Open Access

Mitochondrial dynamics and biogenesis indicators may serve as potential biomarkers for diagnosis of myasthenia gravis

  • Authors:
    • Lanqi Li
    • Donghong Cai
    • Huiya Zhong
    • Fengbin Liu
    • Qilong Jiang
    • Jian Liang
    • Peiwu Li
    • Yafang Song
    • Aidong Ji
    • Wei Jiao
    • Jingwei Song
    • Jinqiu Li
    • Zhiwei Chen
    • Qing Li
    • Lingling Ke
  • View Affiliations

  • Published online on: February 24, 2022     https://doi.org/10.3892/etm.2022.11236
  • Article Number: 307
  • Copyright: © Li et al. This is an open access article distributed under the terms of Creative Commons Attribution License.

Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )


Abstract

Due to challenges in diagnosing myasthenia gravis (MG), identifying novel diagnostic biomarkers for this disease is essential. Mitochondria are key organelles that regulate multiple physiological functions, such as energy production, cell proliferation and cell death. In the present study, Mfn1/2, Opa1, Drp1, Fis1, AMPK, PGC‑1α, NRF‑1 and TFAM were compared between patients with MG and healthy subjects to identify potential diagnostic biomarkers for MG. Blood samples were collected from 50 patients with MG and 50 healthy subjects. The participants' demographic information and routine blood test results were recorded. Mitochondrial dynamics were evaluated and levels of Mfn1/2, Opa1, Drp1, Fis1, AMPK, PGC‑1α, NRF‑1 and TFAM were determined in peripheral blood mononuclear cells using western blotting and reverse transcription‑quantitative PCR, respectively. Receiver operating characteristic curve analysis was used to evaluate the diagnostic accuracy of these indicators. The areas under the curve values of Mfn1/2, Opa1, Drp1, Fis1,AMPK, PGC‑1α, NRF‑1 and TFAM were 0.5408‑0.8696. Compared with control subjects, mRNA expression levels of Mfn1/2, Opa1, AMPK, PGC‑1α, NRF‑1 and TFAM were lower, while those of Drp1 and Fis1 were higher in patients with MG. The protein expression levels of all these molecules were lower in patients with MG than in control subjects. These results suggested that mitochondrial dynamics and biogenesis indicators may be diagnostic biomarkers for MG.

Introduction

Myasthenia gravis (MG) is an autoimmune disease characterized by dysfunctional transmission of nerve impulses to muscles (1), which impedes eyelid movement, facial expression, chewing, talking, swallowing and breathing. The global incidence of MG is 1.7-21.3/1,000,000 individuals per year (2). Although studies have shown that the mortality rate of MG is currently lower than two decades ago (3,4), MG still impacts the quality of life of patients. In current clinical practice, MG diagnosis is dependent on disease stage and involves clinical examination based on serum autoantibody detection. The specific diagnostic tools evaluate levels of anti-acetylcholine receptor (AChR) and anti-muscle-specific tyrosine kinase (MuSK) Abs (5). However, ~10% of patients with MG test negative for both anti-AChR and anti-MuSK Abs (6). Therefore, developing novel methods to diagnose MG is vital.

Mitochondria are abundant in muscle cells and provide most of the energy required to maintain daily activity of the human body (7). They are key for energy production and cell proliferation and death (8). Mitochondrial function is regulated and depends on structure, dynamics and biogenesis (9). Mitochondria serve a key role in improving the metabolic quality and plasticity of skeletal muscles by maintaining biogenesis, dynamics and autophagy/mitophagy (10).

Mitofusion 1 (Mfn1), Mfn2, optic atrophy type 1 (Opa1), dynamin-related protein 1 (Drp1) and fission 1 (Fis1) are key factors associated with mitochondrial fusion and fission (11). Mfn1 and Mfn2 are located in the outer mitochondrial membrane (OMM) and regulate mitochondrial fusion. Opa1 is a member of the dynamin family of mechanoenzymes that are localized in the inner MM, where they regulate mitochondrial fusion (12).

Previous studies have indicated that regulation of Mfn2 to restore mitochondrial homeostasis inhibits development of diabetic cardiomyopathy (13,14). Drp1 dissociates in the cytosol, while Fis1 is anchored to the OMM. Specific signals induce transfer of Drp1 from the cytosol to the surface of the organelle where it interacts with Fis1 to complete organelle division (12,15). This physiological process is known as mitochondrial dynamics (8).

AMP-activated protein kinase (AMPK) is an energy metabolism receptor that serves an important role in maintaining balanced energy metabolism in cells (16). Peroxisome proliferator-activated receptor-γ co-activator-1α (PGC-1α) is the primary transcriptional regulator of mitochondrial biogenesis, respiration and oxidative phosphorylation (17). Nuclear respiratory factor-1 (NRF-1) is a nuclear transcription factor that stimulates expression of nuclear genes to enhance mitochondrial respiratory function. Mitochondrial transcription factor A (TFAM), a DNA-binding protein, controls mitochondrial metabolism and dysfunction by regulating the transcription of its genome and organizing mitochondrial DNA (mtDNA) (18). PGC-1α activates TFAM by serving as a co-transcription factor of NRF-1, thereby regulating mitochondrial biogenesis (19).

Previous studies have shown that mitochondria serve a role in the development of rare neuromuscular diseases, such as Duchenne and Becker muscular dystrophy (20,21). Mitochondrial dysfunction affects muscle function, leading to atrophy (22). Muscle weakness is the primary symptom of MG. Both muscle contraction and relaxation require mitochondria for energy supply; the dynamic balance and biogenesis of mitochondria are key for these processes (23). Therefore, it was hypothesized that mitochondrial dynamics and biogenesis factors may serve as diagnostic biomarkers for MG. The aim of the present study was to investigate the differences in mitochondrial dynamics and biogenesis between patients with MG and healthy individuals. Receiver operating characteristics (ROC) curves were plotted using reverse transcription-quantitative (RT-q)PCR data to evaluate the diagnostic value of mitochondria-associated genes, as well as to determine whether mitochondrial dynamics and biogenesis factors can serve as diagnostic biomarkers for MG.

Materials and methods

Participants

Patients with MG (19 males and 31 females) were enrolled from The First Affiliated Hospital of Guangzhou University of Chinese Medicine (Guangzhou, China) between August 2018 and February 2019. Samples from 50 healthy volunteers (25 males, 25 females) were also included in the present cross-sectional study. The following inclusion criteria were used: i) Age, 14-75 years, ii) willing to participate in the study and iii) examination by personnel trained in diagnosis of MG class IIb (based on the clinical classification proposed by the MG Foundation of America) (24). The following exclusion criteria were used: i) Hormone, immunosuppression, plasmapheresis, or intravenous γ globulin treatment during the previous 3 months, ii) serious infectious disease or subsequent complications (such as mental illness; cerebrovascular, heart or liver disease; kidney failure; or malignant tumor) and iii) participation in another clinical study in the past 3 months. All participants understood the experimental procedure and provided written informed consent. Written informed consent was obtained from the parents/guardians of all participants <18 years old. All procedures involving human subjects were approved by the Academic Ethics Committee of The First Affiliated Hospital of Guangzhou University of Chinese Medicine.

Isolation of human peripheral blood mononuclear cells (PBMCs)

Peripheral blood samples (5 ml) were collected in an anticoagulant tube. Within 1 h of sample collection, PBMCs were isolated using Ficoll-Paque™ gradient (GE Healthcare). An equal volume of phosphate buffer was added to dilute the blood sample, which was added to the Ficoll-Paque separating solution and centrifuged at 600 x g for 20 min at 25˚C. The samples were separated into four layers. PBMCs were collected from the second layer (mononuclear cells). PBMCs were washed three times with phosphate-buffered saline and centrifuged (600 x g, 10 min, 4˚C), and then stored at -80˚C (Fig. 1).

Total RNA extraction

Total RNA was isolated from PBMCs using TRIzol® reagent, according to the manufacturer's instructions (Invitrogen; Thermo Fisher Scientific, Inc.). TRIzol reagent (1 ml) and chloroform (0.2 ml) were added to each sample tube. The tubes were mixed for 15 sec, allowed to stand for 3 min and centrifuged at 600 x g for 15 min at 4˚C. The upper aqueous phase was carefully aspirated and transferred to a new tube. An equal volume of isopropanol was added and samples were mixed at 25˚C for 20 min. The samples were centrifuged at 13,000 x g for 10 min at 4˚C to precipitate the RNA and the supernatant was removed. The sediment was washed with 1 ml pre-cooled 75% ethanol and centrifuged again (600 x g, 5 min, 4˚C). After discarding the supernatant, the RNA pellet was dissolved in 30 µl diethyl pyrocarbonate-treated water and stored at -80˚C.

RT-qPCR evaluation of target mRNA expression in PBMCs

Total RNA was extracted from PBMCs using TRIzol® reagent as aforementioned and reverse-transcribed to cDNA using PrimeScript™ RT Master Mix (cat. no. RR036Q; Takara Bio, Inc.) according to the manufacturer's instructions. The mRNA expression levels were measured using SYBR Green Master Mix (cat. no. RR036A; Takara Bio, Inc.) on a CFX96 Real-Time PCR System (Bio-Rad Laboratories, Inc.), according to the manufacturer's instructions, using the following thermocycling conditions: Initial denaturation at 95˚C for 20 sec, followed by 40 cycles of 95˚C for 10 sec, 60˚C for 30 sec and 70˚C for 1 sec. The target gene sequences were obtained from GenBank (https://www.ncbi.nlm.nih.gov/genbank/) and primer sequences for all target genes are listed in Table I. Relative expression was determined using the 2-ΔΔCq method (25). GAPDH was used as the reference gene.

Table I

Primers used for reverse transcription-quantitative PCR.

Table I

Primers used for reverse transcription-quantitative PCR.

GeneForward primer, 5'-3'Reverse primer, 5'-3'
Mfn1 ATGTAACGGACGCCAATC ATCTTTAGCTTCTACTCCCACT
Mfn2 TGCAGGTGTAAGGGACGATT GAGGCTCTGCAAATGGGATG
Opa1 TGTCCTCCGCAAAGTCAT TGCTTGGGAGACCCTACA
Drp1 CAAAGCAGTTTGCCTGTGGA TCTTGGAGGACTATGGCAGC
Fis1 CCAGGTAGAAGACGTAATCCC GTCCAAGAGCACGCAGTTT
AMPK TTGAAACCTGAAAATGTCCTGCT GGTGAGCCACAACTTGTTCTT
PGC-1α TCAGTCCTCACTGGTGGACA TGCTTCGTCGTCAAAAACAG
NRF-1 GGTGCAGCACCTTTGGAGAA CCAGAGCAGACTCCAGGTCTTC
TFAM CACATTTTCCACCTGGTGAT CACTCCGCCCTATAAGCATC
GAPDH AAGAAGGTGGTGAAGCAGG GTCAAAGGTGGAGGAGTGG

[i] Mfn, mitofusion; Opa, optic atrophy; Drp, dynamin-related protein; Fis, fission; AMPK, AMP-activated protein kinase; PGC, peroxisome proliferator-activated receptor-γ co-activator; NRF, nuclear respiratory factor; TFAM, mitochondrial transcription factor A.

Western blotting evaluation of protein expression in PBMCs

PBMCs were lysed on ice with RIPA lysis buffer (cat. no. 78510; Thermo Fisher Scientific, Inc.) and centrifuged at 13,000 x g for 15 min at 4˚C, and then supernatant was collected. Protein concentration was determined using the bicinchoninic acid method. An equal amount (30 µg, 20 µl) of protein was loaded/lane and samples were separated by 12% sodium dodecyl sulfate-polyacrylamide gel electrophoresis. Samples were transferred onto polyvinylidene difluoride membranes using a Trans-Blot Turbo Transfer System (Bio-Rad Laboratories, Inc.) and blocked at 25˚C with 5% non-fat powdered milk for 1.5 h. The membranes were incubated overnight at 4˚C with the following primary antibodies (all Abcam): Anti-Mfn1 (cat. no. ab129154; rabbit; 1:2,000 in 5% non-fat dry milk), anti-Mfn2 (cat. no. ab124773; rabbit; 1:1,000 in 5% non-fat dry milk), anti-Opa1 (cat. no. ab42364; rabbit; 1:2,000 in 5% BSA), anti-Drp1 (cat. no. ab219596; rabbit; 1:2,000 in 5% BSA), anti-Fis1 (cat. no. ab229969; rabbit; 1:200 in 5% non-fat dry milk), anti-AMPK (cat. no. ab80039; mouse; 1:1,000 in 5% non-fat dry milk), anti-phosphorylated-AMPK (cat. no. ab133448; rabbit; 1:1,000 in 5% non-fat dry milk), anti-PGC-1α (cat. no. ab54481; rabbit; 1:1,000 in 5% non-fat dry milk), anti-NRF-1 (cat. no. ab34682; rabbit; 1:1,000 in 5% non-fat dry milk), anti-TFAM (cat. no. ab176558; rabbit; 1:1,000 in 5% non-fat dry milk) and anti-GAPDH (cat. no. ab8245; mouse; 1:5,000 in 5% non-fat dry milk). The membranes were then incubated with goat anti-rabbit (cat. no. ab7085; 1:3,000 in 5% non-fat dry milk) or goat anti-mouse (cat. no. ab7063; 1:3,000 in 5% non-fat dry milk) secondary antibodies for 90 min at 25˚C, then washed three times for 5 min each using Tris-buffered saline and polysorbate 20 (Beijing Solarbio Science & Technology Co., Ltd.). Protein bands were visualized using Clarity™ Western ECL Substrate kit (Bio-Rad Laboratories, Inc.). The chemiluminescent signal was captured using a ChemiDoc™XRS+ system and resulting bands were analyzed using Image Lab software version 3.0 (both Bio-Rad Laboratories, Inc.).

Statistical analysis

The sensitivity and specificity of variables for MG diagnosis were determined by ROC curve analysis using a non-parametric approach. The optimal cutoff values were selected based on those that minimized the sensitivity-specificity difference and maximized the discriminating power of the tests. All data were repeated three times and analyzed using SPSS 22.0 (IBM Corp.) and are expressed as the mean ± standard deviation. Unpaired t-test was used to compare differences between control and MG. P<0.05 was considered to indicate a statistically significant difference.

Results

Participant information

A total of 50 healthy volunteers (25 males and 25 females; mean age, 38.92±14.76 years) were recruited for the control group and 50 patients with MG (19 males and 31 females; mean age, 42.58±13.76 years) were recruited for the MG group. The clinical characteristics of participants are listed in Table II (raw data are shown in Table SI). A higher number of women than men were affected by MG, which was consistent with clinical reports (26,27), and 66% of patients with MG were aged 30-60 years. According to Table II, the proportion of MG patients with a disease span of 0-6 years was 88%. The patients exhibited dysphagia, chewing weakness, thymectomy and thyroid dysfunction (Table II). The hematology results of the patients with MG are shown in Table III. Routine blood examination values were all within normal ranges. The results provide comprehensive information on the participants.

Table II

Clinical characteristics of patients and controls.

Table II

Clinical characteristics of patients and controls.

CharacteristicMG (n=50)Control (n=50)
Sex  
     Male1925
     Female3125
Age, years  
     14-29923
     30-44206
     45-591617
     ≥6054
Course of disease, months  
     0-3636-
     37-728-
     73-1084-
     >1082-
Symptom (+) -
     Neostigmine50-
     AchR-Ab44-
     MuSK-Ab30 
Dysphagia25-
Chewing weakness11-
Thymectomy28-
Thyroid dysfunction10-

[i] MG, myasthenia gravis; AchR, acetylcholine receptor; Ab, antibody; MuSK, muscle-specific tyrosine kinase.

Table III

Hematology results of patients with myasthenia gravis (mean ± SD, n=50).

Table III

Hematology results of patients with myasthenia gravis (mean ± SD, n=50).

VariableMale (n=19)Normal male rangeFemale (n=31)Normal female range
WBC, 103/µl8.59±4.634.0-10.09.94±3.134.0-10.0
RBC, 106/µl4.45±0.574.0-5.54.58±0.623.5-5.0
PLT, 103/µl227.11±60.22100.0-300.0229.78±41.86100.0-300.0
Hb, g/l130.89±19.18120.0-160.0130.42±18.06110.0-150.0

[i] WBC, white blood cell; RBC, red blood cell; PLT, platelet; Hb, hemoglobin.

mRNA expression of Mfn1, Mfn2, Opa1, Drp1, Fis1, AMPK, PGC-1α, NRF-1 and TFAM measured by RT-qPCR

mRNA expression levels of Mfn1, Mfn2 and Opa1 were significantly lower in the MG than the control group (P<0.05; Fig. 2; Table SII). By contrast, mRNA expression of Drp1 and Fis1 was higher in the MG group than the control (P<0.05). In addition, mRNA expression of AMPK, PGC-1α, NRF-1 and TFAM was significantly lower in the MG group than in the control (P<0.05). The results of 6 MG patients who were anti-AChR-negative are shown in Table SIII. According to the comparison of the results, there were differences in mRNA expression between control group and MG group patients (including antibody-negative patients).

Diagnostic value of Mfn1, Mfn2, Opa1, Drp1, Fis1, AMPK, PGC-1α, NRF-1 and TFAM

To determine whether mitochondria-associated genes serve as diagnostic biomarkers for MG, ROC curves were plotted using RT-qPCR data (Fig. 3). In ROC curve analysis (28), the area under the curve (AUC) quantifies the diagnostic potential of each candidate biomarker with a high AUC indicating a more accurate distinction between patients with MG and controls. AUCs were 0.8628 for PGC-1α, 0.8696 for NRF-1, 0.8072 for TFAM, 0.6488 for Mfn1, 0.6441 for Mfn2, 0.6212 for Opa1, 0.6468 for Drp1, 0.6604 for Fis1 and 0.5408 for AMPK (Fig. 3A-I). The results showed that mitochondrial energy metabolism (as measured by PCG-1α, NRF-1 and TFAM) had higher diagnostic value for MG.

Evaluation of Mfn1, Mfn2, Opa1, Drp1, Fis1, AMPK, PGC-1α, NRF-1 and TFAM expression by western blotting

Western blotting was performed to determine whether proteins were differentially expressed between control and MG groups. Mitochondrial dynamics-associated proteins (Mfn1, Mfn2, Opa1, Drp1 and Fis1) were expressed at significantly lower levels in PBMCs from patients with MG than in control subjects (P<0.05; Fig. 4). Mitochondrial biogenesis-associated proteins (AMPK, PGC-1α, NRF-1 and TFAM) were also expressed at lower levels in patients with MG than in control subjects (P<0.05; Fig. 5). The results indicate that these mitochondrial markers may have diagnostic value for MG.

Discussion

Mitochondria are abundantly present in skeletal muscle fibrils, which require large amounts of ATP for contraction and diastolic movement (29). Mitochondria are semi-autonomous organelles that are key sites of tricarboxylic acid cycle reactions; their normal function determines whether skeletal muscles contract freely and flexibly (30). The accepted mechanism of skeletal muscle contraction (sliding filament theory) asserts that, when stimulated by neurotransmitters and in the presence of ATP hydrolysis, muscle myosin and actin perform muscle contraction by sliding on muscle fibers, leading to overall macro fiber shortening and densifying (31). Furthermore, studies (32,33) have shown that muscle cells in patients with MG are highly sensitive to energy deficiency, which affects signal transduction and normal physiological activity of the neuromuscular junction. Histopathological analysis of extraocular muscle tissues of patients with MG has shown that myopathic features predominantly include substitution of muscle fibers by adipocytes and mitochondrial dysfunction at the ultrastructural level (34). Another study reported mitochondrial dysfunction in a patient with early-stage muscular dystrophy; these abnormal mitochondria were susceptible to further damage following sarcolemma injury (35). These results suggest that mitochondrial and neuromuscular disease are associated. Insufficient mitochondrial ATP synthesis leads to development of muscle movement disorders and clinical MG symptoms, such as limb weakness, eyelid ptosis, chewing weakness, dysphagia and respiratory muscle paralysis (Fig. 6).

The most common method for MG diagnosis in clinical practice includes assessment of symptoms and signs of MG and a positive test for specific autoantibodies (36). However, a portion of patients with MG are not diagnosed as anti-AChR or anti-MuSK positive; thus, this method should be complemented.

By contrast with previous studies (37,38) on MG that have concentrated on the immune system, the present study investigated mitochondrial dysfunction in muscles as a potential mechanism for MG. A large number of patients were needed to achieve reasonable results but the invasive nature of muscle tissue sampling causes pain and imposes a psychological burden on participants, resulting in reluctance to enroll in this type of study. This was a limitation of the present study. However, collecting blood samples for PBMC isolation is relatively painless, involves a simple procedure and has high patient compliance, which increases the feasibility of long-term research. PBMCs are used to identify cellular dysfunction associated with the pathophysiology of Parkinson's disease, a neurodegenerative disorder, such as decreased proteasome activity and mitochondrial dysfunction (39). Yalçınkaya et al (40) reported that gene expression analysis using PBMCs is a simple diagnostic method for Parkinson's disease. This research provided a reference for the present study to analyze the diagnostic value of MG by PBMCs.

Mitochondrial fission and fusion are key for immature cell proliferation as they provide cells with an adequate number of mature mitochondria for effective bioenergy genesis (41). Mitochondrial fusion helps mitochondria resist oxidative stress-induced damage (42). Studies have shown that mitochondrial fusion and fission impairment may affect mitochondrial function and lead to cardiomyocyte death (43,44).

In the present study, mRNA and protein levels of fusion-associated genes Mfn1/2 and Opa1 were decreased in patients with MG compared with control subjects. Mfn1 promotes fusion of tethering-adjacent mitochondria in coordination with Opa1, whereas Mfn2 acts independently. Mitochondria of cardiomyocytes in Mfn-2-deficient mice are pleiomorphic, enlarged and exhibit functional deterioration (15,45). Santel et al (46) found that the highest mRNA levels of Mfn1 and Mfn2 are present in energy-demanding tissue, such as skeletal muscle, heart and brain, which demonstrates the role of mitochondrial fusion in the energy supply chain.

Fission-associated gene products include Fis1 and Drp1. Drp1 translocates to the OMM following signaling from cytosolic GTPase and active fission sites (45). Fis1 recruits Drp1 to the mitochondria to regulate fission, which is associated with skeletal muscle mass. The impairment of mitochondrial fission has been shown to result in muscle atrophy (8,47). These two proteins were expressed at lower levels in patients with MG than in control subjects. However, in the present study, mRNA expression levels of Drp1 and Fis1 were higher than expected compared with protein levels. Fis1 was barely detected in patients with MG, as confirmed by repeat testing. Therefore, it was hypothesized that other factors may have influenced the translation process to decrease protein synthesis. Untranslated regions (UTRs) determine the fate of proteins by regulating their interactions. In most cases, single-stranded miRNAs are not fully complementary to the 3'-UTR of their target mRNA, thus blocking translation and regulating gene expression. Synthetic 5'-UTR RNA structures regulate protein translation in mammalian cells (48,49). Circular RNAs also exhibit a potent translation regulatory function via their sponge function (50). These mechanisms only affect protein levels, not mRNA stability. Further investigation is required to determine the mechanism underlying differences in mRNA and protein expression levels.

Mitochondrial dynamics and biogenesis are reciprocally coupled. Mitochondrial fission-associated proteins induce opening of the mitochondrial permeability transition pore channel, which leads to changes in mitochondrial membrane potential and reactions in the mitochondrial respiratory chain (51), which enhance mitochondrial biogenesis.

Mitochondrial biogenesis serves a vital role in metabolic health and plasticity. AMPK is an energy metabolism receptor that phosphorylates PGC-1α and activates SIRT1 by increasing cellular NAD+ levels. Furthermore, AMPK leads to increased expression of PGC-1α (17). SIRT1 has been shown to interact with PGC-1α to enhance mitochondrial biogenesis (52). The overexpression of PGC-1α is an effective therapy for age-associated muscle loss. In addition, PGC-1α-deficient mice exhibit neurodegeneration, suggesting that PGC-1α may be involved in the pathogenesis of neuromuscular disease (53,54). PGC-1α interacts with NRF-1, a member of the NRF-1 Cap'n'collar-Basic leucine zipper protein family of nuclear transcription factors, to increase TFAM expression and regulate mitochondrial biosynthesis. NRF-1 stimulates nuclear gene expression to promote mitochondrial respiratory reactions. TFAM is a member of the high-mobility-group-box domain-containing protein family that initiates transcription of mtDNA. Conditional knockout of TFAM in dopaminergic neurons in MitoPark mice results in decreased mtDNA levels (55,56). Therefore, biosynthesis promotes mitochondrial ATP synthesis and increases the number of mitochondria to provide an energy reservoir for skeletal muscle contraction (57,58).

Preliminary work by our group on the gastrocnemius muscle tissue of a rat model of autoimmune MG, in which mitochondria are vacuolated, showed that the cristae were broken, expression levels of fusion- and fission-associated proteins were decreased and Na+/K+-ATPase and Ca2+/Mg2+-ATPase activity was decreased compared with control rats (59,60). ATPase activity was decreased to varying degrees in this rat model, leading to a decrease in ATP synthesis and inability of muscles to complete contraction and diastolic movement. Ke et al (33) suggested that the mitochondrial biogenesis signaling pathway is associated with MG, verifying the association between MG and mitochondrial dynamics and biogenesis.

In the present study, expression levels of fusion-associated proteins Mfn1/2 and Opa1 and fission-associated proteins Fis1 and Drp1 were significantly lower in patients with MG than in control subjects. However, the mRNA expression levels of Mfn1, Mfn2 and Opa1 decreased, while those of Fis1 and Drp1 increased in patients with MG compared with control subjects. Both the protein and mRNA expression levels of mitochondrial biogenesis-associated factors AMPK, PGC-1α, NRF-1 and TFAM were decreased in PBMCs of patients with MG. Of 50 patients with MG included in the present study, 6 patients were anti-AChR-negative. Gene expression analysis in these patients (anti-AChR-negative) demonstrated that mRNA expression level was consistent with the whole sample (including anti-AChR-negative and -positive) result, indicating that this subset of patients also have mitochondrial energy metabolism decreased.

ROC curve analysis showed that mitochondrial dynamics- and biogenesis-associated factors were specific and sensitive for diagnosing MG. Excluding AMPK, AUC values of the Mfn1/2, Opa1, Fis1, Drp1, PGC-1α, NRF-1 and TFAM were 0.6212-0.8696 (P<0.05). Furthermore, the AUC values of PGC-1α, NRF-1 and TFAM were >0.8. A higher AUC value indicates a greater potential to distinguish patients from controls. Thus, ROC curve analysis indicated that these proteins may serve as promising biomarkers for MG. However, the present study had limitations. In the absence of clinical diagnosis, it is difficult to distinguish MG from other types of mitochondria-associated disease based on levels of mitochondrial indicators. In addition, the present study only collected patients with type IIb MG and obtained AUC>0.8, but this result is not comprehensive. The present study did not determine the explicit mechanism that how suffering MG underlying mitochondrial function disorder and to distinguish MG from other types of mitochondria-associated disease. In future, the potential diagnostic value of mitochondria-associated indicators in MG should be further researched.

In conclusion, expression levels of mitochondrial dynamics- and biogenesis-associated factors in PBMCs were significantly different between patients with MG and control subjects. These factors may serve as potential diagnostic biomarkers for MG.

Supplementary Material

Row datas of clinical characteristics.
mRNA expression levels in patients with anti-AChR-negative MG and healthy controls.
The comparisons among the mRNA expression levels between patients with MG (including 6 AChR-Ab-negative patients) and the control group.

Acknowledgements

Not applicable.

Funding

Funding: The present study was supported by National Natural Science Foundation of China (grant no. 81473568).

Availability of data and materials

The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.

Authors' contributions

YS conceived and designed the experiments. LL, DC and HZ performed most of experiments and drafted the manuscript. JLiang, AJ and FL performed the formal analysis and interpretation of data. YS provided funding and gave final approval of the version to be published. JLi, ZC, QJ and PL carried out part of the PCR experiments and collected all clinical data. JS and WJ performed isolation of PBMCs and revised the manuscript from a critical perspective for important intellectual content. QL and LK performed the statistical analysis, confirmed the authenticity of all the raw data and gave final approval of the version to be published. JS and WJ agreed to be accountable for all aspects of the work in ensuring that questions related to the accuracy or integrity of any part of the work are appropriately investigated and resolved. All authors have read and approved the final manuscript.

Ethics approval and consent to participate

All participants understood the experimental procedure and provided written informed consent. Written informed consent was obtained from parents/guardians of all participants <18 years old. All procedures involving human subjects were approved by the Academic Ethics Committee of The First Affiliated Hospital of Guangzhou University of Chinese Medicine [approval no. ZYYZCK(2018)075].

Patient consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

References

1 

Binks S, Vincent A and Palace J: Myasthenia gravis: A clinical-immunological update. J Neurol. 263:826–834. 2016.PubMed/NCBI View Article : Google Scholar

2 

Berrih-Aknin S, Frenkian-Cuvelier M and Eymard B: Diagnostic and clinical classification of autoimmune myasthenia gravis. J Autoimmun. 48-49:143–148. 2014.PubMed/NCBI View Article : Google Scholar

3 

Hehir MK and Silvestri NJ: Generalized myasthenia gravis: Classification, clinical presentation, natural history, and epidemiology. Neurol Clin. 36:253–260. 2018.PubMed/NCBI View Article : Google Scholar

4 

Sieb JP: Myasthenia gravis: An update for the clinician. Clin Exp Immunol. 175:408–418. 2014.PubMed/NCBI View Article : Google Scholar

5 

Szczudlik P, Sobieszczuk E, Szyluk B, Lipowska M, Kubiszewska J and Kostera-Pruszczyk A: Determinants of quality of life in myasthenia gravis patients. Front Neurol. 11(553626)2020.PubMed/NCBI View Article : Google Scholar

6 

Mantegazza R and Cavalcante P: Diagnosis and treatment of myasthenia gravis. Curr Opin Rheumatol. 31:623–633. 2019.PubMed/NCBI View Article : Google Scholar

7 

Bastian TW, von Hohenberg WC, Georgieff MK and Lanier LM: Chronic energy depletion due to iron deficiency impairs dendritic mitochondrial motility during hippocampal neuron development. J Neurosci. 39:802–813. 2019.PubMed/NCBI View Article : Google Scholar

8 

Romanello V and Sandri M: Mitochondrial quality control and muscle mass maintenance. Front Physiol. 6(422)2016.PubMed/NCBI View Article : Google Scholar

9 

Meyer JN, Leuthner TC and Luz AL: Mitochondrial fusion, fission, and mitochondrial toxicity. Toxicology. 391:42–53. 2017.PubMed/NCBI View Article : Google Scholar

10 

Fix DK, Hardee JP, Gao S, VanderVeen BN, Velázquez KT and Carson JA: Role of gp130 in basal and exercise-trained skeletal muscle mitochondrial quality control. J Appl Physiol (1985). 124:1456–1470. 2018.PubMed/NCBI View Article : Google Scholar

11 

Forrester SJ, Preston KJ, Cooper HA, Boyer MJ, Escoto KM, Poltronetti AJ, Elliott KJ, Kuroda R, Miyao M, Sesaki H, et al: Mitochondrial fission mediates endothelial inflammation. Hypertension. 76:267–276. 2020.PubMed/NCBI View Article : Google Scholar

12 

Chiong M, Cartes-Saavedra B, Norambuena-Soto I, Mondaca-Ruff D, Morales PE, García-Miguel M and Mellado R: Mitochondrial metabolism and the control of vascular smooth muscle cell proliferation. Front Cell Dev Biol. 2(72)2014.PubMed/NCBI View Article : Google Scholar

13 

Hu L, Ding M, Tang D, Gao E, Li C, Wang K, Qi B, Qiu J, Zhao H, Chang P, et al: Targeting mitochondrial dynamics by regulating Mfn2 for therapeutic intervention in diabetic cardiomyopathy. Theranostics. 9:3687–3706. 2019.PubMed/NCBI View Article : Google Scholar

14 

Gao Q, Wang XM, Ye HW, Yu Y, Kang PF, Wang HJ, Guan SD and Li ZH: Changes in the expression of cardiac mitofusin-2 in different stages of diabetes in rats. Mol Med Rep. 6:811–814. 2012.PubMed/NCBI View Article : Google Scholar

15 

Li Y and Liu X: Novel insights into the role of mitochondrial fusion and fission in cardiomyocyte apoptosis induced by ischemia/reperfusion. J Cell Physiol. 233:5589–5597. 2018.PubMed/NCBI View Article : Google Scholar

16 

Zhang M, Wu J, Sun R, Tao X, Wang X, Kang Q, Wang H, Zhang L, Liu P, Zhang J, et al: SIRT5 deficiency suppresses mitochondrial ATP production and promotes AMPK activation in response to energy stress. PLoS One. 14(e0211796)2019.PubMed/NCBI View Article : Google Scholar

17 

Wen JJ, Cummins CB, Szczesny B and Radhakrishnan RS: Cardiac dysfunction after burn injury: Role of the AMPK-SIRT1-PGC1α-NFE2L2-ARE Pathway. J Am Coll Surg. 230:562–571. 2020.PubMed/NCBI View Article : Google Scholar

18 

Lv J, Bhatia M and Wang X: Roles of mitochondrial DNA in energy metabolism. Adv Exp Med Biol. 1038:71–83. 2017.PubMed/NCBI View Article : Google Scholar

19 

Zhao Q, Tian Z, Zhou G, Niu Q, Chen J, Li P, Dong L, Xia T, Zhang S and Wang A: SIRT1-dependent mitochondrial biogenesis supports therapeutic effects of resveratrol against neurodevelopment damage by fluoride. Theranostics. 10:4822–4838. 2020.PubMed/NCBI View Article : Google Scholar

20 

Araujo BG, Souza E, Silva LF, de Barros Torresi JL, Siena A, Valerio BCO, Brito MD and Rosenstock TR: Decreased mitochondrial function, biogenesis, and degradation in peripheral blood mononuclear cells from amyotrophic lateral sclerosis patients as a potential tool for biomarker research. Mol Neurobiol. 57:5084–5102. 2020.PubMed/NCBI View Article : Google Scholar

21 

Santacatterina F, Chamorro M, de Arenas CN, Navarro C, Martín MA, Cuezva JM and Sánchez-Aragó M: Quantitative analysis of proteins of metabolism by reverse phase protein microarrays identifies potential biomarkers of rare neuromuscular diseases. J Transl Med. 13(65)2015.PubMed/NCBI View Article : Google Scholar

22 

Oh KH, Sheoran S, Richmond JE and Kim H: Alcohol induces mitochondrial fragmentation and stress responses to maintain normal muscle function in Caenorhabditis elegans. FASEB J. 34:8204–8216. 2020.PubMed/NCBI View Article : Google Scholar

23 

Sligar J, Debruin DA, Saner NJ, Philp AM and Philp A: The importance of mitochondrial quality control for maintaining skeletal muscle function across healthspan. Am J Physiol Cell Physiol: Feb 2, 2022 (Epub ahead of print). doi: 10.1152/ajpcell.00388.2021.

24 

Sanders DB, Wolfe GI, Benatar M, Evoli A, Gilhus NE, Illa I, Kuntz N, Massey JM, Melms A, Murai H, et al: International consensus guidance for management of myasthenia gravis: Executive summary. Neurology. 87:419–425. 2016.PubMed/NCBI View Article : Google Scholar

25 

Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods. 25:402–408. 2001.PubMed/NCBI View Article : Google Scholar

26 

Anil R, Kumar A, Alaparthi S, Sharma A, Nye JL, Roy B, O'Connor KC and Nowak RJ: Exploring outcomes and characteristics of myasthenia gravis: Rationale, aims and design of registry-The EXPLORE-MG registry. J Neurol Sci. 414(116830)2020.PubMed/NCBI View Article : Google Scholar

27 

Park JS, Eah KY and Park JM: Epidemiological profile of myasthenia gravis in South Korea using the national health insurance database. Acta Neurol Scand: Feb 9, 2022 (Epub ahead of print). doi: 10.1111/ane.13596.

28 

Zou M, Liu Z, Zhang XS and Wang Y: NCC-AUC: An AUC optimization method to identify multi-biomarker panel for cancer prognosis from genomic and clinical data. Bioinformatics. 31:3330–3338. 2015.PubMed/NCBI View Article : Google Scholar

29 

Zhang S, Ding JH, Zhou F, Wang ZY, Zhou XQ and Hu G: Iptakalim ameliorates MPP + -induced astrocyte mitochondrial dysfunction by increasing mitochondrial complex activity besides opening mitoK(ATP) channels. J Neurosci Res. 87:1230–1239. 2009.PubMed/NCBI View Article : Google Scholar

30 

Shally A and McDonagh B: The redox environment and mitochondrial dysfunction in age-related skeletal muscle atrophy. Biogerontology. 21:461–473. 2020.PubMed/NCBI View Article : Google Scholar

31 

Powers JD, Malingen SA, Regnier M and Daniel TL: The sliding filament theory since Andrew Huxley: Multiscale and multidisciplinary muscle research. Annu Rev Biophys. 50:373–400. 2021.PubMed/NCBI View Article : Google Scholar

32 

Ruiter AM, Verschuuren JJGM and Tannemaat MR: Fatigue in patients with myasthenia gravis. A systematic review of the literature. Neuromuscul Disord. 30:631–639. 2020.PubMed/NCBI View Article : Google Scholar

33 

Ke L, Li Q, Song J, Jiao W, Ji A, Chen T, Pan H and Song Y: The mitochondrial biogenesis signaling pathway is a potential therapeutic target for myasthenia gravis via energy metabolism (Review). Exp Ther Med. 22(702)2021.PubMed/NCBI View Article : Google Scholar

34 

Rautenbach RM, Pillay K, Murray ADN and Heckmann JM: Extraocular muscle findings in myasthenia gravis associated treatment-resistant ophthalmoplegia. J Neuroophthalmol. 37:414–417. 2017.PubMed/NCBI View Article : Google Scholar

35 

Vila MC, Rayavarapu S, Hogarth MW, Van der Meulen JH, Horn A, Defour A, Takeda S, Brown KJ, Hathout Y, Nagaraju K and Jaiswal JK: Mitochondria mediate cell membrane repair and contribute to Duchenne muscular dystrophy. Cell Death Differ. 24:330–342. 2017.PubMed/NCBI View Article : Google Scholar

36 

Gilhus NE: Myasthenia Gravis. N Engl J Med. 375:2570–2581. 2016.PubMed/NCBI View Article : Google Scholar

37 

Punga AR, Maddison P, Heckmann JM, Guptill JT and Evoli A: Epidemiology, diagnostics, and biomarkers of autoimmune neuromuscular junction disorders. Lancet Neurol. 21:176–188. 2022.PubMed/NCBI View Article : Google Scholar

38 

Smith VM, Nguyen H, Rumsey JW, Long CJ, Shuler ML and Hickman JJ: A Functional Human-on-a-Chip autoimmune disease model of myasthenia gravis for development of therapeutics. Front Cell Dev Biol. 9(745897)2021.PubMed/NCBI View Article : Google Scholar

39 

White AJ, Wijeyekoon RS, Scott KM, Gunawardana NP, Hayat S, Solim IH, McMahon HT, Barker RA and Williams-Gray CH: The Peripheral Inflammatory Response to Alpha-Synuclein and Endotoxin in Parkinson's Disease. Front Neurol. 9(946)2018.PubMed/NCBI View Article : Google Scholar

40 

Yalçınkaya N, Haytural H, Bilgiç B, Özdemir Ö, Hanağası H, Küçükali Cİ, Özbek Z, Akcan U, İdrisoğlu HA, Gürvit H and Tüzün E: Expression changes of genes associated with apoptosis and survival processes in Parkinson's disease. Neurosci Lett. 615:72–77. 2016.PubMed/NCBI View Article : Google Scholar

41 

Ding Q, Qi Y and Tsang SY: Mitochondrial biogenesis, mitochondrial dynamics, and mitophagy in the maturation of cardiomyocytes. Cells. 10(2463)2021.PubMed/NCBI View Article : Google Scholar

42 

Ahmed ME, Selvakumar GP, Kempuraj D, Thangavel R, Mentor S, Dubova I, Raikwar SP, Zaheer S, Iyer S and Zaheer A: Synergy in disruption of mitochondrial dynamics by Aβ (1-42) and glia maturation factor (GMF) in SH-SY5Y cells is mediated through alterations in fission and fusion proteins. Mol Neurobiol. 56:6964–6975. 2019.PubMed/NCBI View Article : Google Scholar

43 

Gao J, Zhao L, Wang J, Zhang L, Zhou D, Qu J, Wang H, Yin M, Hong J and Zhao W: C-Phycocyanin ameliorates mitochondrial fission and fusion dynamics in ischemic cardiomyocyte damage. Front Pharmacol. 10(733)2019.PubMed/NCBI View Article : Google Scholar

44 

Zhang Q, Guo D and Wang Y, Wang X, Wang Q, Wu Y, Li C, Wang W and Wang Y: Danqi pill protects against heart failure post-acute myocardial infarction via HIF-1α/PGC-1α mediated glucose metabolism pathway. Front Pharmacol. 11(458)2020.PubMed/NCBI View Article : Google Scholar

45 

Iqbal S and Hood DA: The role of mitochondrial fusion and fission in skeletal muscle function and dysfunction. Front Biosci (Landmark Ed). 20:157–172. 2015.PubMed/NCBI View Article : Google Scholar

46 

Santel A, Frank S, Gaume B, Herrler M, Youle RJ and Fuller MT: Mitofusin-1 protein is a generally expressed mediator of mitochondrial fusion in mammalian cells. J Cell Sci. 116:2763–2774. 2003.PubMed/NCBI View Article : Google Scholar

47 

Fix DK, VanderVeen BN, Counts BR and Carson JA: Regulation of skeletal muscle DRP-1 and FIS-1 protein expression by IL-6 signaling. Oxid Med Cell Longev. 2019(8908457)2019.PubMed/NCBI View Article : Google Scholar

48 

Eisenhut P, Mebrahtu A, Moradi Barzadd M, Thalén N, Klanert G, Weinguny M, Sandegren A, Su C, Hatton D, Borth N and Rockberg J: Systematic use of synthetic 5'-UTR RNA structures to tune protein translation improves yield and quality of complex proteins in mammalian cell factories. Nucleic Acids Res. 48(e119)2020.PubMed/NCBI View Article : Google Scholar

49 

Mayr C: Regulation by 3'-Untranslated Regions. Annu Rev Genet. 51:171–194. 2017.PubMed/NCBI View Article : Google Scholar

50 

Prats AC, David F, Diallo LH, Roussel E, Tatin F, Garmy-Susini B and Lacazette E: Circular RNA, the key for translation. Int J Mol Sci. 21(8591)2020.PubMed/NCBI View Article : Google Scholar

51 

Cortassa S, Aon MA, Winslow RL and O'Rourke B: A mitochondrial oscillator dependent on reactive oxygen species. Biophys J. 87:2060–2073. 2004.PubMed/NCBI View Article : Google Scholar

52 

Reutzel M, Grewal R, Dilberger B, Silaidos C, Joppe A and Eckert GP: Cerebral mitochondrial function and cognitive performance during aging: A longitudinal study in NMRI mice. Oxid Med Cell Longev. 2020(4060769)2020.PubMed/NCBI View Article : Google Scholar

53 

Xiang Z, Valenza M, Cui L, Leoni V, Jeong HK, Brilli E, Zhang J, Peng Q, Duan W, Reeves SA, et al: Peroxisome-proliferator-activated receptor gamma coactivator 1 α contributes to dysmyelination in experimental models of Huntington's disease. J Neurosci. 31:9544–9553. 2011.PubMed/NCBI View Article : Google Scholar

54 

Jones AW, Yao Z, Vicencio JM, Karkucinska-Wieckowska A and Szabadkai G: PGC-1 family coactivators and cell fate: Roles in cancer, neurodegeneration, cardiovascular disease and retrograde mitochondria-nucleus signalling. Mitochondrion. 12:86–99. 2012.PubMed/NCBI View Article : Google Scholar

55 

Martín-Jiménez R, Lurette O and Hebert-Chatelain E: Damage in mitochondrial DNA associated with Parkinson's Disease. DNA Cell Biol. 39:1421–1430. 2020.PubMed/NCBI View Article : Google Scholar

56 

Islam H, Bonafiglia JT, Turnbull PC, Simpson CA, Perry CGR and Gurd BJ: The impact of acute and chronic exercise on Nrf2 expression in relation to markers of mitochondrial biogenesis in human skeletal muscle. Eur J Appl Physiol. 120:149–160. 2020.PubMed/NCBI View Article : Google Scholar

57 

Piao Y, Kim HG, Oh MS and Pak YK: Overexpression of TFAM, NRF-1 and myr-AKT protects the MPP(+)-induced mitochondrial dysfunctions in neuronal cells. Biochim Biophys Acta. 1820:577–585. 2012.PubMed/NCBI View Article : Google Scholar

58 

Ramachandran B, Yu G and Gulick T: Nuclear respiratory factor 1 controls myocyte enhancer factor 2A transcription to provide a mechanism for coordinate expression of respiratory chain subunits. J Biol Chem. 283:11935–11946. 2008.PubMed/NCBI View Article : Google Scholar

59 

Song J, Lei X, Jiao W, Song Y, Chen W, Li J and Chen Z: Effect of Qiangji Jianli decoction on mitochondrial respiratory chain activity and expression of mitochondrial fusion and fission proteins in myasthenia gravis rats. Sci Rep. 8(8623)2018.PubMed/NCBI View Article : Google Scholar

60 

Jiao W, Hu F, Li J, Song J, Liang J, Li L, Song Y, Chen Z, Li Q and Ke L: Qiangji Jianli Decoction promotes mitochondrial biogenesis in skeletal muscle of myasthenia gravis rats via AMPK/PGC-1α signaling pathway. Biomed Pharmacother. 129(110482)2020.PubMed/NCBI View Article : Google Scholar

Related Articles

Journal Cover

April-2022
Volume 23 Issue 4

Print ISSN: 1792-0981
Online ISSN:1792-1015

Sign up for eToc alerts

Recommend to Library

Copy and paste a formatted citation
x
Spandidos Publications style
Li L, Cai D, Zhong H, Liu F, Jiang Q, Liang J, Li P, Song Y, Ji A, Jiao W, Jiao W, et al: Mitochondrial dynamics and biogenesis indicators may serve as potential biomarkers for diagnosis of myasthenia gravis. Exp Ther Med 23: 307, 2022
APA
Li, L., Cai, D., Zhong, H., Liu, F., Jiang, Q., Liang, J. ... Ke, L. (2022). Mitochondrial dynamics and biogenesis indicators may serve as potential biomarkers for diagnosis of myasthenia gravis. Experimental and Therapeutic Medicine, 23, 307. https://doi.org/10.3892/etm.2022.11236
MLA
Li, L., Cai, D., Zhong, H., Liu, F., Jiang, Q., Liang, J., Li, P., Song, Y., Ji, A., Jiao, W., Song, J., Li, J., Chen, Z., Li, Q., Ke, L."Mitochondrial dynamics and biogenesis indicators may serve as potential biomarkers for diagnosis of myasthenia gravis". Experimental and Therapeutic Medicine 23.4 (2022): 307.
Chicago
Li, L., Cai, D., Zhong, H., Liu, F., Jiang, Q., Liang, J., Li, P., Song, Y., Ji, A., Jiao, W., Song, J., Li, J., Chen, Z., Li, Q., Ke, L."Mitochondrial dynamics and biogenesis indicators may serve as potential biomarkers for diagnosis of myasthenia gravis". Experimental and Therapeutic Medicine 23, no. 4 (2022): 307. https://doi.org/10.3892/etm.2022.11236