Open Access

Biological effects of bone marrow mesenchymal stem cells on hepatitis B virus in vitro

  • Authors:
    • Wei‑Ping Zheng
    • Bo‑Ya Zhang
    • Zhong‑Yang Shen
    • Ming‑Li Yin
    • Yi Cao
    • Hong‑Li Song
  • View Affiliations

  • Published online on: March 15, 2017     https://doi.org/10.3892/mmr.2017.6330
  • Pages: 2551-2559
  • Copyright: © Zheng et al. This is an open access article distributed under the terms of Creative Commons Attribution License.

Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )


Abstract

The aim of the present study was to explore the effects of co‑culturing bone marrow‑derived mesenchymal stem cells (BM-MSCs) cultured with hepatitis B virus (HBV)‑infected lymphocytes in vitro. BM‑MSCs and lymphocytes from Brown Norway rats were obtained from the bone marrow and spleen, respectively. Rats were divided into the following five experimental groups: Group 1, splenic lymphocytes (SLCs); group 2, HepG2.2.15 cells; group 3, BM‑MSCs + HepG2.2.15 cells; group 4, SLCs + HepG2.2.15 cells; and group 5, SLCs + BM‑MSCs + HepG2.2.15 cells. The viability of lymphocytes and HepG2.2.15 cells was assessed using the MTT assay at 24, 48 and 72 h, respectively. Levels of supernatant HBV DNA and intracellular HBV covalently closed circular DNA (cccDNA) were measured using quantitative polymerase chain reaction. Supernatant cytokine levels were measured by enzyme‑linked immunosorbent assay (ELISA). T cell subsets were quantified by flow cytometry using fluorescence‑labeled antibodies. In addition, the HBV genome sequence was analyzed by direct gene sequencing. Levels of HBV DNA and cccDNA in group 5 were lower when compared with those in group 3 or group 4, with a significant difference observed at 48 h. The secretion of interferon‑γ was negatively correlated with the level of HBV DNA, whereas secretion of interleukin (IL)‑10 and IL‑22 were positively correlated with the level of HBV DNA. Flow cytometry demonstrated that the percentage of CD3+CD8+ T cells was positively correlated with the levels of HBV DNA, and the CD3+CD4+/CD3+CD8+ ratio was negatively correlated with the level of HBV DNA. Almost no mutations in the HBV DNA sequence were detected in HepG2.2.15 cells co‑cultured with BM‑MSCs, SLCs, or in the two types of cells combined. BM‑MSCs inhibited the expression of HBV DNA and enhanced the clearance of HBV, which may have been mediated by the regulation of the Tc1/Tc2 cell balance and the mode of cytokine secretion to modulate cytokine expression.

Introduction

In China, the yearly mortality rate for end-stage liver disease is >300,000 patients (1). Of the >30 million patients with chronic liver disease in China, ~80% are infected with the hepatitis B virus (HBV) (2). The most effective treatment for HBV-associated end-stage liver disease is liver transplantation. However, without effective prophylaxis, the risk of HBV re-infection following transplantation may reach >80% (3,4). The current treatment protocol of nucleos(t)ide analogues combined with hepatitis B immunoglobulin (HBIG) following liver transplantation, greatly reduces the hepatitis B recurrence rate (2,5,6). However, the high cost remains a heavy burden for patients (7,8), and the long-term use of nucleos(t)ide analogues may lead to HBV resistance (9,10). Application of the HBV vaccine following liver transplantation may potentially lead to the withdrawal of nucleoside analogues and HBIG therapy, however the vaccine is less effective due to the use of immunosuppressants following transplantation (11,12). Therefore, it is important to identify novel methods to prevent hepatitis B recurrence following liver transplantation.

Bone marrow-derived mesenchymal stem cells (BM-MSCs) have demonstrated anti-inflammatory (13,14) and angiogenesis-enhancing effects (15,16) with low immunogenicity (17,18). In addition, BM-MSCs exhibit immunomodulatory capabilities in animal models of rejection following transplantation (1921), which may represent a promising method for inducing immune tolerance. Transfusions of umbilical cord-derived MSCs for patients with HBV-associated acute-on-chronic liver failure resulted in improved liver function and alleviated liver damage (22). However, the biological effects of BM-MSCs on HBV have not yet been reported. In the present study, the effect of BM-MSCs on HBV replication and genome mutation in vitro was investigated, as well as its associated mechanisms. The results of the current study may provide innovative strategies for the prevention of hepatitis B recurrence following liver transplantation.

Materials and methods

Animals and cell lines

A total of 12 specific pathogen-free Brown Norway (BN) male rats (age, 4–5 weeks; body weight, 200–220 g) were used for the isolation and identification of BM-MSCs. Inbred male BN rats were kept 2 rats per cage at 24°C, with 50% humidity and a 12 h light and dark cycle, with free access to water and food. An additional 6 specific pathogen-free BN male rats (age, 4–5 weeks; body weight, 200–220 g) were used for the extraction of splenic lymphocytes (SLCs), and were kept under the same conditions as described above. All animals were purchased from the Chinese Academy of Military Medical Sciences (Beijing, China). The use of animals and the animal experimental procedures employed for the purposes of this study were approved by the Ethics Committee of Tianjin First Central Hospital (Tianjin, China). The human hepatocellular carcinoma cell line HepG2.2.15 was donated by Professor Wei Lai (Hepatology Institute of Peking University Affiliated Hospital, Beijing, China), and contained the complete HBV genome, as well as expressed HBV-associated antigens and secreted whole Dane particles (23,24).

Instruments and reagents

The following instruments and reagents were used: Dulbecco's modified Eagle's medium (DMEM) and DMEM/F12 media (1:1; Hyclone, Logan, UT, USA), G418 (Gibco; Thermo Fisher Scientific, Inc., Waltham, MA, USA), fetal bovine serum (FBS; Biowest, Nuaille, France), transwell plates (Corning, Inc., Corning, NY, USA), MTT reagent (Beijing Dingguo Changsheng Biotechnology, Co., Ltd., Beijing, China), dimethyl sulfoxide (DMSO; Amresco, Solon, OH, USA), lymphocyte separation medium (Beijing Dingguo Changsheng Biotechnology, Co., Ltd.), TRIzol (Invitrogen; Thermo Fisher Scientific, Inc.), antibodies directed against CD29 (cat. no. 102207), CD90 (cat. no. 202503), RT1A (cat. no. 205208), CD45 (cat. no. 202207) and RT1B (cat. no. 205305) for the identification of BM-MSCs (Biolegend, Inc., San Diego, CA, USA), CD34 (cat. no. sc-7324; Santa Cruz Biotechnology, Inc., Dallas, TX, USA), CD3-APC mAb (cat. no. 11-0040-82), CD8a-PE-Cy7 (cat. no. 12-0084-82), and CD4-FITC mAb (cat. no. 11-0040-82; eBiosciences, Inc., San Diego, CA, USA), a cell genomic DNA extraction kit (Beijing Kangwei Century Biotech Co. Ltd., Beijing, China) and enzyme-linked immunosorbent assay (ELISA) kits for measuring IL-10 (cat. no. R1000), IL-22 (cat. no. M2200), and IFN-γ (cat. no. RIF00; R&D Systems, Inc., Minneapolis, MN, USA). Primer sequences used for quantitative polymerase chain reaction (PCR) assay analysis for the detection of HBV covalently closed circular DNA (cccDNA) were as follows: cccDNA, forward, 5′-GTGTGCACTTCGCTTCAC-3′, and reverse, 5′-GGGTCAATGTCCATGCC-3′ (designed by Shanghai Jikang Biotechnology Company, Co., Ltd., Shanghai, China). The TaqMan probe (5′-FAM-ATG TCC TAC TGT TCA AGC CTC CAA-BHQ-3′) was designed by Takara Bio, Inc. (Otsu, Japan). Instruments included the CO2 incubator (Sheldon Manufacturing, Inc., Cornelius, OR, USA), an inverted fluorescence microscope (Olympus Corporation, Tokyo, Japan), the FACSCalibur flow cytometer (BD Biosciences), the ABI PRISM® 3700 DNA Analyzer and the fluorescence-based 7500 Fast Real-Time PCR system (Applied Biosystems™; Thermo Fisher Scientific, Inc.), the automatic fluorescence quantitative flow cytometer (PerkinElmer, Inc., Waltham, MA, USA), and the RT-6000 automatic microplate reader (Omega Bio-Tek, Inc., Norcross, GA, USA). Serum levels of alanine transaminase (ALT) and aspartate aminotransferase (AST) were determined using a 7180 clinical chemistry analyzer (Hitachi High-Technologies Corporation, Tokyo, Japan).

Isolation and identification of BM-MSCs

BM-MSCs were aseptically isolated from the femur and tibia of 12 male BN rats. Red blood cells were lysed using 0.1 mol/l NH4Cl, and the remaining cells were washed, resuspended and cultured in DMEM/F12 (1:1) media containing 100 U/ml penicillin, 100 mg/ml streptomycin (Gibco; Thermo Fisher Scientific, Inc.), and 15% FBS. BM-MSCs were cultured in an incubator at 37°C and 5% CO2 with saturating humidity. The medium was refreshed every 48 h. When cells at passage 3 had reached 80% confluence, cells were trypsinized, washed, centrifuged at 300 × g for 5 min at room temperature, and resuspended at 1×107 cells/ml in phosphate-buffered saline (PBS). BM-MSCs (100 µl) were incubated with the following fluorescence-labeled antibodies at 4°C for 30 min in the dark: CD29-PE (1:80), CD34-FITC (1:20), CD45-PE (1:80), CD90-FITC (1:200), RT1A-PE (1:80) and RT1B-FITC (1:200). Cells were then washed with PBS and analyzed by flow cytometry (FACSCalibur; BD Biosciences) to determine the phenotype and purity of BM-MSCs.

Harvesting of rat SLCs

Spleens of 6 rats were extracted following sacrifice by cervical dislocation under aseptic conditions, disassociated by grinding, and then filtered through a 200-µm nylon mesh. Cell suspensions were transferred to a centrifuge tube containing Percoll lymphocyte separation medium (1.083 g/ml; Beijing Dingguo Changsheng Biotechnology, Co., Ltd., Beijing, China). Following centrifugation at 670 × g for 20 min at room temperature, the white middle layer was extracted and centrifuged at 330 × g for 8 min at room temperature, before the supernatant was discarded. After washing with PBS, the lymphocytes were counted and cultured in RPIM 1640 media (Gibco; Thermo Fisher Scientific, Inc.) containing 100 U/ml penicillin, 100 mg/ml streptomycin, 1 mmol/l glutamine, and 10% FBS (5×105 cells/ml).

HepG2.2.15 cell culture

HepG2.2.15 cells were cultured in high glucose-DMEM (Hyclone; GE Healthcare Life Sciences), which contained 10% heat-inactivated FBS, 200 mg/l G418, 6 mmol/l glutamine, 100 U/ml penicillin and 100 mg/l streptomycin, in an incubator at 37°C and 5% CO2 with saturating humidity. The medium was refreshed every 48 h, and healthy cells were selected for downstream experiments.

Co-culture of different cell types

The following experimental groups were studied: Group 1, SLCs; group 2, HepG2.2.15 cells; group 3, BM-MSCs + HepG2.2.15 cells; group 4, SLCs + HepG2.2.15 cells; and group 5, SLCs + BM-MSCs + HepG2.2.15 cells. HepG2.2.15 cells were plated in the lower chamber of a 6-well transwell dish (pore size, 0.4 µm; Corning, Incorporated) at 1×105 cells/well, and SLCs and BM-MSCs were inoculated in the upper chamber of the transwell plate at 5×105 cells/well. Plates were cultured at 37°C and 5% CO2 with saturating humidity in an incubator for 24, 48 or 72 h. Each group was plated in triplicate wells for each time point. At each time point, supernatants and cells were collected for further analysis.

MTT cell viability assay

Cell suspensions (200 µl) from each experimental group were added to each well of a 96-well plate (SLCs, 2×104 cells/well; BM-MSCs, 2×104 cells/well; HepG2.2.15 cells, 4×103 cells/well), which was incubated at 37°C with 5% CO2. Cells were cultured for 24, 48 or 72 h. MTT solution (15 µl at 5 g/l) was added to each well and incubated for 3 h. The medium was subsequently aspirated and DMSO (100 µl) was added to each well before the plates were placed on a shaker for 10 min to fully dissolve the formazan crystals. The absorbance (A) at 490 nm was measured using an automated microplate reader, and the cell survival rate was calculated using the following formula: Survival rate = (Atest well-Ablank well) / (Acontrol well-Ablank well) ×100%.

Detection of supernatant HBV DNA and intracellular cccDNA of HepG2.2.15 cells and BM-MSCs

The supernatant HBV DNA levels were measured using a real-time PCR kit according to the manufacturer's instructions (Shanghai Kehua Bioengineering Co., Ltd.), using an ABI 7500 Real-Time PCR system. Genomic DNA was extracted from HepG2.2.15 cells (2×106 cells) or BM-MSCs (5×106 cells) using a UniversalGen DNA kit (CWBio, Co., Ltd., Beijing, China), and 2 µg HBV DNA or cccDNA was subjected to quantitative PCR analysis using an optimized quantitative PCR method described previously (25).

HBV genomic DNA extraction and sequencing analysis

HBV genomic DNA was extracted from the supernatants of co-cultured HepG2.2.15 cells using a Viral DNA Isolation kit (DAAN Gene, Co., Ltd., of Sun Yat-sen University, Guangzhou, China) according to the manufacturer's instructions. Briefly, cell supernatants were added to virus lysis buffer, and lysates were loaded onto a spin column. After viral DNA was bound to the membrane, each column was washed and the viral DNA was eluted.

PCR was performed using HBV genomic DNA as a template to amplify the P, S, X and C regions using the primer sequences listed in Table I. The PCR conditions were as follows: Initial denaturation at 94°C for 2 min, followed by 35 cycles of 94°C for 30 sec, 55°C for 30 sec, 72°C for 1 min and a final extension at 72°C for 10 min. PCR products were resolved by 2% agarose gel electrophoresis, and the bands were visualized under ultraviolet light following ethidium bromide staining. The DNA was recovered from the agarose gel using a MiniBEST Agarose Gel DNA Extraction kit (Takara Bio, Inc.) according to the manufacturer's protocol, and the amplified DNA was subjected to sequencing analysis by Sangon Biotech (Shanghai, China).

Table I.

Sequences of the primers used for polymerase chain reaction in the present study.

Table I.

Sequences of the primers used for polymerase chain reaction in the present study.

Primer nameSequence (5′-3′)Length (bp)
HBV-F1 GGGTCACCATATTCTTGGGAAC22
HBV-R1 ATTGAGAGAAGTCCACCACGAGT23
HBV-F2 TAGGACCCCTGCTCGTGTTACAG18
HBV-R2 GAACCACTGAACAAATGGCACTAG24
HBV-F3 GAACCTCTATGTTTCCCTCT20
HBV-R3 TGCGTCAGCAAACACTT17
HBV-F4 CCTATTGATTGGAAAGTATG20
HBV-R4 ATGAGAAGGCACAGACG17
HBV-F5 CCGATCCATACTGCGGAACTCC22
HBV-R5 GCTTGGAGGCTTGAACAGTAGGACA25
HBV-F6 TACTAGGAGGCTGTAGGCATAA22
HBV-R6 GTGTTGATAAGATAGGGGCATTT23
HBV-F7 GGTGTCTTTTGGAGTGTGGA20
HBV-R7 TTGTTCCCAAGAATATGGTGA21
HBV-F8 AGAACTCCCTCGCCTCG17
HBV-R8 TTGAAGTCCCAATCTGGATT20

[i] HBV, hepatitis B virus; F, forward; R, reverse.

Detection of lymphocyte surface markers CD4 and CD8 in the CD3+ cell by flow cytometry

SLCs were harvested and centrifuged at 300 × g for 5 min at 4°C following culture for 24, 48 or 72 h. Then SLCs (1×106 cells) were resuspended in 100 µl PBS for detection, and the fluorescence-labeled antibodies anti-CD3-APC (1:80), anti-CD4-FITC (1:200), and anti-CD8a-PE-Cy7 (1:160) were added for incubation at 4°C for 30 min in the dark, to detect the expression intensity of each cell surface marker by flow cytometry.

Detection of supernatant cytokines

Concentrations of IFN-γ, IL-10, and IL-22 in the cell supernatants were determined using an ELISA kit (R&D Systems, Inc.) according to the manufacturer's protocol. The absorbance at 450 nm was measured using an automated microplate reader.

Statistical analysis. SPSS 17.0 (SPSS, Inc., Chicago, IL, USA) was used for statistical analysis

Normally distributed data were presented as the mean ± standard deviation. Additional data sets were compared by analysis of variance, and Dunnett's method was used when the variance was not homogenous. Linear correlation analysis was used to test the interdependence of the variables. P<0.05 was considered to indicate a statistically significant difference. GraphPad Prism 5.0 software (GraphPad Software, Inc., La Jolla, CA, USA) was used to plot data for presentation.

Results

Morphology and phenotypic analysis of HepG2.2.15 cells and BM-MSCs

HepG2.2.15 cells were confirmed to be plastic-adherent cells with a spindle-shaped morphology (Fig. 1A). Rat BM-MSCs were successfully established in culture and proliferated in vitro. Morphological and phenotypic examination revealed that BM-MSCs were confirmed to be plastic-adherent cells with a spindle-shaped morphology under standard culture conditions, as determined by microscopy, and some of the cells exhibited a whirlpool or chrysanthemum pattern (Fig. 1B). BM-MSCs were incubated with antibodies against CD29, CD90, RT1A, CD34, RT1B and CD45, and were analyzed by flow cytometry. Phenotypic examination of BM-MSCs at passage 3 demonstrated that 97.0% of cells expressed CD29, 96.3% of cells expressed CD90, and 96.3% of cells expressed RT1A (Fig. 1C-E). By contrast, >95% of BM-MSCs were negative for CD34, CD45 and RT1B (Fig. 1C-E), which was in accordance with the results of a previous study (26).

Detection of liver enzymes in supernatants

When co-cultured with xenogeneic SLCs or BM-MSCs, no significant difference in liver enzyme levels in HepG2.2.15 cell supernatants was observed (Table II). This suggested that neither BM-MSCs nor SLCs induced rejection of the human hepatocellular carcinoma cell line, HepG2.2.15.

Table II.

Supernatant ALT and AST levels in different groups at different time points.

Table II.

Supernatant ALT and AST levels in different groups at different time points.

24 h48 h72 h



GroupALT (IU/l)AST (IU/l)ALT (IU/l)AST (IU/l)ALT (IU/l)AST (IU/l)
HepG2.2.151.17±0.419.53±1.631.50±0.3813.25±2.651.47±0.2719.82±1.64
BM-MSCs+HepG2.2.151.20±0.3611.30±0.401.40±0.3315.65±1.021.77±0.5923.12±2.22
SLCs+HepG2.2.151.45±0.3711.02±2.951.72±0.2017.62±3.261.83±0.4323.42±3.49
SLCs+BM-MSCs+HepG2.2.151.17±0.4011.70±3.371.43±0.1415.93±0.681.73±0.1921.27±0.74
P-value0.4420.0990.8620.4470.0560.145

[i] All values are presented as the mean ± standard deviation (n=3). ALT, alanine transaminase; AST, aspartate transaminase; BM-MSC, bone marrow-derived mesenchymal stem cells; SLC, splenic lymphocytes; IU, intentional unit.

Effects of BM-MSCs on the activity of SLCs and HepG2.2.15 cells

The viability of SLCs in group 5 was significantly lower when compared with that of group 4 at each time point (24 h, P<0.05; 48 h, P<0.01; 72 h, P<0.01; Fig. 2A), which suggested that BM-MSCs may reduce the viability of SLCs.

The viability of adherent cells in group 3 was significantly lower when compared to that of groups 2 at 48 and 72 h, respectively (P<0.01 at 48 and 72 h; Fig. 2B). These results suggested that BM-MSCs may inhibit the viability of HepG2.2.15 cells. In contrast, the viability of adherent cells in group 5 was significantly higher when compared to that of groups 3 at 24, 48 and 72 h, respectively (P<0.01 at 24, 48 and 72 h; Fig. 2B). These results suggested that BM-MSCs exhibited stimulatory effects on HepG2.2.15 cell viability when co-cultured with SLCs.

Effects of BM-MSCs on the supernatant levels of HBV DNA in HepG2.2.15 cells

The quantity of supernatant HBV DNA in group 5 was significantly lower when compared to that of groups 2, 3 and 4 at 24, 48 and 72 h, respectively (Fig. 3A).

When co-cultured with BM-MSCs and SLCs (group 5), the intracellular quantity of HBV cccDNA in HepG2.2.15 cells was lower than that of groups 2 and 4 at 24 h, however this did not reach statistical significance. The intracellular quantity of HBV cccDNA in group 5 was statistically higher than that of group 2 at 72 h (P<0.01; Fig. 3B). The intracellular quantity HBV cccDNA in group 5 was significantly lower than that of groups 2, 3 and 4 at 48 h (Fig. 3B). These findings suggested that BM-MSCs and SLCs may inhibit HBV replication in HepG2.2.15 cells, and that the inhibitory effect was more significant when HepG2.2.15 cells were co-cultured with BM-MSCs and SLCs.

Detection of intracellular HBV cccDNA in BM-MSCs

No intracellular HBV cccDNA was detected in the BM-MSCs in any of the groups (data not shown), which suggested that BM-MSCs co-cultured with HepG2.2.15 cells were not be infected by HBV.

HBV gene sequencing

No mutations in the C or X regions of the HBV genome were detected in HepG2.2.15 cells co-cultured with BM-MSCs, SLCs, or both types of cells (Table III). However, a T45 N mutation in the S region, and an rtR192S mutation in the P region was identified in the supernatants of BM-MSCs + HepG2.2.15 and SLCs + HepC2.2.15 groups, respectively (Table III).

Table III.

Effect of BM-MSCs and SLCs on the HBV gene sequence.

Table III.

Effect of BM-MSCs and SLCs on the HBV gene sequence.

HBV gene sequence

GroupMutation in C regionMutation in X regionMutation in S regionMutation in P region
HepG2.2.15No mutationNo mutationNo mutationNo mutation
BM-MSCs+HepG2.2.15No mutationNo mutationT45NNo mutation
SLCs+HepG2.2.15No mutationNo mutationNo mutationrtR192S
SLCs+BM-MSCs+HepG2.2.15No mutationNo mutationNo mutationNo mutation

[i] BM-MSCS, bone marrow-derived mesenchymal stem cells; SLCs, splenic lymphocytes; HBV, hepatitis B virus.

Effect of BM-MSCs on lymphocyte subsets

Detection of lymphocyte surface markers by flow cytometry revealed that the percentage of CD3+CD4+ cells in group 5 was higher than that of group 4 at 24 and 72 h, but was lower at 48 h. These differences did not reach statistical significance (Fig. 4A).

The percentage of CD3+CD8+ cells in group 5 was significantly lower than that of group 4 at all time points (24 h, P<0.01; 48 h, P<0.05; 72 h, P<0.05; Fig. 4B). When compared with group 4, the CD3+CD4+/CD3+CD8+ ratio in group 5 significantly increased at 24 and 48 h (P<0.01 and P<0.05, respectively; Fig. 4C), but no significant difference was observed at 72 h. The percentage of CD3+CD8+ cells was positively correlated with HBV DNA levels when co-cultured with BM-MSCs (24 h, r=0.865; 48 h, r=0.766; 72 h, r=0.912; P<0.05).

Effect of BM-MSCs on cytokine levels in co-cultured SLCs and HepG2.2.15 cell supernatants

The supernatant concentrations of IFN-γ in group 5 were higher than those of groups 3 and 4 at 24, 48 and 72 h (Table IV). By contrast, IL-10 and IL-22 levels in group 5 were lower than those of group 3 and group 4 at 24, 48 and 72 h (Table IV). IFN-γ secretion levels were negatively correlated with HBV DNA levels (24 h, r=−0.900, 48 h, r=−0.982; 72 h, r=−0.968; P<0.05), whereas IL-10 and IL-22 secretion levels were positively correlated with HBV DNA levels (IL-10, 24 h, r=0.860; 48 h, r=0.972; P<0.05; IL-22, 48 h, r=0.858; 72 h, r=0.742; P<0.05). In group 5, the supernatant IFN-γ levels at 48 h were significantly higher than those at 72 h, and the supernatant levels of IL-10 at 48 h were significantly lower than those detected at 24 and 72 h (Table IV). These findings suggested that alterations in IFN-γ and IL-10 levels were most evident at 48 h within the same group.

Table IV.

Cytokine levels in cell culture supernatants.

Table IV.

Cytokine levels in cell culture supernatants.

CytokineGroup24 h (pg/µl)48 h (pg/µl)72 h (pg/µl)
IFN-γSLCs 848.557±11.409aa 468.347±20.523aa 528.111±15.640aa
BM-MSCs+HepG2.2.15 636.650±47.047aa 460.953±38.345aa 603.735±26.848a
SLCs+HepG2.2.15 675.637±19.046aa 621.237±24.709aa 517.170±31.331aa
SLCs+BM-MSCs+HepG2.2.15735.030±18.646780.463±19.879 676.317±34.414bb
IL-10SLCs 803.930±55.897aa 297.040±32.246aa 183.367±46.742aa
BM-MSCs+HepG2.2.15 240.747±28.605aa 206.609±13.669a 259.580±30.070aa
SLCs+HepG2.2.15 511.553±37.490a 413.360±14.133aa 553.133±54.416a
SLCs+BM-MSCs+HepG2.2.15 420.227±23.235bb153.087±26.016 447.230±31.192bb
IL-22SLCs 344.423±36.904aa 180.337±4.672aa164.537±35.654
BM-MSCs+HepG2.2.15 183.135±18.123a 166.264±23.206aa164.722±12.389
SLCs+HepG2.2.15166.337±18.651 258.923±23.426aa 305.053±14.766aa
SLCs+BM-MSCs+HepG2.2.15 146.007±20.407bb208.537±6.499210.857±22.527

{ label (or @symbol) needed for fn[@id='tfn4-mmr-15-05-2551'] } Data are presented as the mean ± standard deviation (n=3).

a P<0.05

aa P<0.01, vs. SLCs + BM-MSCs + HepG2.2.15.

b P<0.05

bb P<0.01, vs. the same group at 48 h. IFN-γ, interferon-γ; IL, interleukin; SLCs, splenic lymphocytes; BM-MSCs, bone marrow-derived mesenchymal stem cells.

Discussion

Liver-derived MSCs have been demonstrated to be crucial for the repair of damaged hepatocytes and liver regeneration (2729). Oh et al (30) confirmed that BM-MSCs are potential sources of hepatic oval cells. When the liver is severely damaged, BM-MSCs differentiate into hepatic progenitor-like cells and mediate repair of the liver (3133). The present study aimed to explore the effects of BM-MSCs on hepatocytes infected with HBV. Previous studies have demonstrated that human MSCs survive and exhibit protective effects on neurological and lung injuries following transplantation into rats (3436). However, they may also stimulate an allogeneic immune response to increase lymphocyte proliferation in the host (37,38). Therefore, with the lack of stable rat cell lines transfected with HBV, and the strict ethical limits to acquire human stem cells, a xenotransplantation model was employed in the present study.

The preliminary findings demonstrated that when co-cultured with BM-MSCs, the proliferation of HepG2.2.15 cells was inhibited and HBV DNA levels were decreased. When BM-MSCs were co-cultured with SLCs, HBV DNA levels were markedly reduced. Meanwhile, BM-MSCs induced very few HBV genome sequence mutations and did not cause rejection between xenogeneic cells. To the best of our knowledge the T45N mutation in the S region, and the rtR192S mutation in the P region, are not known to be significant in the clinical treatment of hepatitis B. In addition, the preliminary results of the present study suggested that BM-MSCs may inhibit the replication of HBV cccDNA in vitro. It is possible that BM-MSCs may suppress the proliferation of co-cultured T cells in vitro, thereby inhibiting immune responses to induce immune tolerance (3941). Alternatively, BM-MSCs may secrete cytokines, including fibroblast growth factor (42,43), epidermal growth factor (EGF) (44), and hepatocyte growth factor (HGF) (43,45,46) to inhibit HBV replication (47). In addition, intracellular HBV cccDNA in BM-MSCs co-cultured with HepG2.2.15 cells was not detected, which supports the conclusion that HBV is unable to replicate in BM-MSCs (48,49).

BM-MSCs are a cell type that exert immunomodulatory activities (1921). They inhibit the proliferation and activation of T cells and exhibit immunomodulatory functions mediated by soluble factors (39,41). Prostaglandin E2 (PGE2) and indoleamine dioxygenase were observed to be potentially involved in the immunomodulatory function of BM-MSCs (50). The majority of T lymphocytes can be divided into CD4+ T cells and CD8+ T cells, and the majority of CD8+ T cells are cytotoxic T lymphocytes (CTL). T cell function is exhausted during chronic HBV infection, and CTLs cannot effectively eliminate the virus. As a result, the virus persists and the proportion of T cell subsets in the peripheral blood is subsequently altered (5153). The findings of the present study suggested that the percentage of CD8+ cells was positively correlated with HBV DNA levels, which is consistent with a previous study demonstrating that an imbalance of T cell subsets was closely associated with HBV DNA levels (54,55). The CD4+/CD8+ ratio increased at 24 and 48 h, and then decreased at 72 h. Furthermore, the reduction in the levels of intracellular HBV cccDNA was the most significant at 48 h, which suggested that the increased CD4+/CD8+ ratio was correlated with inhibitory effects on HBV cccDNA replication. To further confirm these results, the levels of cytokines were measured.

MSCs clearly inhibit the proliferation of allogeneic lymphocytes, and immunosuppression is mediated by CD8+ regulatory cells (56). CD8+ cells are divided into the Tc1 and Tc2 subtypes, and control of the Tc1/Tc2 cell ratio is necessary to maintain normal immune function (57,58). Therefore, IFN-γ and IL-10 cytokine levels were ascertained in the present study, as they are secreted by Tc1 and Tc2 cells, respectively. The results demonstrated that BM-MSCs may influence the expression of IFN-γ and IL-10 by inhibiting CD8+ T cells, as well as inhibit the replication and reduce the levels of HBV DNA.

BM-MSCs secrete various cytokines that affect the function of hematopoietic cells, and release a number of neurotrophic factors, including nerve growth factor, EGF, ciliary neurotrophic factor and IFN-γ (59). The IFN-γ cytokine induces BM-MSCs to constitutively express increased levels of immunosuppressive cytokines, such as PGE2, HGF, and transforming growth factor (TGF)-β1 (60). Thus, the cytokine expression results obtained in the current study indicate that BM-MSCs may secrete cytokines that affect HBV. However, testing this hypothesis will require further study.

IL-22 was first discovered in the year 2000 (61). As it demonstrates 22% amino acid sequence similarity with IL-10, it was classified as an IL-10 family member (61). However, whether IL-22 exhibits anti- or pro-inflammatory effects on HBV infection remains controversial. Previous studies have demonstrated that intra-hepatic expression of IL-22 was increased in patients with acute and chronic hepatitis B (62). When infected with the virus, T cells mediate antiviral immunity, and cause inflammatory injury to the liver. Meanwhile, inflammation and injury leads to compensatory increases in levels of cytokines (e.g. IL-22) that may protect hepatocytes from inflammation and repair liver damage (63). The results of the present study indicated that IL-22 and IL-10 secretion were reduced significantly when SLCs were co-cultured with BM-MSCs, which suggested that IL-22 exerted anti-inflammatory effects in HBV infection.

HBV-associated end-stage liver disease poses a serious threat to human health, and liver transplantation is currently the only effective treatment. BM-MSC transplantation has been proposed as a novel strategy for the treatment of HBV, and may represent a new method for prophylaxis and the treatment of HBV re-infection following liver transplantation. In addition, studies of the effects of BM-MSCs on HBV cccDNA levels may provide novel strategies to screen for preventative treatments against HBV re-infection. Although HBV does not affect the phenotype or differentiation ability of BM-MSCs, it has been demonstrated to inhibit the proliferation of BM-MSCs in vitro (64). Therefore, a number of issues require further investigation before BM-MSCs may be used as a clinical treatment option, and will be a focus of future research.

Acknowledgements

The present study was supported by the National Natural Science Foundation of China (grant nos. 81270528, 81170444, 81441022 and 81670574) and the Natural Science Foundation of Tianjin (grant nos. 08JCYBJC08400, 11JCZDJC27800 and 12JCZDJC25200), and the Technology Foundation of Health Bureau in Tianjin (grant nos. 2011KY11 and 10KG101).

Glossary

Abbreviations

Abbreviations:

BM-MSCs

bone marrow-derived mesenchymal stem cells

SLCs

splenic lymphocytes

HBV

Hepatitis B virus

BN

Brown Norway

UC-MSCs

umbilical cord-derived mesenchymal stem cells

DMEM

Dulbecco's modified Eagle's medium

MTT

methylthiazolyl tetrazolium

EGF

epidermal growth factor

HGF

hepatocyte growth factor

References

1 

Zhuang H: Current status and goals of hepatitis B prevention and treatment. Zhonghua Nei Ke Za Zhi. 47:793–795. 2008.(In Chinese). PubMed/NCBI

2 

Shen Zhong-Yang, Zhu Zhi-Jun, Deng Yong-Lin, Sun Liying, Qu Wei, Rao Wei, Sun Xiao-Ye, Zheng Hong, Pan Cheng and Liu Yi-He: Combination of low-dose HBIg and Nucleoside analogues to prevent recurrent hepatitis B virus after liver transplantation: A retrospective analysis of 1506 cases. Chinese J Hepatobiliary Surg. 17:364–366. 2011.

3 

Avolio AW, Nure E, Pompili M, Barbarino R, Basso M, Caccamo L, Magalini S, Agnes S and Castagneto M: Liver transplantation for hepatitis B virus patients: Long-term results of three therapeutic approaches. Transplant Proc. 40:1961–1964. 2008. View Article : Google Scholar : PubMed/NCBI

4 

Samuel D, Feray C and Bismuth H: Hepatitis viruses and liver transplantation. J Gastroenterol Hepatol. 12:(Suppl). S335–S341. 1997. View Article : Google Scholar : PubMed/NCBI

5 

Campsen J, Zimmerman M, Trotter J, Hong J, Freise C, Brown R, Cameron A, Ghobrial M, Kam I, Busuttil R, et al: Liver transplantation for hepatitis B liver disease and concomitant hepatocellular carcinoma in the United States with hepatitis B immunoglobulin and nucleoside/nucleotide analogues. Liver Transpl. 19:1020–1029. 2013. View Article : Google Scholar : PubMed/NCBI

6 

Cholongitas E, Goulis J, Akriviadis E and Papatheodoridis GV: Hepatitis B immunoglobulin and/or nucleos(t)ide analogues for prophylaxis against hepatitis b virus recurrence after liver transplantation: A systematic review. Liver Transpl. 17:1176–1190. 2011. View Article : Google Scholar : PubMed/NCBI

7 

Ishigami M, Onishi Y, Ito T, Katano Y, Ito A, Hirooka Y, Kiuchi T and Goto H: Anti-hepatitis B surface immunoglobulin reduction in early postoperative period after liver transplantation in hepatitis B virus-positive patients. Hepatol Res. 41:1189–1198. 2011. View Article : Google Scholar : PubMed/NCBI

8 

Saab S, Ham MY, Stone MA, Holt C and Tong M: Decision analysis model for hepatitis B prophylaxis one year after liver transplantation. Liver Transpl. 15:413–420. 2009. View Article : Google Scholar : PubMed/NCBI

9 

Shen ZY, Zheng WP, Deng YL and Song HL: Variations in the S and P regions of the hepatitis B virus genome under immunosuppression in vitro and in vivo. Viral Immunol. 25:368–378. 2012. View Article : Google Scholar : PubMed/NCBI

10 

Limquiaco JL, Wong J, Wong VW, Wong GL, Tse CH, Chan HY, Kwan KY, Lai PB and Chan HL: Lamivudine monoprophylaxis and adefovir salvage for liver transplantation in chronic hepatitis B: A seven-year follow-up study. J Med Virol. 81:224–229. 2009. View Article : Google Scholar : PubMed/NCBI

11 

Rosenau J, Hooman N, Hadem J, Rifai K, Bahr MJ, Philipp G, Tillmann HL, Klempnauer J, Strassburg CP and Manns MP: Failure of hepatitis B vaccination with conventional HbsAg vaccine in patients with continuous HBIG prophylaxis after liver transplantation. Liver Transpl. 13:367–373. 2007. View Article : Google Scholar : PubMed/NCBI

12 

Wursthorn K, Wedemeyer H and Manns MP: Managing HBV in patients with impaired immunity. Gut. 59:1430–1445. 2010. View Article : Google Scholar : PubMed/NCBI

13 

Han D, Wu C, Xiong Q, Zhou L and Tian Y: Anti-inflammatory mechanism of bone marrow mesenchymal stem cell transplantation in rat model of spinal cord injury. Cell Biochem Biophys. 71:1341–1347. 2015. View Article : Google Scholar : PubMed/NCBI

14 

Shen ZY, Zhang J, Song HL and Zheng WP: Bone-marrow mesenchymal stem cells reduce rat intestinal ischemia-reperfusion injury, ZO-1 downregulation and tight junction disruption via a TNF-α-regulated mechanism. World J Gastroenterol. 19:3583–3595. 2013. View Article : Google Scholar : PubMed/NCBI

15 

Mitkari B, Nitzsche F, Kerkelä E, Kuptsova K, Huttunen J, Nystedt J, Korhonen M and Jolkkonen J: Human bone marrow mesenchymal stem/stromal cells produce efficient localization in the brain and enhanced angiogenesis after intra-arterial delivery in rats with cerebral ischemia, but this is not translated to behavioral recovery. Behav Brain Res. 259:50–59. 2014. View Article : Google Scholar : PubMed/NCBI

16 

Santhakumar R, Vidyasekar P and Verma RS: Cardiogel: A nano-matrix scaffold with potential application in cardiac regeneration using mesenchymal stem cells. PLoS One. 9:e1146972014. View Article : Google Scholar : PubMed/NCBI

17 

Ball LM, Bernardo ME, Roelofs H, Lankester A, Cometa A, Egeler RM, Locatelli F and Fibbe WE: Cotransplantation of ex vivo expanded mesenchymal stem cells accelerates lymphocyte recovery and may reduce the risk of graft failure in haploidentical hematopoietic stem-cell transplantation. Blood. 110:2764–2767. 2007. View Article : Google Scholar : PubMed/NCBI

18 

Phinney DG and Prockop DJ: Concise review: Mesenchymal stem/multipotent stromal cells: The state of transdifferentiation and modes of tissue repair-current views. Stem Cells. 25:2896–2902. 2007. View Article : Google Scholar : PubMed/NCBI

19 

Zhang W, Shen ZY, Song HL, Yang Y, Wu BJ, Fu NN and Liu T: Protective effect of bone marrow mesenchymal stem cells in intestinal barrier permeability after heterotopic intestinal transplantation. World J Gastroenterol. 20:7442–7451. 2014. View Article : Google Scholar : PubMed/NCBI

20 

Perez-Basterrechea M, Obaya AJ, Meana A, Otero J and Esteban MM: Cooperation by fibroblasts and bone marrow-mesenchymal stem cells to improve pancreatic rat-to-mouse islet xenotransplantation. PLoS One. 8:e735262013. View Article : Google Scholar : PubMed/NCBI

21 

Roemeling-van Rhijn M, Khairoun M, Korevaar SS, Lievers E, Leuning DG, Ijzermans JN, Betjes MG, Genever PG, van Kooten C, de Fijter HJ, et al: Human bone marrow- and adipose tissue-derived mesenchymal stromal cells are immunosuppressive in vitro and in a humanized allograft rejection model. J Stem Cell Res Ther. (Suppl 6). S207802013.

22 

Shi M, Zhang Z, Xu R, Lin H, Fu J, Zou Z, Zhang A, Shi J, Chen L, Lv S, et al: Human mesenchymal stem cell transfusion is safe and improves liver function in acute-on-chronic liver failure patients. Stem Cells Transl Med. 1:725–731. 2012. View Article : Google Scholar : PubMed/NCBI

23 

Sells MA, Chen ML and Acs G: Production of hepatitis B virus particles in Hep G2 cells transfected with cloned hepatitis B virus DNA. Proc Natl Acad Sci USA. 84:1005–1009. 1987. View Article : Google Scholar : PubMed/NCBI

24 

Shen ZY, Zheng WP, Liu T, Yang Y and Song HL: Effects of dendritic cells from hepatitis B virus transgenic mice-stimulated autologous lymphocytes on hepatitis B virus replication: A study on the impact of specific sensitized effector cells on in vitro virus replication. Viral Immunol. 28:85–92. 2015. View Article : Google Scholar : PubMed/NCBI

25 

Gao YT, Han T, Li Y, Yang B, Wang YJ, Wang FM, Jing X and Du Z: Enhanced specificity of real-time PCR for measurement of hepatitis B virus cccDNA using restriction endonuclease and plasmid-safe ATP-dependent DNase and selective primers. J Virol Methods. 169:181–187. 2010. View Article : Google Scholar : PubMed/NCBI

26 

Harting M, Jimenez F, Pati S, Baumgartner J and Cox C Jr: Immunophenotype characterization of rat mesenchymal stromal cells. Cytotherapy. 10:243–253. 2008. View Article : Google Scholar : PubMed/NCBI

27 

Joshi MB, Patil P, He Z, Holgersson J, Olausson M and Sumitran-Holgersson S: Fetal liver-derived mesenchymal stromal cells augment engraftment of transplanted hepatocytes. Cytotherapy. 14:657–669. 2012. View Article : Google Scholar : PubMed/NCBI

28 

Fouraschen SM, Pan Q, de Ruiter PE, Farid WR, Kazemier G, Kwekkeboom J, Ijzermans JN, Metselaar HJ, Tilanus HW, de Jonge J and van der Laan LJ: Secreted factors of human liver-derived mesenchymal stem cells promote liver regeneration early after partial hepatectomy. Stem Cells Dev. 21:2410–2419. 2012. View Article : Google Scholar : PubMed/NCBI

29 

Fouraschen SM, Hall SR, de Jonge J and van der Laan LJ: Support of hepatic regeneration by trophic factors from liver-derived mesenchymal stromal/stem cells. Methods Mol Biol. 1213:89–104. 2014. View Article : Google Scholar : PubMed/NCBI

30 

Oh SH, Hatch HM and Petersen BE: Hepatic oval ‘stem’ cell in liver regeneration. Semin Cell Dev Biol. 13:405–409. 2002. View Article : Google Scholar : PubMed/NCBI

31 

Facciorusso A, Antonino M, Del Prete V, Neve V, Scavo MP and Barone M: Are hematopoietic stem cells involved in hepatocarcinogenesis? Hepatobiliary Surg Nutr. 3:199–206. 2014.PubMed/NCBI

32 

Lehwald N, Duhme C, Wildner M, Kuhn S, Fürst G, Forbes SJ, Jonas S, Robson SC, Knoefel WT, Schmelzle M and Schulte Am Esch J: HGF and SDF-1-mediated mobilization of CD133+ BMSC for hepatic regeneration following extensive liver resection. Liver Int. 34:89–101. 2014. View Article : Google Scholar : PubMed/NCBI

33 

Zocco MA, Piscaglia AC, Giuliante F, Arena V, Novi M, Rinninella E, Tortora A, Rumi C, Nuzzo G, Vecchio FM, et al: CD133+ stem cell mobilization after partial hepatectomy depends on resection extent and underlying disease. Dig Liver Dis. 43:147–154. 2011. View Article : Google Scholar : PubMed/NCBI

34 

Hosseini M, Moghadas M, Edalatmanesh MA and Hashemzadeh MR: Xenotransplantation of human adipose derived mesenchymal stem cells in a rodent model of Huntington's disease: Motor and non-motor outcomes. Neurol Res. 37:309–319. 2015. View Article : Google Scholar : PubMed/NCBI

35 

Gao F, Li Q, Hou L, Li Z, Min F and Liu Z: Mesenchymal stem cell-based angiotensin-converting enzyme 2 in treatment of acute lung injury rat induced by bleomycin. Exp Lung Res. 40:392–403. 2014. View Article : Google Scholar : PubMed/NCBI

36 

Khabbal J, Kerkelä E, Mitkari B, Raki M, Nystedt J, Mikkonen V, Bergström K, Laitinen S, Korhonen M and Jolkkonen J: Differential clearance of rat and human bone marrow-derived mesenchymal stem cells from the brain after intra-arterial infusion in rats. Cell Transplant. 24:819–828. 2015. View Article : Google Scholar : PubMed/NCBI

37 

Chuang CK, Lin KJ, Lin CY, Chang YH, Yen TC, Hwang SM, Sung LY, Chen HC and Hu YC: Xenotransplantation of human mesenchymal stem cells into immunocompetent rats for calvarial bone repair. Tissue Eng Part A. 16:479–488. 2010. View Article : Google Scholar : PubMed/NCBI

38 

Wang Y, Chen X, Armstrong MA and Li G: Survival of bone marrow-derived mesenchymal stem cells in a xenotransplantation model. J Orthop Res. 25:926–932. 2007. View Article : Google Scholar : PubMed/NCBI

39 

Jorgensen C, Djouad F, Apparailly F and Noël D: Engineering mesenchymal stem cells for immunotherapy. Gene Ther. 10:928–931. 2003. View Article : Google Scholar : PubMed/NCBI

40 

Kong QF, Sun B, Wang GY, Zhai DX, Mu LL, Wang DD, Wang JH, Li R and Li HL: BM stromal cells ameliorate experimental autoimmune myasthenia gravis by altering the balance of Th cells through the secretion of IDO. Eur J Immunol. 39:800–809. 2009. View Article : Google Scholar : PubMed/NCBI

41 

Wang Q, Sun B, Wang D, Ji Y, Kong Q, Wang G, Wang J, Zhao W, Jin L and Li H: Murine bone marrow mesenchymal stem cells cause mature dendritic cells to promote T-cell tolerance. Scand J Immunol. 68:607–615. 2008. View Article : Google Scholar : PubMed/NCBI

42 

Liu Y, Ming L, Luo H, Liu W, Zhang Y, Liu H and Jin Y: Integration of a calcined bovine bone and BMSC-sheet 3D scaffold and the promotion of bone regeneration in large defects. Biomaterials. 34:9998–10006. 2013. View Article : Google Scholar : PubMed/NCBI

43 

Hiwatashi N, Hirano S, Mizuta M, Tateya I, Kanemaru S, Nakamura T and Ito J: Adipose-derived stem cells versus bone marrow-derived stem cells for vocal fold regeneration. Laryngoscope. 124:E461–E469. 2014. View Article : Google Scholar : PubMed/NCBI

44 

Kwon DS, Gao X, Liu YB, Dulchavsky DS, Danyluk AL, Bansal M, Chopp M, McIntosh K, Arbab AS, Dulchavsky SA and Gautam SC: Treatment with bone marrow-derived stromal cells accelerates wound healing in diabetic rats. Int Wound J. 5:453–463. 2008. View Article : Google Scholar : PubMed/NCBI

45 

Sun L, Fan X, Zhang L, Shi G, Aili M, Lu X, Jiang T and Zhang Y: Bone mesenchymal stem cell transplantation via four routes for the treatment of acute liver failure in rats. Int J Mol Med. 34:987–996. 2014.PubMed/NCBI

46 

Li T, Zhu J, Ma K, Liu N, Feng K, Li X, Wang S and Bie P: Autologous bone marrow-derived mesenchymal stem cell transplantation promotes liver regeneration after portal vein embolization in cirrhotic rats. J Surg Res. 184:1161–1173. 2013. View Article : Google Scholar : PubMed/NCBI

47 

Schorr O, Borel C, Trepo C, Zoulim F and Hantz O: Effects of liver growth factors on hepadnavirus replication in chronically infected duck hepatocytes. J Hepatol. 44:842–847. 2006. View Article : Google Scholar : PubMed/NCBI

48 

Xie C, Zheng YB, Zhu HP, Peng L and Gao ZL: Human bone marrow mesenchymal stem cells are resistant to HBV infection during differentiation into hepatocytes in vivo and in vitro. Cell Biol Int. 33:493–500. 2009. View Article : Google Scholar : PubMed/NCBI

49 

Rong Q, Zhang L, Su E, Li J, Li J, Liu Z, Huang Z, Ma W, Cao K and Huang J: Bone marrow-derived mesenchymal stem cells are capable of mediating hepatitis B virus infection in injured tissues. J Viral Hepat. 15:607–614. 2008. View Article : Google Scholar : PubMed/NCBI

50 

Matysiak M, Orlowski W, Fortak-Michalska M, Jurewicz A and Selmaj K: Immunoregulatory function of bone marrow mesenchymal stem cells in EAE depends on their differentiation state and secretion of PGE2. J Neuroimmunol. 233:106–111. 2011. View Article : Google Scholar : PubMed/NCBI

51 

Conroy MJ, Mac Nicholas R, Grealy R, Taylor M, Otegbayo JA, O'Dea S, Mulcahy F, Ryan T, Norris S and Doherty DG: Circulating CD56dim natural killer cells and CD56+ T cells that produce interferon-γ or interleukin-10 are expanded in asymptomatic, E antigen-negative patients with persistent hepatitis B virus infection. J Viral Hepat. 22:335–345. 2015. View Article : Google Scholar : PubMed/NCBI

52 

Murray JM and Goyal A: In silico single cell dynamics of hepatitis B virus infection and clearance. J Theor Biol. 366:91–102. 2015. View Article : Google Scholar : PubMed/NCBI

53 

Ito H, Ando T, Ando K, Ishikawa T, Saito K, Moriwaki H and Seishima M: Induction of hepatitis B virus surface antigen-specific cytotoxic T lymphocytes can be up-regulated by the inhibition of indoleamine 2,3-dioxygenase activity. Immunology. 142:614–623. 2014. View Article : Google Scholar : PubMed/NCBI

54 

Xue-Song L, Cheng-Zhong L, Ying Z and Mo-Bin W: Changes of Treg and Th17 cells balance in the development of acute and chronic hepatitis B virus infection. BMC Gastroenterol. 12:432012. View Article : Google Scholar : PubMed/NCBI

55 

Zhang JY, Song CH, Shi F, Zhang Z, Fu JL and Wang FS: Decreased ratio of Treg cells to Th17 cells correlates with HBV DNA suppression in chronic hepatitis B patients undergoing entecavir treatment. PLoS One. 5:e138692010. View Article : Google Scholar : PubMed/NCBI

56 

Djouad F, Plence P, Bony C, Tropel P, Apparailly F, Sany J, Noël D and Jorgensen C: Immunosuppressive effect of mesenchymal stem cells favors tumor growth in allogeneic animals. Blood. 102:3837–3844. 2003. View Article : Google Scholar : PubMed/NCBI

57 

Uzawa A, Mori M, Hayakawa S, Masuda S, Nomura F and Kuwabara S: Expression of chemokine receptors on peripheral blood lymphocytes in multiple sclerosis and neuromyelitis optica. BMC Neurol. 10:1132010. View Article : Google Scholar : PubMed/NCBI

58 

Wang T, Zhao H, Ren H, Guo J, Xu M, Yang R and Han ZC: Type 1 and type 2 T-cell profiles in idiopathic thrombocytopenic purpura. Haematologica. 90:914–923. 2005.PubMed/NCBI

59 

Ma XQ, Ma QY, Wang YY, Gu P and Wang MW: Protein secreted by bone marrow mesenchymal stem cells and its function. J Clin Rehab Tiss Engin Res. 13:2763–2766. 2009.

60 

Liang C, Chen SL, Wang M, Zhai WJ, Zhou Z, Pang AM, Feng SZ and Han MZ: Synergistic immunomodulatory effects of interferon-gamma and bone marrow mesenchymal stem cells. Zhonghua Xue Ye Xue Za Zhi. 34:213–216. 2013.(In Chinese). PubMed/NCBI

61 

Dumoutier L, Van Roost E, Ameye G, Michaux L and Renauld JC: IL-TIF/IL-22: Genomic organization and mapping of the human and mouse genes. Genes Immun. 1:488–494. 2000. View Article : Google Scholar : PubMed/NCBI

62 

Zhang Y, Cobleigh MA, Lian JQ, Huang CX, Booth CJ, Bai XF and Robek MD: A proinflammatory role for interleukin-22 in the immune response to hepatitis B virus. Gastroenterology. 141:1897–1906. 2011. View Article : Google Scholar : PubMed/NCBI

63 

Park O, Wang H, Weng H, Feigenbaum L, Li H, Yin S, Ki SH, Yoo SH, Dooley S, Wang FS, et al: In vivo consequences of liver-specific interleukin-22 expression in mice: Implications for human liver disease progression. Hepatology. 54:252–261. 2011. View Article : Google Scholar : PubMed/NCBI

64 

Hu WH and Ren J: Impact of hepatitis B virus infected serum on the hepatic differentiation of human bone marrow mesenchymal stem cells. Beijing Da Xue Xue Bao. 40:459–464. 2008.(In Chinese). PubMed/NCBI

Related Articles

Journal Cover

May-2017
Volume 15 Issue 5

Print ISSN: 1791-2997
Online ISSN:1791-3004

Sign up for eToc alerts

Recommend to Library

Copy and paste a formatted citation
x
Spandidos Publications style
Zheng WP, Zhang BY, Shen ZY, Yin ML, Cao Y and Song HL: Biological effects of bone marrow mesenchymal stem cells on hepatitis B virus in vitro. Mol Med Rep 15: 2551-2559, 2017.
APA
Zheng, W., Zhang, B., Shen, Z., Yin, M., Cao, Y., & Song, H. (2017). Biological effects of bone marrow mesenchymal stem cells on hepatitis B virus in vitro. Molecular Medicine Reports, 15, 2551-2559. https://doi.org/10.3892/mmr.2017.6330
MLA
Zheng, W., Zhang, B., Shen, Z., Yin, M., Cao, Y., Song, H."Biological effects of bone marrow mesenchymal stem cells on hepatitis B virus in vitro". Molecular Medicine Reports 15.5 (2017): 2551-2559.
Chicago
Zheng, W., Zhang, B., Shen, Z., Yin, M., Cao, Y., Song, H."Biological effects of bone marrow mesenchymal stem cells on hepatitis B virus in vitro". Molecular Medicine Reports 15, no. 5 (2017): 2551-2559. https://doi.org/10.3892/mmr.2017.6330