Gou X: Berberine sensitizes rapamycin-mediated human hepatoma cell death in vitro. Mol Med Rep. 10:3132–3138. 2014.PubMed/NCBI

20 

Zhang XZ, Wang L, Liu DW, Tang GY and Zhang HY: Synergistic inhibitory effect of berberine and d-limonene on human gastric carcinoma cell line MGC803. J Med Food. 17:955–962. 2014. View Article : Google Scholar : PubMed/NCBI

21 

Mittal A, Tabasum S and Singh RP: Berberine in combination with doxorubicin suppresses growth of murine melanoma B16F10 cells in culture and xenograft. Phytomedicine. 21:340–347. 2014. View Article : Google Scholar

22 

Mahata S, Bharti AC, Shukla S, Tyagi A, Husain SA and Das BC: Berberine modulates AP-1 activity to suppress HPV transcription and downstream signaling to induce growth arrest and apoptosis in cervical cancer cells. Mol Cancer. 10:392011. View Article : Google Scholar : PubMed/NCBI

23 

Lin JP, Yang JS, Chang NW, Chiu TH, Su CC, Lu KW, Ho YT, Yeh CC, Mei-Dueyang, Lin HJ and Chung JG: GADD153 mediates berberine-induced apoptosis in human cervical cancer Ca ski cells. Anticancer Res. 27:3379–3386. 2007.PubMed/NCBI

24 

Abu Bakar MF, Mohamad M, Rahmat A, Burr SA and Fry JR: Cytotoxicity, cell cycle arrest, and apoptosis in breast cancer cell lines exposed to an extract of the seed kernel of Mangifera pajang (bambangan). Food Chem Toxicol. 48:1688–1697. 2010. View Article : Google Scholar : PubMed/NCBI

25 

Tian Z, An N, Zhou B, Xiao P, Kohane IS and Wu E: Cytotoxic diarylheptanoid induces cell cycle arrest and apoptosis via increasing ATF3 and stabilizing p53 in SH-SY5Y cells. Cancer Chemother Pharmacol. 63:1131–1139. 2009. View Article : Google Scholar

26 

Itoh M, Murata T, Suzuki T, Shindoh M, Nakajima K, Imai K and Yoshida K: Requirement of STAT3 activation for maximal collagenase-1 (MMP-1) induction by epidermal growth factor and malignant characteristics in T24 bladder cancer cells. Oncogene. 25:1195–1204. 2006. View Article : Google Scholar

27 

Jiang N, Zhou LQ and Zhang XY: Downregulation of the nucleosome-binding protein 1 (NSBP1) gene can inhibit the in vitro and in vivo proliferation of prostate cancer cells. Asian J Androl. 12:709–717. 2010. View Article : Google Scholar : PubMed/NCBI

28 

Zhou A, Scoggin S, Gaynor RB and Williams NS: Identification of NF-kappa B-regulated genes induced by TNFalpha utilizing expression profiling and RNA interference. Oncogene. 22:2054–2064. 2003. View Article : Google Scholar : PubMed/NCBI

29 

Lapillonne H, Konopleva M, Tsao T, Gold D, McQueen T, Sutherland RL, Madden T and Andreeff M: Activation of peroxisome proliferator-activated receptor gamma by a novel synthetic triterpenoid 2-cyano-3, 12-dioxooleana-1, 9-dien-28-oic acid induces growth arrest and apoptosis in breast cancer cells. Cancer Res. 63:5926–5939. 2003.PubMed/NCBI

30 

Chidambara Murthy KN, Jayaprakasha GK and Patil BS: The natural alkaloid berberine targets multiple pathways to induce cell death in cultured human colon cancer cells. Eur J Pharmacol. 688:14–21. 2012. View Article : Google Scholar : PubMed/NCBI

31 

Hur JM, Hyun MS, Lim SY, Lee WY and Kim D: The combination of berberine and irradiation enhances anti-cancer effects via activation of p38 MAPK pathway and ROS generation in human hepatoma cells. J Cell Biochem. 107:955–964. 2009. View Article : Google Scholar : PubMed/NCBI

32 

Kim JB, Yu JH, Ko E, Lee KW, Song AK, Park SY, Shin I, Han W and Noh DY: The alkaloid Berberine inhibits the growth of Anoikis-resistant MCF-7 and MDA-MB-231 breast cancer cell lines by inducing cell cycle arrest. Phytomedicine. 17:436–440. 2010. View Article : Google Scholar

33 

Wang J, Liu Q and Yang Q: Radiosensitization effects of berberine on human breast cancer cells. Int J Mol Med. 30:1166–1172. 2012.PubMed/NCBI

34 

Chou HC, Lu YC, Cheng CS, Chen YW, Lyu PC, Lin CW, Timms JF and Chan HL: Proteomic and redox-proteomic analysis of berberine-induced cytotoxicity in breast cancer cells. J Proteomics. 75:3158–3176. 2012. View Article : Google Scholar : PubMed/NCBI

35 

Zheng F, Tang Q, Wu J, Zhao S, Liang Z, Li L, Wu W and Hann S: p38α MAPK-mediated induction and interaction of FOXO3a and p53 contribute to the inhibited-growth and induced-apoptosis of human lung adenocarcinoma cells by berberine. J Exp Clin Cancer Res. 33:362014. View Article : Google Scholar

36 

Ma X, Zhou J, Zhang CX, Li XY, Li N, Ju RJ, Shi JF, Sun MG, Zhao WY, Mu LM, et al: Modulation of drug-resistant membrane and apoptosis proteins of breast cancer stem cells by targeting berberine liposomes. Biomaterials. 34:4452–4465. 2013. View Article : Google Scholar : PubMed/NCBI

37 

Qi HW, Xin LY, Xu X, Ji XX and Fan LH: Epithelial-to-mesenchymal transition markers to predict response of Berberine in suppressing lung cancer invasion and metastasis. J Transl Med. 12:222014. View Article : Google Scholar : PubMed/NCBI

38 

Scordino A, Campisi A, Grasso R, Bonfanti R, Gulino M, Iauk L, Parenti R and Musumeci F: Delayed luminescence to monitor programmed cell death induced by berberine on thyroid cancer cells. J Biomed Opt. 19:1170052014. View Article : Google Scholar : PubMed/NCBI

39 

Weyhenmeyer B, Murphy AC, Prehn JH and Murphy BM: Targeting the anti-apoptotic bcl-2 family members for the treatment of cancer. Exp Oncol. 34:192–199. 2012.PubMed/NCBI

40 

Green DR: Apoptotic pathways: Paper wraps stone blunts scissors. Cell. 102:1–4. 2000. View Article : Google Scholar : PubMed/NCBI

41 

Žegura B, Gajski G, Štraser A and Garaj-Vrhovac V: Cylindrospermopsin induced DNA damage and alteration in the expression of genes involved in the response to DNA damage, apoptosis and oxidative stress. Toxicon. 58:471–479. 2011. View Article : Google Scholar : PubMed/NCBI

42 

Vogelstein B, Lane D and Levine AJ: Surfing the p53 network. Nature. 408:307–310. 2000. View Article : Google Scholar : PubMed/NCBI

43 

Certo M, Del Gaizo Moore V, Nishino M, Wei G, Korsmeyer S, Armstrong SA and Letai A: Mitochondria primed by death signals determine cellular addiction to antiapoptotic BCL-2 family members. Cancer Cell. 9:351–365. 2006. View Article : Google Scholar : PubMed/NCBI

44 

Kim R, Tanabe K, Uchida Y, Emi M, Inoue H and Toge T: Current status of the molecular mechanisms of anticancer drug-induced apoptosis. The contribution of molecular-level analysis to cancer chemotherapy. Cancer Chemother Pharmacol. 50:343–352. 2002. View Article : Google Scholar : PubMed/NCBI

45 

Zhang C, Yan W, Li B, Xu B, Gong Y, Chu F, Zhang Y, Yao Q, Wang P and Lei H: A New Ligustrazine Derivative-Selective Cytotoxicity by Suppression of NF-kB/p65 and COX-2 expression on human hepatoma cells. Part 3. Int J Mol Sci. 16:16401–16413. 2015. View Article : Google Scholar : PubMed/NCBI

46 

Breinig M, Schirmacher P and Kern MA: Cyclooxygenase-2 (COX-2)-a therapeutic target in liver cancer? Curr Pharm Des. 13:3305–3315. 2007. View Article : Google Scholar

47 

Tang TC, Poon RT, Lau CP, Xie D and Fan ST: Tumor cyclooxygenase-2 levels correlate with tumor invasiveness in human hepatocellular carcinoma. World J Gastroenterol. 11:1896–1902. 2005. View Article : Google Scholar : PubMed/NCBI

48 

Zhong B, Cai X, Chennamaneni S, Yi X, Liu L, Pink JJ, Dowlati A, Xu Y, Zhou A and Su B: From COX-2 inhibitor nimesulide to potent anti-cancer agent: Synthesis, in vitro, in vivo, and pharmacokinetic evaluation. Eur J Med Chem. 47:432–444. 2012. View Article : Google Scholar

49 

Mazhar D, Gillmore R and Waxman J: COX and cancer. QJM. 98:711–718. 2005. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Wang HY, Yu HZ, Huang SM and Zheng YL: p53, Bcl-2 and cox-2 are involved in berberine hydrochloride-induced apoptosis of HeLa229 cells. Mol Med Rep 14: 3855-3861, 2016.
APA
Wang, H., Yu, H., Huang, S., & Zheng, Y. (2016). p53, Bcl-2 and cox-2 are involved in berberine hydrochloride-induced apoptosis of HeLa229 cells. Molecular Medicine Reports, 14, 3855-3861. https://doi.org/10.3892/mmr.2016.5696
MLA
Wang, H., Yu, H., Huang, S., Zheng, Y."p53, Bcl-2 and cox-2 are involved in berberine hydrochloride-induced apoptosis of HeLa229 cells". Molecular Medicine Reports 14.4 (2016): 3855-3861.
Chicago
Wang, H., Yu, H., Huang, S., Zheng, Y."p53, Bcl-2 and cox-2 are involved in berberine hydrochloride-induced apoptosis of HeLa229 cells". Molecular Medicine Reports 14, no. 4 (2016): 3855-3861. https://doi.org/10.3892/mmr.2016.5696
Copy and paste a formatted citation
x
Spandidos Publications style
Wang HY, Yu HZ, Huang SM and Zheng YL: p53, Bcl-2 and cox-2 are involved in berberine hydrochloride-induced apoptosis of HeLa229 cells. Mol Med Rep 14: 3855-3861, 2016.
APA
Wang, H., Yu, H., Huang, S., & Zheng, Y. (2016). p53, Bcl-2 and cox-2 are involved in berberine hydrochloride-induced apoptosis of HeLa229 cells. Molecular Medicine Reports, 14, 3855-3861. https://doi.org/10.3892/mmr.2016.5696
MLA
Wang, H., Yu, H., Huang, S., Zheng, Y."p53, Bcl-2 and cox-2 are involved in berberine hydrochloride-induced apoptosis of HeLa229 cells". Molecular Medicine Reports 14.4 (2016): 3855-3861.
Chicago
Wang, H., Yu, H., Huang, S., Zheng, Y."p53, Bcl-2 and cox-2 are involved in berberine hydrochloride-induced apoptosis of HeLa229 cells". Molecular Medicine Reports 14, no. 4 (2016): 3855-3861. https://doi.org/10.3892/mmr.2016.5696
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team